Previous Article | Next Article ![]()
Applied and Environmental Microbiology, October 2005, p. 6418-6422, Vol. 71, No. 10
0099-2240/05/$08.00+0 doi:10.1128/AEM.71.10.6418-6422.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
| SHORT REPORT |
Istituto di Patologia Speciale e Clinica Medica Veterinaria, Università degli Studi di Sassari, Via Vienna 2, 07100 Sassari, Italy,1 School of Agriculture, Food and Rural Development, King George VI Building, King's Road, University of Newcastle, Newcastle upon Tyne NE1 7RU, United Kingdom2
Received 11 January 2005/ Accepted 17 May 2005
|
|
|---|
|
|
|---|
To date, only two HGA cases have been reported in continental Italy (14). However, serological and molecular findings demonstrated the occurrence of A. phagocytophilum infections in dogs and Ixodes ricinus ticks in this country (9, 15, 17). An average rate of 13.4 tick bite-related disease cases/year/100,000 inhabitants was reported for the island of Sardinia between 1992 and 1996, compared to the national average value of 2.1 cases/year/100,000 inhabitants. Moreover, 117 cases of tick bite-related disease whose etiology remains obscure were registered between 1995 and 2002.
Indirect immunofluorescence is commonly used for A. phagocytophilum diagnosis, but it should take into account coinfection, cross-reactivity among different pathogens (5, 7, 13, 16), and seroconversion (2). The diagnostic strategy has therefore focused on molecular methods based on PCR approaches (10). PCR methods should be highly specific, and a recently developed PCR assay for amplification of the A. phagocytophilum 16S rRNA gene resulted in coamplification of the Anaplasma platys gene (6).
In order to establish the presence of A. phagocytophilum in an area of Sardinia characterized by a high incidence of tick bite-related diseases in dogs and humans and to compare Sardinian strains with American and European isolates, symptomatic dogs and horses were tested by a molecular method able to distinguish A. phagocytophilum from A. platys. To accomplish this, a strategy based on groEL PCR-restriction fragment length polymorphism and sequence analysis, an alternative to the 16S rRNA-based PCR method, was used.
Between 2002 and 2004, veterinarians based in central Sardinia were instructed to collect blood samples when a suspected case of tick bite-related disease was found in their clinics. A total of 40 blood samples were collected from 40 dogs showing tick infestation and symptoms consistent with tick bite-related disease, such as fever, anorexia, depression, anemia, myalgia, and a reluctance to move. Clinical hematology indicated thrombocytopenia and anemia. Moreover, 20 blood samples were obtained from 20 horses showing tick infestation, hyperthermia, anemia, anorexia, jaundice, myalgia, and a reluctance to move.
Genomic DNA was extracted from the buffy coat obtained by centrifugation of 2 to 4 ml of blood as previously described (12). A. phagocytophilum genomic DNA (NCH-1 strain) was extracted from FA substrate slides (VMRD, Inc.) and used as a positive control in canine granulocytic anaplasmosis-specific PCRs. A DNA preparation of a southern Italy A. platys isolate was used as a positive control in infectious cyclic thrombocytopenia-specific PCRs. Based on an alignment of the heat shock protein groEL gene sequences available in the GenBank database for species belonging to the family Anaplasmataceae, four primers were generated and used in combination in two heminested PCRs. Primers EphplgroEL(569)F (ATGGTATGCAGTTTGATCGC) and EphplgroEL(1193)R (TCTACTCTGTCTTTGCGTTC) anneal to nucleotide strings conserved in A. phagocytophilum and A. platys and were designed to selectively amplify, in a first PCR round, 624 bp of the groEL gene of both species from clinical samples. EphgroEL(1142)R (TTGAGTACAGCAACACCACCGGAA) and EplgroEL(1084)R (CATAGTCTGAAGTGGAGGAC) are specific for A. phagocytophilum and A. platys, respectively, and were alternatively coupled with primer EphplgroEL(569)F in two heminested PCRs in which the amplification products obtained from the first PCR round were used as DNA templates. The final 50-µl PCR mixture from the first PCR round contained 5 µl of the DNA extract, 1 µM primer EphplgroEL(569)F, 1 µM primer EphplgroEL(1142)R, and HotMaster Taq DNA polymerase (5 U/µl; Eppendorf) according to the manufacturer's basic protocols for cycle profiling and mixture composition. Five microliters of the PCR products obtained from the first PCR round was used as the template DNA in each of the two heminested PCRs. The heminested PCR profiles were the same as the profiles in the first PCR round, except for the reverse primer used [EphgroEL(1142)R for the A. phagocytophilum-specific heminested PCR and EplgroEL(1084)R for the A. platys-specific heminested PCR]. Amplicons were digested with restriction endonuclease HindIII. The HindIII restriction pattern of the A. phagocytophilum groEL gene amplified region (three fragments, 