This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groh, J. L.
Right arrow Articles by Krumholz, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groh, J. L.
Right arrow Articles by Krumholz, L. R.
Agricola
Right arrow Articles by Groh, J. L.
Right arrow Articles by Krumholz, L. R.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, November 2005, p. 7064-7074, Vol. 71, No. 11
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.11.7064-7074.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

A Method Adapting Microarray Technology for Signature-Tagged Mutagenesis of Desulfovibrio desulfuricans G20 and Shewanella oneidensis MR-1 in Anaerobic Sediment Survival Experiments{dagger}

Jennifer L. Groh,1,{ddagger} Qingwei Luo,1,{ddagger} Jimmy D. Ballard,2 and Lee R. Krumholz1*

Department of Botany and Microbiology, University of Oklahoma, Norman, Oklahoma 73019,1 Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 731902

Received 28 March 2005/ Accepted 21 June 2005


arrow
ABSTRACT
 
Signature-tagged mutagenesis (STM) is a powerful technique that can be used to identify genes expressed by bacteria during exposure to conditions in their natural environments. To date, there have been no reports of studies in which this approach was used to study organisms of environmental, rather than pathogenic, significance. We used a mini-Tn10 transposon-bearing plasmid, pBSL180, that efficiently and randomly mutagenized Desulfovibrio desulfuricans G20 in addition to Shewanella oneidensis MR-1. Using these organisms as model sediment-dwelling anaerobic bacteria, we developed a new screening system, modified from former STM procedures, to identify genes that are critical for sediment survival. The screening system uses microarray technology to visualize tags from input and output pools, allowing us to identify those lost during sediment incubations. While the majority of data on survival genes identified will be presented in future papers, we report here on chemotaxis-related genes identified by our STM method in both bacteria in order to validate our method. This system may be applicable to the study of numerous environmental bacteria, allowing us to identify functions and roles of survival genes in various habitats.


arrow
INTRODUCTION
 
Microbial survival in a habitat is subject to both biotic and abiotic influences and ultimately depends on the organism's ability to respond to prevailing environmental stresses. This response is believed to involve expression of genes that confer specific "stress response" capabilities on the cells. These functions can involve a variety of biochemical or structural features useful for the microorganism's survival. For example, sediment-dwelling microorganisms can detoxify their surroundings by reducing certain metals to less soluble forms (13, 29, 31, 53). With our current knowledge of the importance of gene expression in response to environmental factors, many essential biological events that occur in situ are most likely missed during studies of laboratory cultures. As well, there has been no way to prove that cell functions observed in the laboratory are important for the organism when it is growing in the natural environment. Recognition of this problem has been pronounced in many fields, but significant progress in addressing this issue has been made only in studies of bacterial pathogens and some commensal organisms (16). This work has allowed for studies of bacterial genes as the organisms are growing within the host. One of the most widely used techniques for identification of genes directly involved with in situ survival of the organism is signature-tagged mutagenesis (STM).

STM requires the generation of oligonucleotide-tagged mutants, the incubation of these mutants in the natural environment, and finally, identification of nonsurviving mutants by observing the loss of their corresponding tags by using a hybridization approach. The first STM study demonstrated the potential for identifying genes essential for survival of Salmonella enterica serovar Typhimurium in the infected host model (mouse) (19). Since this seminal article, increasing numbers of reports of studies that have further exploited this approach for studying the in vivo survival of pathogenic microorganisms (8, 14, 16, 26, 27, 34) and commensal bacteria (18, 21) have appeared each year. Although the STM procedure has undergone many refinements during these studies (reviewed in reference 26), all reinforce the belief that STM is a powerful approach for screening the genomes of microorganisms for genes that enable bacteria to survive in their natural habitats.

In order to adapt this technique to study bacteria of environmental significance, we chose two model organisms. These are representative of sediment-dwelling anaerobic bacteria that carry out important functions in their environments. Sulfate-reducing bacteria, such as Desulfovibrio desulfuricans G20, are involved in the reductive arm of the sulfur cycle and play critical roles in degrading organic compounds in sulfate- and organic-rich environments (15, 42). Shewanella oneidensis MR-1 is from a genus shown to be abundant in a variety of sedimentary environments, and Shewanella species have been used as models for studying Fe(III) (40) and radionuclide [U(VI) and Tc(VII)] transformations (13, 29). With these organisms, difficulty in achieving high efficiency and random transposition with transposon systems similar to those used in prior STM or general mutagenesis studies led us to screen a number of transposon-containing vectors. The availability of microarray technology led us to modify the screening process of the STM procedure, enabling us to mass produce microarray slides with printed tags. The microarray system also enabled us to downsize equipment necessary for carrying out hybridizations. This modified approach to STM allowed us to identify genes critical to the function of organisms of environmental significance, such as anaerobic, sediment-dwelling bacteria.


arrow
MATERIALS AND METHODS
 
Strains and media.
A general outline of the entire STM procedure appears in Fig. 1. A list of strains and plasmids used in this study is given in Table 1. Strain G20 was grown in lactate-sulfate (LS) medium prepared as described by Rapp and Wall (44), using N2 headspace and vitamin and metal solutions as described elsewhere (50). Prior to autoclaving, the pH was adjusted to 7.2, and after autoclaving, 8 mM bicarbonate and 0.025% cysteine were added from anaerobic stock solutions. For growth of G20 on solid media, LS agar medium (1.5% agar) was prepared, with the addition of 0.005% PdCl2 (rather than cysteine), a catalyst for reduction of the medium by H2 (contained within the anaerobic chamber). These plates were poured on the bench, and following solidification, the oxidized plates (pink from resazurin redox indicator) were dried overnight in a laminar flow hood and then moved into an anaerobic chamber and reduced overnight. S. oneidensis MR-1 was maintained aerobically on standard Luria broth (LB) medium and grown anaerobically with a modified LS medium [25 mM Fe(III)-citrate in place of sulfate, 50 mM lactate, no bicarbonate or cysteine, pH 7]. A minimal lactate medium was also used for aerobic growth where indicated [amended LS medium with Fe(III)-citrate omitted]. For selection of transposon mutants, 175 µg/ml kanamycin was added to agar plates prepared as described above for G20 and 50 µg/ml kanamycin was added to LB plates for MR-1. Escherichia coli strains were cultured in LB supplemented with appropriate antibiotics. Additionally, strain ß-2155 required 0.05% diaminopimelic acid (DAP) for growth with LB medium. G20 and E. coli strains were grown at 37°C, while MR-1 was grown at 30°C. A period of 3 days was necessary for colonies of G20 to appear on solid media, while 18 h was sufficient to generate 1- to 2-mm-diameter colonies of MR-1.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 1. Overview of STM for G20 and MR-1 sediment survival studies. Although 96 tags were originally designed and moved into E. coli ß-2155 on pBSL180, only 60 were used for conjugation with G20 and MR-1. This model therefore shows assembly of 60 G20 and MR-1 mutants in each one of 96 "mutant pools."


View this table:
[in this window]
[in a new window]
 
TABLE 1. Strains and plasmids used in this study

For construction of our tagged-transposon mutant libraries, we used strains of G20 and MR-1 that had been adapted to sediment conditions. In order to generate these strains, G20 and MR-1 Rfr Smr were incubated individually in sediment microcosms as described in greater detail below (see "Initial sediment survival experiments") and subsequently reisolated at the time of peak growth (8 to 9 days for G20 and 3 days for MR-1) based on nalidixic acid (200 µg/ml) resistance for G20 and streptomycin (300 µg/ml) resistance for MR-1. By utilizing such strains (now termed G20sediment and MR-1sediment) that have adjusted to sediment conditions, we hoped to avoid problems with adaptation to environmental conditions and the possibility that important functions may have been suppressed during repeated transfer in laboratory media.

Plasmids were provided by Dianne Newman (pBSL180), Judy Wall (pRK2096, pRK2073, and pRL1058a), and Gerben Zylstra (pTnMod-RKm and pTnMod-OGm).

Tag design and screening for cross hybridization among tags.
Based upon tag sequences in a previously described STM system (19), we designed 96 single-stranded DNA tags, each with a 40-nucleotide (nt) variable region flanked by constant arms common to all tags: 5'-CTAGGTACCTACAACCTCAAGCTT-[NK]20-AAGCTTGGTTAGAATGGGTACCATG-3', where [NK]20 represents the 40-nt variable region; N is A, C, G, or T; and K is G or T. This design prevented KpnI sites, necessary for later cloning steps, from being incorporated into the tag sequence. Following the individual synthesis of 89-nt single-stranded tags (Integrated DNA Technologies, Inc., Coralville, Iowa), all 96 tags were individually amplified in PCRs using primers P3 and P5 (homologous to the common arms of all tags) (19), in order to create double-stranded tags for cloning into pBSL180. Primers P2 and P4 (19), internal to primers P3 and P5, were used in later steps described below to PCR amplify the unique region of tags prior to hybridization. Double-stranded tags that had been amplified by primers P3 and P5 were individually digested with KpnI (restriction sites present in the common arms) and ligated individually into KpnI-digested pBSL180. Competent cells of E. coli strain CC118 were transformed with the ligation product by using standard electroporation methods. Plasmid isolated with QIAprep spin miniprep kit (QIAGEN) from transformed CC118 cells was then used to electroporate E. coli strain ß-2155.

We screened all 96 tags for cross hybridization prior to mutagenesis of strains G20sediment and MR-1sediment with each tagged form of pBSL180. Tagged pBSL180 was first isolated from individual E. coli ß-2155 strains. We PCR amplified and then labeled tags with Cy5 dye as described in "Colony PCR" and "Target preparation" below, except that here we started with purified plasmid for PCR template and not colonies on agar medium. The 96 tags (approximately 100 ng each) were individually PCR amplified in a 96-well plate. We then pooled the well contents (6.25 µl of the 50 µl PCR mixture) from each column (8 tags per column; 12 columns) and each row (12 tags per row; 8 rows) in order to perform 20 separate labeling reactions for 20 hybridizations to microarray slides. Prior to and following the labeling reaction, DNAs from pooled columns and rows were cleaned with Amersham Microspin G-25 columns. Slides were printed with the 40-bp unique region from the 96 tags (as described below), and hybridization of labeled tags and wash conditions were as described in "Hybridization and washing procedures" below. Based on results discussed further below, we eliminated 36 tags from the study due to cross hybridization. We continued with the 60 remaining tags (sequences of the 40-nt unique region are found in Table S1 in the supplemental material).

Generation of mutant libraries.
Conjugations were carried out by picking a single colony and transferring it to either LB (strain MR-1sediment and each E. coli ß-2155 strain containing a uniquely tagged pBSL180) or LS media (strain G20sediment). The following manipulations were carried out aerobically with MR-1 or in an anaerobic glove box (Coy Laboratory Products, Grass Lake, MI) for G20. G20 and MR-1 were grown for 10 to 20 h. E. coli ß-2155 with one unique tag in pBSL180 was grown overnight, diluted 1:10 in LB without antibiotic selection, and grown until the optical density at 600 nm (OD600) was approximately equal to that of the recipient organism (0.5 to 1.0). Volumes of E. coli and recipient were centrifuged together (6,000 x g, 10 min) at a 1:1 or 1:2 ratio and then resuspended in 100 µl of spent medium from the recipient strain. This mating mixture was placed onto a 0.22-µm filter in the center of an LB-DAP plate for 3 h at 30°C (for MR-1) or an LS plate for 6 h at 37°C (for G20). Cells were washed from the filter by immersion into 1 ml of the medium favored by the recipient (no DAP) in 13- by 100-mm glass tubes. Strain MR-1sediment transposon mutants were washed from the filter and then immediately plated onto LB plates supplemented with kanamycin (no DAP), while strain G20sediment transposon mutants were recovered in liquid LS medium with 200 µg/ml nalidixic acid for 5 h prior to plating onto LS medium with kanamycin. Nalidixic acid was included in LS medium during the recovery in order to kill E. coli ß-2155, which could grow on LS medium even without addition of DAP. This conjugation procedure was repeated for each of the remaining 59 ß-2155 strains harboring a uniquely tagged form of pBSL180.

For each tagged pBSL180, we picked 96 random exconjugants to a 96-well plate. With 60 unique tags, we collected 5,760 mutants in total. Mutants were then reassembled so that one mutant (of 96) from each of the original 60 plates was moved to one other plate. The procedure was repeated 96 times so that each new plate contained a pool of 60 uniquely tagged mutants. We had 96 of these mutant pools to screen in sediment per organism (Fig. 1). At this stage we also used a random sampling of mutants and standard Southern blotting procedures (3) to determine that single, random transposition events occurred in both G20 and MR-1.

Initial sediment survival experiments.
Prior to creation of the transposon mutant libraries, initial sediment survival experiments were carried out for two purposes: to determine when to sacrifice sediment incubations for collection of output pools and to isolate sediment-adapted strains, as described previously. These initial sediment incubations with G20 and MR-1 Rfr Smr were carried out in a manner similar to that for the mutant pool sediment incubations described below. The only differences were sacrificing replicate microcosms (two bottles per time point for G20 and three bottles per time point for MR-1) at various time points (instead of just at one time point for mutant pools) and selection of recovered cells with solid media containing nalidixic acid (G20) or streptomycin (MR-1). Sizes of inocula were approximately 105 to 106 cells for both G20 and MR-1.

With MR-1, we added 200 µmol amorphous Fe(III) oxyhydroxide, prepared as described previously (33), in order to shift sediment from sulfate-reducing conditions to Fe(III)-reducing conditions (see "Screening of tagged mutants in natural sediments" below for a description of the sediment collected). Because previous work with STM required some growth of virulent strains in the host (8), we amended MR-1 microcosms with 20 µmol lactate in order to stimulate at least a 10-fold increase in cell numbers. In similar microcosms without addition of lactate, we were unable to achieve this amount of growth (data not shown). To assess levels of Fe(III) reduction, cells (1 ml) were first sampled from sediment incubations (as described below), and then the liquid remaining in the bottles was acidified by addition of 250 µl 6 N HCl and shaken at room temperature for 30 min. Fe(II) was measured from 0.5 ml acidified sample in each bottle, using the ferrozine assay (32, 33).