525 bp, 21 bp, and 27 bp) is different from the restriction pattern produced after digestion of amplicons of the A. platys groEL gene (two fragments, 199 bp and 316 bp). An ABI PRISM Big Dye terminator cycle sequencing Ready Reaction kit (Applied Biosystems) was used for direct cycle sequencing of the PCR products obtained according to the protocol supplied by the manufacturer. To ensure that polymorphisms did not represent PCR errors, all the amplicons obtained were cloned into the pCR2.1-TOPO vector (Invitrogen), and three clones per sample were sequenced using universal M13 primers. The sequences generated were edited with CHROMAS (Technelysium Pty. Ltd., Australia). Based on alignment of all the A. phagocytophilum groEL sequences available in the GenBank database with the sequences of A. phagocytophilum generated during this study (573 bp), 39 type sequences were identified (Table 1). The 39 groEL type sequences were used as operational taxonomic units (OTUs) for phylogenetic analyses, which were performed with MEGA, version 3.0 (8). Genetic distances among the OTUs were expressed as percent total nucleotide differences or by the Kimura two-parameter method and were used to construct neighbor-joining (NJ) trees. Statistical support for internal branches of the trees was evaluated by bootstrapping. Maximum-parsimony (MP) trees and consensus values were also generated.
|
View this table: [in a new window] |
TABLE 1. Identity of the 39 groEL sequence types used as OTUs in phylogenetic analyses
|
![]() View larger version (36K): [in a new window] |
FIG. 1. Results of groEL PCRs and HindIII digestion. Lane MW contained molecular weight standards. Lane 1 contained amplicon obtained after the first PCR round starting with DNA extracted from the buffy coat of a symptomatic dog. Lanes 2, 4, 6, and 8 show groEL heminested PCR results obtained using internal primer EPhGroR, specific for A. phagocytophilum, with DNA extracted from the reference strain of A. phagocytophilum and from samples Stechi, Sogno, and Perla, respectively. To the right of each PCR result, the corresponding HindIII digestion result is shown (lanes 3, 5, 7, and 9). Lanes 10 and 12 show groEL heminested PCR results obtained using internal primer EPlGroR, specific for A. platys, with DNA extracted from the control strain of A. platys and from sample Lara, respectively. To the right of each PCR result, the corresponding HindIII digestion result is shown (lanes 11 and 13). Lane 14 shows HindIII digestion of the amplicon obtained after the first PCR (lane 1) and identification of the sample as A. platys.
|
![]() View larger version (30K): [in a new window] |
FIG. 2. Coinciding NJ and MP trees generated by considering 39 A. phagocytophilum sequence types OTUs for phylogenetic analyses. The numbers in parentheses are statistically significant bootstrap values for the branches obtained by testing the robustness of NJ trees. The numbers not in parentheses are statistically significant consensus values for branches obtained by testing MP trees.
|
Two main groEL sequence types have been reported in Europe by von Loewenich and coworkers (18), in agreement with the findings of Petrovec and coworkers (11), who identified two genetic lineages of groEL sequences, one more closely related to strains isolated from humans and infecting mainly red deer and one infecting roe deer.
The phylogenetic analyses conducted during this study (Table 1 and Fig. 2) confirmed the presence of two distinct European lineages of A. phagocytophilum. Unexpectedly, both Sardinian equine and canine A phagocytophilum isolates do not fall in either of the two European lineages but are phylogenetically closely related to the American strains. The latter observation has implications for risk assessment, since A. phagocytophilum American strains seem to be associated with higher mortality rates in humans and HGA cases in Europe are less severe (1, 4). Statistical evaluation of the branches and group analysis strongly support the morphology of the trees. These observations could suggest that there was recent introduction via mammalian hosts and tick vectors that moved from the United States to Sardinia.
Alternatively, we cannot exclude the possibility of introduction from other regions of the Mediterranean area or from North Africa (for which information on the groEL gene type sequences are not yet available) through ticks transported by migratory birds. Indeed, 8 of 57 ticks (14%) collected on passerine migratory birds in the Baltic region of Russia were found to host A. phagocytophilum (3), thus demonstrating that Anaplasma exchange could occur between ticks cofeeding on animals without systemic infections. In conclusion, molecular analyses are required in order to characterize A. phagocytophilum strains circulating in hosts (especially humans) and vectors in the Mediterranean area and to confirm our observations.
|
|
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»