Screening of tagged mutants in natural sediments.
Each mutant pool of G20 (60 uniquely tagged mutants) was grown in deep 96-well plates to late log phase (equivalent to an OD600 in serum tubes of 0.7) with LS medium in an anaerobic glove box. MR-1 pools were grown in shallow 96-well plates and transferred through LB, minimal lactate (aerobic), and finally modified LS medium (grown in anaerobic chamber). MR-1 pools were grown until the Fe(III)-citrate had cleared in most wells. Experiments were then continued independently for each organism but were maintained in an anaerobic glove box. The contents of all 60 wells were then pooled. Pooled cells were washed three times in modified LS anoxic minimal medium buffered with 8.3 mM bicarbonate without addition of the vitamins, trace metals, and electron donor. For G20, Na2SO4 was omitted but the solution contained 8.4 mM MgSO4. For MR-1, Fe(III) was omitted; 7 mM NaCl and 2 mM MgCl2 replaced Na2SO4 and MgSO4, respectively (so as not to stimulate the sulfate-reducing population); KH2PO4 was increased to 3.7 mM; NH4Cl was reduced to 7.5 mM; and CaCl2 was dropped to 0.34 mM to avoid precipitation. Washed cells (100 µl) were inoculated (~105 cells) into 30-ml serum bottles containing 2 g sulfidogenic subsurface sediments from a landfill in Norman, OK, a site characterized in previous studies (4, 5). The initial water content of these sediments ranges from 10% to 25% of the total weight. Bottles were then flushed with N2-CO2 (4:1), as CO2 is required to maintain a neutral pH in this system. MR-1 microcosms were amended with 200 µmol amorphous Fe(III) oxyhydroxide and 20 µmol lactate. One bottle per mutant pool was sacrificed (as described below for output pool) within 3 h for analysis of tags present in the input pool. A duplicate bottle for each mutant pool was incubated in the dark at room temperature for 8 to 9 days (G20) or 5 to 6 days (MR-1) and then sacrificed.

For extraction of cells, anoxic minimal medium buffer (4 ml) was added to the bottles and they were shaken by hand and vortexed for 15 min. Extracted cells were then diluted in the same buffer and plated onto LS plates with 175 µg/ml kanamycin in the anaerobic glove box for G20 and aerobically onto LB plates containing 100 µg/ml kanamycin for MR-1 (increased from 50 µg/ml to decrease the background of kanamycin-resistant sediment organisms). Plates were incubated as described in "Strains and media" above.

Colony PCR.
Plates from the dilution series were chosen so that one to two plates containing a total of about 300 colonies were used. Colonies were scraped from plates into the same mineral medium used for inoculation of microcosms, and cells were centrifuged for 1 min (12,000 x g). The pellet from pooled colonies was resuspended in 200 µl distilled water (dH2O). A portion (50 µl) was removed to an Eppendorf tube, and 1 ml dH2O was added. The cells were then centrifuged for 1 min, and the supernatant was removed. Washing was repeated four times, and the final pellet was resuspended in 100 µl dH2O. This was boiled for 5 min, placed on ice for several minutes, and then centrifuged for 2 min. The supernatant (5 µl) was used in a 50-µl PCR mixture containing 1x PCR buffer; 1.5 mM MgCl2; 0.2 mM each dATP, dCTP, and dGTP; 0.12 mM dTTP; 80 µM aminoallyl-dUTP (Molecular Probes); 0.1 µM each of primers P2 and P4 (19); and 2.5 U Invitrogen Platinum Taq. PCR parameters were 94°C for 4 min, followed by 30 cycles (G20) or 25 cycles (MR-1) of 94°C for 30 s, 50°C for 30 s, and 72°C for 30 s. All PCRs were performed using the GeneAmp PCR System 9700 (Applied Biosystems) thermal cycler. Following amplification, the reaction mixture was purified with an Amersham Microspin G-25 column according to the instructions of the manufacturer. We compared genomic DNA extracted from cell pellets by using the Invitrogen Easy DNA kit as template in tag labeling PCR to that from the boiling extract procedure described above. In every case tested, results were identical (data not shown).

Target preparation.
One vial of Cy5 Mono-Reactive Dye Pack (Amersham) was dissolved in 72 µl dimethyl sulfoxide. Aliquots (4.5 µl) were distributed into amber Eppendorf tubes and dried completely in a Labconoco Centrivap (60°C, 45 min). The purified PCR product containing aminoallyl-dUTP was also dried in this manner and resuspended in 6 µl of 0.1 M Na2CO3 solution (pH 9). This was added to the dried Cy5 dye and incubated for 1 h at room temperature in the dark. The reaction was stopped by addition of 3 µl of sodium acetate (3 M, pH 4.5) and 41 µl water, and unbound dye was removed with Microspin G-25 columns. Dye incorporation was quantified on a DU530 Life UV/visible spectrophotometer (Beckman Instruments). The labeled PCR product (target) was then dried completely as before and resuspended in 2.5 µl water, 50 µl Roche digoxigenin hybridization solution, and 2.5 µl salmon sperm DNA (Stratagene). Prior to hybridization, the target was heated to 65°C for 5 min and then placed on ice.

Preparation of microarray slides.
The 40-nt unique region (see Table S1 in the supplemental material) and its complementary strand for each of 60 tags were synthesized separately (Invitrogen). Equivalent concentrations of the unique regions and their 40-nt complements were mixed to create 60 solutions of approximately 3.3-µg/µl final concentration in 3x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate). A small fraction of all of these solutions was spotted onto FMB Oligo Slides with poly-L-lysine surface chemistry (Full Moon BioSystems Inc.) using a Generation Array III spotter (Molecular Dynamics), creating 60 spots of approximately 100 µm in diameter (probes). On each slide, the unique tags were printed in duplicate in order to check reproducibility within the hybridization. This duplicate set was also printed on both ends of the slide, enabling us to simultaneously compare input (hybridized on one half of the slide) and output (hybridized on the other half of the slide) pools. Spotted slides were stored desiccated until ready for use within 2 months of preparation. Prior to use, slides were rehydrated briefly with steam, immediately dried on a heat block, UV cross-linked, and then blocked using a succinic anhydride blocking solution (http://omrf.ouhsc.edu/~frank/M_Slide_Blocking_Protocol.html).

To demonstrate that the probes were not washed from the slides during hybridizations or washes, we compared rehydrated and UV-cross-linked slides that were stained for 5 min at room temperature with SYTO 61 red-fluorescent nucleic acid stain (Molecular Probes; 1 µl in 50 µl Tris-EDTA buffer spread over spotted probes on each half of slides) either prior to or after the hybridization (no labeled target was applied with hybridization solution) and washing procedures described below. Slides were washed in Tris-EDTA buffer to remove the excess DNA stain, dried with 95% ethanol, and scanned at 650 nm using GenePix Pro 5.1 from Axon Instruments to compare the intensities of each stained probe before and after hybridization/washing procedures.

Hybridization and washing procedures.
Each slide was placed into a Corning hybridization chamber, and 22I*25 coverslips (Erie Scientific Company) were placed over each half of the slide (one to cover the input pool and one to cover the output pool). Approximately 20 to 25 µl (~100 pmol) of target was added beneath each coverslip, and hybridization units were incubated in a water bath at 37°C overnight. Prior to washing, slides were dipped in dH2O to remove the coverslips. Following all washing procedures (see below), slides were dried under a gentle stream of nitrogen. Scanning (650 nm) and spot intensity analyses were performed using GenePix Pro 5.1 from Axon Instruments. Background was assessed locally and subtracted from each spot by using the companion software. A negative response was set at any signal below 3 times the background level. This cutoff was based on the relative variability of the background.

For washing solutions, we tested a low-stringency (high-salt) procedure and a high-stringency (low-salt) procedure to determine which one resulted in fewer cross hybridizations among the original 96 tags. Comparisons were carried out by pooling columns and rows as described in "Tag design and screening for cross hybridization among tags" above. The low-stringency wash consisted of a series of washes (10 min each at room temperature) with 2x SSC-0.1% SDS, 1x SSC-0.1% SDS, 1x SSC, and 0.5x SSC. For the high-stringency wash (from the Full Moon Oligo Slides protocol), slides were washed in 0.2x SSC-0.2% SDS solution (prewarmed to 55°C) for 30 min on a shaker at room temperature. Slides were then removed from the first wash, dipped twice in 0.2x SSC (also prewarmed to 55°C), and then dipped three times in room temperature dH2O. Following analysis of spot intensities, the high-stringency wash was chosen for our STM method (see Results), as fewer tags exhibited cross hybridization with this protocol.

Following analysis of these hybridizations, we attempted to decrease cross hybridizations further among 36 tags slated for elimination (out of the original 96 tags) by increasing the wash temperature of slides. Twenty pools of tags were prepared as described in "Tag design and screening for cross hybridization among tags" above. Following hybridizations, replicate slides for each of the 20 pools were washed at 55°C, 60°C, and 65°C using the high-stringency wash solutions.

Confirmation of sediment mutants.
Potential nonsurviving mutants were defined as having a signal in the input pool but no signal (below 3 times the background level) in the output pool when hybridizations were analyzed. For G20 studies, mutants were confirmed by monitoring the cell number of individual mutants in sediment incubations (carried out exactly as described in "Initial sediment survival experiments" above).

MR-1 mutants were confirmed by subsequent competition experiments in sediment microcosms with parental strain MR-1sediment, as performed in previous STM studies (7, 22). These competition experiments were similar to mutant pool incubations, except that now only one transposon mutant and strain MR-1sediment were inoculated together in a 100-µl volume (~103 cells each) of the anoxic minimal medium buffer described above. The inoculum size was lowered from that used in mutant pools (105 total cells) to reflect the approximate concentration of one tagged mutant among 59 other tagged mutants. Following extraction of replicate microcosms (in duplicate bottles) with anoxic minimal medium buffer at 0 and 5 days, surviving cells were plated onto LB plus kanamycin (100 µg/ml) and LB plus streptomycin (300 µg/ml). The transposon mutant was enumerated by colony counts on kanamycin plates, while the number of recovered strain MR-1sediment CFU was the difference between kanamycin (mutant) and streptomycin (total) plate counts. These numbers were used to calculate a competitive index (CI), a measure of output ratio of mutant to parent strain/input ratio of mutant to parent strain (7, 22). Where deemed necessary, a CI was also determined in anoxic Fe(III)-citrate laboratory medium for growth of individual potential nonsurvivors competing with strain MR-1sediment (inoculated with ~106 to 107 cells each, from separate, mid-log-phase aerobic lactate medium cultures). The output ratio in this case was determined by total cell count taken when the brown coloration of Fe(III)-citrate medium was beginning to clear. In previous growth experiments, we monitored cell number (by plating onto LB medium) and Fe(II) accumulation (ferrozine assay described above) in this medium and determined that clearing occurred near the mid-log phase of growth and as a result of Fe(III) reduction to Fe(II) (data not shown).

Arbitrary PCR and identification of interrupted genes.
Arbitrary PCR was used to determine the DNA sequences of the sites of transposon insertion in confirmed sediment-impaired mutants and was modified from previous procedures (36, 41). Approximately 3 ml of overnight mutant culture was centrifuged and washed, and DNA was extracted using the colony PCR protocol described above. In all PCRs, the Expand Long Template PCR system (Roche) was used according to the manufacturer's instructions. For the first round of PCR (25-µl reaction mixture), 5 µl supernatant from the prepared pellet was used with primers Tn10ext (5'GTGTTCCGCTTCCTTTAGCAGC3') and Arb1 (41). Parameters were (i) 95°C for 5 min; (ii) 15 cycles of 95°C for 45 s, 40°C for 45 s, and 68°C for 1 min; and (iii) 20 cycles of 95°C for 45 s, 45°C for 45 s, and 68°C for 1 min. For the second round of PCR (50-µl reaction mixture), 2 µl of first-round product was used with primers Tn10seq (5'GTCGACGGTATCGATAAGCTTG3') and Arb2 (41). Parameters were (i) 95°C for 5 min; (ii) 15 cycles of 95°C for 45 s, 45°C for 45 s, and 68°C for 1 min; and (iii) 15 cycles of 95°C for 45 s, 50°C for 45 s, and 68°C for 1 min. The resultant PCR product was purified with the PCR purification kit from QIAGEN and sequenced directly using the Tn10seq primer. For identification of the interrupted gene, sequence obtained from arbitrary PCR was compared to the NCBI database by using blastn. The genome sequence for MR-1 has been published (17), while annotation completed to date for G20 is available at http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db = genome&gi = 5163.


arrow
RESULTS
 
Transposition system for G20 and MR-1.
Wall et al. (54) described several vectors suitable for transposon mutagenesis in D. desulfuricans G20. We mutagenized strain G20 and other strains of Desulfovibrio with several of these vectors, using both conjugation and electroporation procedures. Although we observed efficient transformation (Table 2) using the Tn7-based pRK2096, transposon insertion (as determined by Southern blot hybridization) was not random (data not shown). Subsequent electroporation experiments using Tn5-based pRL1058a resulted in low transformation efficiency (four transformants/µg DNA). Additionally, Southern blot analysis of mutant chromosomal DNA showed only two different insertion patterns (among 10 mutants tested) (data not shown). We attempted to improve the efficiency of pRL1058a transposition by inserting the Desulfovibrio vulgaris cytochrome c promoter in front of the kanamycin resistance gene of the Tn5 transposon. This promoter has been used to express different genes in Desulfovibrio and E. coli (6, 52). Although the transformation efficiency did increase slightly, this modification (plasmid designated pQL1058a) did not result in random insertions. This was possibly due to transposon instability, since the transposase gene was encoded on the transposon (11).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Frequency of conjugations and efficiency of electroporations with D. desulfuricans G20

We also tested the ability of several other vectors to mutagenize G20, using both electroporation and conjugation. These included pTnMod-RKm and pTnMod-OGm, two mini-Tn5 plasmids that have transposase encoded outside the transposon (10), and pMycoMar, with a mariner transposon (1). In all cases, no transposon mutants were obtained with G20. One commercially available kit with Tn5 and transposase mix (Epicenter) was also used for electroporation into G20, but the transformation efficiency was very low (Table 2).

For transposon mutagenesis of MR-1, we obtained a mini-Tn10 plasmid, pBSL180 (Table 1), whose features include a relatively small size (6.3 kb), an R6K origin of replication (requires the {pi} protein for replication), a kanamycin resistance gene (nptII), and the multiple cloning site of pBluescriptII within the Tn10, as well as a mutant ATS Tn10 transposase gene encoded outside the transposon (2). The R6K origin of replication is critical for use in transposon mutagenesis of MR-1, as many plasmids, including those with origins such as p15A and pMB1, are capable of replicating in Shewanella (37; our results; D. Lies, personal communication). The importance of the mutant ATS Tn10 transposase is that it displays a lower degree of insertion specificity than the wild-type Tn10 transposase, which is known to insert into hot spots (25).

Fortuitously, by conjugating E. coli strain ß-2155 harboring pBSL180 with G20, we found that the frequency of conjugation was sufficient (Table 2) for us to create STM mutant libraries with this mutagenesis system in both G20 and MR-1. Southern blot analysis confirmed that mutations occurred randomly in the strain G20 chromosome (Fig. 2). Random transposition was previously shown for MR-1 (40) and through Southern blotting performed in our study (data not shown).



View larger version (130K):
[in this window]
[in a new window]
 
FIG. 2. Southern blot analysis of G20 mutants transformed with pBSL180 Tn10 transposon. pBSL180 was used as a probe. Lanes 1 and 25, 1-kb DNA ladder; lanes 2 to 4, pBSL180 HindIII-digested fragments; lanes 5 to 24 and 26 to 47, HindIII digests of chromosomal DNAs from independent G20 mutants (two bands are expected from Tn10); lane 48, HindIII digest of chromosomal DNA of untransformed G20.

Probe preparation for spotting.
Complementary oligonucleotide pairs of the unique region for each tag served as the probe (40 bp). In initial experiments, we tested the effect on the hybridization signal of the concentration of probe DNA (10 ng/µl, 300 ng/µl, 670 ng/µl, or 3.3 µg/µl) used in spotting. Spots with 3.3 µg/µl of 40-bp DNA produced the strongest hybridization signal. Spot intensities for the remaining concentrations were 2%, 5%, and 32%, respectively, relative to 3.3 µg/µl.

We then compared spotted slides that were incubated with SYTO 61 red-fluorescent nucleic acid stain added either before or after hybridization/washing procedures. We observed that fluorescence from the DNA stain did not change during the hybridization and washing steps (data not shown), indicating that the majority of spotted DNA remained bound to our slides. This also indicated that 3x SSC, commonly used in microarray spotting at the time (47), was sufficient for spotting our double-stranded probes to the glass slide.

Hybridization and washing conditions.
Prior to hybridization, blocking of slides was found to be essential to achieve reproducible results, as it allowed for even spreading of target across the spotted slide surface. Comparison of two washing protocols showed that the high-stringency wash yielded the strongest signal with minimal cross hybridization (Fig. 3).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 3. Comparison of (a) high-salt (low-stringency) and (b) low-salt (high-stringency) wash conditions following hybridization of row and column pools (20) for 96 tags. The results shown represent one pooled column (eight tags from eight PCRs in one column of a 96-well plate). The remaining 7 columns and 12 rows were also individually labeled for 19 separate hybridizations with the microarray (spotted with the 96 original tags), but those data are not shown here. The portion of the array displayed is from a region containing the eight complementary probes for the eight labeled tags used in this example (spots 1 to 4, 7, 8, 13, and 14), in addition to eight other spotted probes (spots 5, 6, 9 to 12, 15, and 16) that are not complementary to the eight labeled tags added in the hybridization solution. In all 20 hybridizations, cross hybridization of targets to nonspecific probes over the whole array occurred less often for high-stringency conditions (b) than for low stringency conditions (a). In the example shown in this figure, circles are placed over probes to which nonspecific target has annealed under low-stringency conditions only.

With this chosen washing condition, we investigated whether increasing the washing temperature above room temperature could eliminate the cross hybridization of 36 tags slated for elimination. We found that the chosen increases in wash temperature failed to reduce cross hybridizations and actually decreased spot intensities of all specific hybridizations (Table 3). These 36 tags were eliminated based on these results and those from the cross hybridization screen (by columns and rows as described in Materials and Methods). Sixty of the original 96 synthesized tags remained for mutagenesis of G20 and MR-1 (see Table S1 in the supplemental material for tag sequences).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Signal intensities of eight tags (from one row of 12 columns and 8 rows tested) bound to their respective complementary probe as a function of increasing wash temperature

Initial sediment survival experiments.
Initial sediment survival tests were performed to determine how long incubations should proceed before extraction of surviving mutants. From initial sediment survival tests of G20, we found that peak growth (approximately 20-fold over the initial inoculum level) was reached after 8 to 9 days of incubation at room temperature (Fig. 4a). As we believed that this amount of growth would be sufficient to select nonsurvivors from survivors, STM screens were carried out at this time point for G20. From initial survival tests of MR-1, we found that it was necessary to supply sediments with lactate in order for MR-1 to grow at least 10-fold and to remain at concentrations above the initial inoculum concentration for at least 7 days (Fig. 4b). We then chose to sacrifice MR-1 STM microcosms [amended with Fe(III) oxyhydroxide and lactate] at 5 to 6 days, a time point at which Fe(III) reduction was occurring, as evidenced by Fe(II) accumulation in initial sediment survival experiments (Fig. 4b).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 4. Growth curves in subsurface sediments of (a) G20 (data represent averages for two microcosms) and (b) MR-1 (data represent averages for three microcosms). For MR-1, squares represent CFU, open circles represent soluble Fe(II) detected from the same microcosms as CFU, and closed circles represent Fe(II) detected in identical, sterile microcosms. Error bars show standard deviations, but these are too small to appear in most cases.

Screening of tagged mutants in natural sediments.
To investigate recovery of tags from the input and output pools, we initially varied the number of colonies pooled for production of labeled target. In these early trials, we compared collections of 300, 700, and 3,500 colonies and found that pooled target from these resulted in similar hybridizations for some mutant pools but that on occasion, pooled target from more than 300 colonies could contribute to weak hybridization signals for mutants that might actually have been impaired in sediment survival. To ensure that we would not miss potentially impaired mutants, we elected to use approximately 300 colonies for recovery in subsequent sediment screens.

With regard to optimization of the number of PCR cycles, we observed that 30 PCR cycles with wild-type MR-1 genomic DNA as the template generated an unknown labeled target that hybridized weakly to some probe sequences spotted on the glass slide. We cannot explain why this occurred, because wild-type MR-1 does not contain any of the 60 tags and therefore should not generate target that hybridizes with our array, but we did find that using only 25 PCR cycles eliminated this background hybridization.

To test the reproducibility of our STM screening procedure, several mutant pools were run through independent replicate sediment microcosms. Target was labeled from 300 colonies collected from each independent microcosm, and hybridizations on separate slides were performed. In all cases, hybridizations identified the same potentially impaired sediment mutants, and the same survivors appeared among all replicates (data not shown). On account of this and the fact that we performed a confirmation step for each potential nonsurvivor to ensure that we had correctly identified mutants impaired in sediment survival, we hybridized DNA from a single microcosm for each of the 96 mutant pools of each organism.

A total of 96 mutant pools (of both G20 and MR-1), containing 60 uniquely tagged mutants in each pool, were grown as described in Materials and Methods, washed, and inoculated into sulfidogenic subsurface sediment microcosms [amended with Fe(III) and lactate for MR-1]. Potential nonsurviving mutants, defined as producing essentially no signal (below 3 times the background level) when hybridized slides were analyzed (a sample input versus output pool hybridization is shown in Fig. 5), were confirmed by subsequent competition experiments. In general, cell numbers for truly impaired MR-1 mutants were 20 to 30% of those for the parent strain when both were recovered after 5 days of incubation in competition sediment microcosms (data not shown). For G20, cell numbers of impaired mutants decreased to 0 to 9% of the initial inoculum. As a comparison, G20 mutants that survived in sediment had individual recoveries above 500% of the inoculum concentration. Of 208 potential sediment-impaired mutants for G20 identified during the first screening, 117 were confirmed by independent reinoculation of each into sediment. Of 86 potential sediment-impaired mutants for MR-1, 56 were confirmed by competition experiments, but 8 of these were also impaired in Fe(III)-citrate growth.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 5. Hybridization results from one mutant pool, comparing (a) input pool hybridization with (b) output pool hybridization following sediment incubation. Circles have been placed around those tags present in the input pool and absent from the output pool. The 60 tags are positioned in four rows and eight columns, and all 60 tags are spotted in duplicate. For the slide shown, 10 tags did not fluoresce in both the input and output pools. As a result of being absent from the input pool, these 10 were not considered impaired mutants in this mutant pool.

Validation of the methods described herein.
In order to validate our method, we present chemotaxis genes that our STM study identified in both G20 and MR-1. For MR-1, the interrupted gene SO2323 had a CI in sediment of 0.1 ± 0.02, confirming its impaired status in sediment. The CI for Fe(III)-citrate growth was not determined for this mutant, as its growth in this medium appeared similar to growth observed for the parent strain prior to inoculation of these strains together in sediment competition experiments. SO2323 encodes a putative methyl-accepting chemotaxis protein (MCP) and starts a multicistronic operon of five genes putatively involved in chemotaxis functions. Similar genes may also be present in other environmental bacteria, as evidenced by protein sequence similarities across entire putative MCPs present in Magnetococcus sp. strain MC-1 and D. vulgaris Hildenborough (37 and 32% identity, respectively), while similarity to other bacterial proteins is restricted to the conserved C-terminal half of the protein.

A G20 transposon mutant with a similar gene (VIMMS392990) interrupted was recovered at 4% of the original inoculum concentration when inoculated back into sediment microcosms on its own. This gene is a monocistronic operon. Best similarity to other environmental organisms exists with sequences for MCPs in the NCBI protein database for D. vulgaris (designated DcrH) and Geobacter sulfurreducens PCA (41 and 44% similarity, respectively), as well as 42% similarity to one protein of Geobacter metallireducens. Similarity to protein sequences from these {delta}-Proteobacteria occurs mainly within the C-terminal region of the protein. Interestingly, this protein is orthologous to an MCP of Vibrio cholerae and Shewanella oneidensis MR-1 across the entire protein, but with a lower degree of homology.

The vast number of genes identified in both organisms cannot be discussed thoroughly in this paper, which focuses on development of a novel STM method for environmental bacteria. We will present our genes, confirmation of the genes (through competition experiments or inoculation of individual mutants back into sediment), and discussions of their potential function in sediment survival in future papers for each organism.


arrow
DISCUSSION
 
This paper is the first report on the use of the STM method with environmental microorganisms. Before we could successfully apply STM to detect genes essential for survival of G20 and MR-1 in their specific niches, we had to satisfy three key requirements of STM: a mutagenesis procedure that provides efficient and random transposition, a model to represent in situ conditions, and a system to screen for transposon mutants impaired in in situ survival. We tried several available transposon systems, including vectors previously described as suitable for transposon mutagenesis in D. desulfuricans G20 (54), but found that of all vectors we tested, only the mini-Tn10 transposon system provided both efficient and random transposition for generation of mutant libraries in both Desulfovibrio strain G20 and Shewanella oneidensis MR-1 (5,760 mutants each). While this number of mutants did not constitute a saturating screen of either organism's genome (G20 has 3,862 open reading frames [http://img.jgi.doe.gov/pub/main.cgi?page=taxonDetail&taxon_oid=400040000], and MR-1 had 4,758 open reading frames when the sequence was published [17]), we expected 5,760 mutants to reveal many genes necessary for sediment survival. In former STM studies, many genes required for survival were identified, whereas fewer mutants had been screened for bacteria with genome sizes comparable to those of MR-1 and G20 (34).

Just as optimization of the animal host model was important for studying pathogens by STM (reviewed in reference 8), a model sediment system for our environmental microbes had to be optimized, considering parameters such as pool complexity, inoculum concentration, time course for incubations, and recovery of surviving mutants. The simultaneous use of 60 tagged mutants in our study, a number falling between the 48 (7) and 96 (35) tagged mutants used in pathogenic studies with reusable tags, did not present a pool complexity problem, a condition described in reference 8) in relation to STM pathogen studies. By repeating incubation and hybridization of several pools early into development of our method, we found that the same mutants were consistently identified as impaired. An inoculum size similar to that used in prior STM studies (19, 35) was found to be suitable for our study. The time point at which each organism's mutant pool was extracted was determined from preliminary sediment incubations and occurred following growth of cells, a condition necessary in pathogen STM studies to select virulent strains from avirulent strains (8).

The optimized procedure that we have developed samples fewer colonies from sediment than prior STM studies have used for the host (19, 35). Screening this smaller number ensured that we would not miss potentially impaired mutants, but we had to contend with more false negatives (mutants exhibiting no hybridization signal in the output pool that were subsequently shown to survive in confirmation experiments). The purpose of the secondary screen (competition experiments or inoculation of individual mutants back into sediment) was to identify those mutants that were truly attenuated in sediment survival. Competition experiments with MR-1 showed that impaired mutant cell numbers at 5 days were 20 to 30% of cell numbers for the parent strain. Since 300 colonies would give each tag the chance of being represented five times (if all 60 tagged mutants grew equally and had the same chance of being picked for the 300-colony pool), collection of more colonies could have masked these mutants.

To help reduce the frequency of false negatives and confirmation experiments, at least duplicate replications of microcosms and microarrays would need to be incorporated into the experimental design. Replicates may also alleviate some problems associated with inherent factors of the STM protocol (e.g., soil heterogeneity and technical issues with PCR and microarrays) that may influence whether or not mutant tags are observed.

Despite the breakthrough made by the original STM method in identification of virulence-related genes in pathogenesis studies, the use of standard dot blotting techniques for pool analysis does not allow for efficient screening of mutants (19). In this respect, the technique was subsequently improved with a PCR-based STM (28). This system uses 12 tags designed and synthesized for specific and optimal PCR detection. Using this method, 12 libraries (one for each unique tag) are obtained, and single mutants from each library are picked to form pools comprised of 12 different mutants. The screening process consists of a separate PCR for each of the 12 tags. Agarose gels obviate the need for hybridizations by showing whether a PCR product is amplified with each tag as a primer paired with a universal primer within the kanamycin resistance gene of the transposon (28). Recently more tags have been designed for use in this PCR-based STM (43), increasing the number of mutants that can be screened at once to 72. This involves the use of additional tags as well as three different miniTn5 vectors. Groups of mutants are screened in a similar manner as when there were only 12 tags, but by using multiplex PCR. The disadvantage of this system is that more than one mutagenesis vector may not be available for organisms in which genetic systems are not fully developed (as with many environmentally relevant bacteria). The alternative is to increase the number of PCRs, increasing the cost and the labor involved. For the procedure described in this paper, the addition of more tag sequences to one vector used to create mutant pools achieves the same result as using multiple vectors to increase the number of uniquely tagged mutants.

A separate method that aimed at more efficient screening of mutants applied high-density oligonucleotide array technology, as developed by Affymetrix (30), to screen double-tagged transposon mutants (22). This technology involves synthesis of oligonucleotides directly on the array by using a combination of photolithography and oligonucleotide chemistry, while the method described here utilizes mechanical microspotting (for a more detailed comparison, see reference 46). At present, the advantage of our approach is affordability, because STM requires the screening of a large number of mutant pools, dependent on the number of unique tags employed, by individual hybridizations. Furthermore, our method uses only one array per pool, as each slide is spotted with the set of 60 probes on both ends, allowing simultaneous analysis of input and output pools. While the photolithographic approach may provide quantitative fitness data (48, 56), our approach satisfies the original intent of STM and currently does so at lower costs. For STM, quantitative data relevant to survival can also be assessed through studies of each individual impaired mutant that was identified by the screening process, rather than in the screen itself.

A final advantage of our method is that there is no need to digest and purify the 18-bp conserved arms from the labeled tag targets prior to hybridization, because only the 40-bp variable region is immobilized on the array as the probe. The early STM studies required an additional step to remove the invariable arms from the labeled probes ("target" in microarray terminology) prior to blot hybridization with colonies or plasmids containing the tagged transposons (19, 35).

Sequencing of interrupted genes in confirmed mutants from each organism identified MCPs as critical for sediment survival of both G20 and MR-1. While sequence similarity to these chemotaxis proteins exists with other proteins within MR-1 and G20, this similarity is confined mainly to C-terminal regions that are conserved across diverse MCPs and not to the variable N-terminal region comprising the periplasmic domain that is involved in recognition of specific attractants and repellants (51). Finding these genes validates our screen in that we expect chemotaxis response proteins to be necessary for bacteria to react to attractants and repellents encountered in their environment in order to compete with surrounding microorganisms. An earlier study has shown that a chemotactic strain of Pseudomonas fluorescens survived significantly better in sediment than a nonmotile strain, while the strains had equivalent growth rates in liquid media (23).

At this time we do not know the specific environmental stimuli for the chemotaxis proteins in our survival studies, but both Desulfovibrio and Shewanella have demonstrated chemotaxis in previous studies. MR-1 displayed chemotaxis to certain electron acceptors, while there was no tactic response to ferric citrate and Mn(IV) oxide (39). In addition, besides a weak response for formate, MR-1 did not display a tactic response to other carbon sources tested (39). Another study on chemotaxis in Geobacter metallireducens reported that MR-1 is not motile when grown with Fe(III) oxide in motility plate assays (9). D. vulgaris has shown a chemotactic response to oxygen concentration or redox potential of the environment, and chemotaxis may help the cells find an optimal anaerobic environment (12).

In summary, adapting microarray technology to STM enabled us to mass produce microarray slides spotted with our tags as probes and to downsize the equipment necessary for carrying out hybridizations. We created tagged vectors which we demonstrated were suitable for mutagenizing environmentally significant members of the {delta}- and {gamma}-Proteobacteria. This system may be applicable to a variety of environmental bacteria, creating many possibilities for future research areas regarding in situ activities of these bacteria, as in bioremediation and geomicrobiological processes.


arrow
ACKNOWLEDGMENTS
 
This work was supported by the Natural and Accelerated Bioremediation Research (NABIR) program of the Office of Biological and Environmental Research of the Office of Science, U.S. Department of Energy.

We are grateful to Darren Smalley and Mary Beth Langer, formerly of the OU Microarray Core Facility at the University of Oklahoma (www.ou.edu/microarray/), for their assistance and advice with microarray protocols. We thank Marvin Whiteley for providing assistance and primers associated with arbitrary PCR.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Botany and Microbiology, University of Oklahoma, Norman, OK 73019. Phone: (405) 325-0437. Fax: (405) 325-7619. E-mail: krumholz{at}ou.edu. Back

{dagger} Supplemental material for this article may be found at http://aem.asm.org/. Back

{ddagger} These authors contributed equally to the work presented in this paper. Back


arrow
REFERENCES
 
    1
  1. Akerley, B. J., E. J. Rubin, A. Camilli, D. J. Lampe, H. M. Robertson, and J. J. Mekalanos. 1998. Systematic identification of essential genes by in vitro mariner mutagenesis. Proc. Natl. Acad. Sci. USA 95:8927-8932.[Abstract/Free Full Text]
  2. 2
  3. Alexeyev, M. F., and I. N. Shokolenko. 1995. Mini-Tn10 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene 160:59-62.[CrossRef][Medline]
  4. 3
  5. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1987. Current protocols in molecular biology. Green Publishing Associates, New York, N.Y.
  6. 4
  7. Beeman, R. E., and J. M. Suflita. 1990. Environmental factors influencing methanogenesis in a shallow anoxic aquifer: a field and laboratory study. J. Ind. Microbiol. 5:45-58.[CrossRef][Medline]
  8. 5
  9. Beeman, R. E., and J. M. Suflita. 1987. Microbial ecology of a shallow unconfined ground water aquifer polluted by municipal landfill leachate. Microb. Ecol. 14:39-54.[CrossRef]
  10. 6
  11. Cannac, V., M. S. Caffrey, G. Voordouw, and M. A. Cusanovich. 1991. Expression of the gene encoding cytochrome c3 from the sulfate-reducing bacterium Desulfovibrio vulgaris in the purple photosynthetic bacterium Rhodobacter sphaeroides. Arch. Biochem. Biophys. 286:629-632.[CrossRef][Medline]
  12. 7
  13. Chiang, S. L., and J. J. Mekalanos. 1998. Use of signature-tagged transposon mutagenesis to identify Vibrio cholerae genes critical for colonization. Mol. Microbiol. 27:797-805.[CrossRef][Medline]
  14. 8
  15. Chiang, S. L., J. J. Mekalanos, and D. W. Holden. 1999. In vivo genetic analysis of bacterial virulence. Annu. Rev. Microbiol. 53:129-154.[CrossRef][Medline]
  16. 9
  17. Childers, S. E., S. Ciufo, and D. R. Lovley. 2002. Geobacter metallireducens accesses insoluble Fe(III) oxide by chemotaxis. Nature 416:767-769.[CrossRef][Medline]
  18. 10
  19. Dennis, J. J., and G. J. Zylstra. 1998. Plasposons: modular self-cloning minitransposon derivatives for rapid genetic analysis of gram-negative bacterial genomes. Appl. Environ. Microbiol. 64:2710-2715.[Abstract/Free Full Text]
  20. 11
  21. Dyson, P. J. 1999. Isolation and development of transposons. Methods Microbiol. 29:133-167.
  22. 12
  23. Fu, R., J. D. Wall, and G. Voordouw. 1994. DcrA, a c-type heme-containing methyl-accepting protein from Desulfovibrio vulgaris Hildenborough, senses the oxygen concentration or redox potential of the environment. J. Bacteriol. 176:344-350.[Abstract/Free Full Text]
  24. 13
  25. Ganesh, R., K. G. Robinson, G. D. Reed, and G. S. Sayler. 1997. Reduction of hexavalent uranium from organic complexes by sulfate- and iron-reducing bacteria. Appl. Environ. Microbiol. 63:4385-4391.[Abstract]
  26. 14
  27. Handfield, M., and R. C. Levesque. 1999. Strategies for isolation of in vivo expressed genes from bacteria. FEMS Microbiol. Rev. 23:69-91.[CrossRef][Medline]
  28. 15
  29. Hansen, T. A. 1994. Metabolism of sulfate-reducing prokaryotes. Antonie Leeuwenhoek 66:165-185.
  30. 16
  31. Hayes, F. 2003. Transposon-based strategies for microbial functional genomics and proteomics. Annu. Rev. Genet. 37:3-29.[CrossRef][Medline]
  32. 17
  33. Heidelberg, J. F., I. T. Paulsen, K. E. Nelson, E. J. Gaidos, W. C. Nelson, T. D. Read, J. A. Eisen, R. Seshadri, N. Ward, B. Methe, R. A. Clayton, T. Meyer, A. Tsapin, J. Scott, M. Beanan, L. Brinkac, S. Daugherty, R. T. DeBoy, R. J. Dodson, A. S. Durkin, D. H. Haft, J. F. Kolonay, R. Madupu, J. D. Peterson, L. A. Umayam, O. White, A. M. Wolf, J. Vamathevan, J. Weidman, M. Impraim, K. Lee, K. Berry, C. Lee, J. Mueller, H. Khouri, J. Gill, T. R. Utterback, L. A. McDonald, T. V. Feldblyum, H. O. Smith, J. C. Venter, K. H. Nealson, and C. M. Fraser. 2002. Genome sequence of the dissimilatory metal ion-reducing bacterium Shewanella oneidensis. Nat. Biotechnol. 20:1118-1123.[CrossRef][Medline]
  34. 18
  35. Hendrixson, D. R., and V. J. DiRita. 2004. Identification of Campylobacter jejuni genes involved in commensal colonization of the chick gastrointestinal tract. Mol. Microbiol. 52:471-484.[CrossRef][Medline]
  36. 19
  37. Hensel, M., J. E. Shea, C. Gleeson, M. D. Jones, E. Dalton, and D. W. Holden. 1995. Simultaneous identification of bacterial virulence genes by negative selection. Science 269:400-403.[Abstract/Free Full Text]
  38. 20
  39. Herz, K., S. Vimont, E. Padan, and P. Berche. 2003. Roles of NhaA, NhaB, and NhaD Na+/H+ antiporters in survival of Vibrio cholerae in a saline environment. J. Bacteriol. 185:1236-1244.[Abstract/Free Full Text]
  40. 21
  41. Heungens, K., C. E. Cowles, and H. Goodrich-Blair. 2002. Identification of Xenorhabdus nematophila genes required for mutualistic colonization of Steinernema carpocapsae nematodes. Mol. Microbiol. 45:1337-1353.[CrossRef][Medline]
  42. 22
  43. Karlyshev, A. V., P. C. F. Oyston, K. Williams, G. C. Clark, R. W. Titball, E. A. Winzeler, and B. W. Wren. 2001. Application of high-density array-based signature-tagged mutagenesis to discover novel Yersinia virulence-associated genes. Infect. Immun. 69:7810-7819.[Abstract/Free Full Text]
  44. 23
  45. Kennedy, M. J., and J. G. Lawless. 1985. Role of chemotaxis in the ecology of denitrifiers. Appl. Environ. Microbiol. 49:109-114.[Abstract/Free Full Text]
  46. 24
  47. Kim, C. H., D. R. Helinski, and G. Ditta. 1986. Overlapping transcription of the nifA regulatory gene in Rhizobium meliloti. Gene 50:141-148.[CrossRef][Medline]
  48. 25
  49. Kleckner, N., J. Bender, and S. Gottesman. 1991. Uses of transposons with emphasis on Tn10. Methods Enzymol. 204:139-180.[Medline]
  50. 26
  51. Lehoux, D. E., and R. C. Levesque. 2000. Detection of genes essential in specific niches by signature-tagged mutagenesis. Curr. Opin. Biotechnol. 11:434-439.[CrossRef][Medline]
  52. 27
  53. Lehoux, D. E., F. Sanschagrin, I. Kukavica-Ibrulj, E. Potvin, and R. C. Levesque. 2004. Identification of novel pathogenicity genes by PCR signature-tagged mutagenesis and related technologies, p. 289-304. In N. Woodford and A. P. Johnson (ed.), Genomics, proteomics, and clinical bacteriology, vol. 266. Humana Press, Totowa, N.J.
  54. 28
  55. Lehoux, D. E., F. Sanschagrin, and R. C. Levesque. 1999. Defined oligonucleotide tag pools and PCR screening in signature-tagged mutagenesis of essential genes from bacteria. BioTechniques 26:473-480.[Medline]
  56. 29
  57. Lloyd, J. R., J. Chesnes, S. Glasauer, D. J. Bunker, F. R. Livens, and D. R. Lovley. 2002. Reduction of actinides and fission products by Fe(III)-reducing bacteria. Geomicrobiol. J. 19:103-120.
  58. 30
  59. Lockhart, D. J., H. Dong, M. C. Byrne, M. T. Follettie, M. V. Gallo, M. S. Chee, M. Mittmann, C. Wang, M. Kobayashi, H. Horton, and E. L. Brown. 1996. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat. Biotechnol. 14:1675-1680.[CrossRef][Medline]
  60. 31
  61. Lovley, D. R., D. E. Holmes, and K. P. Nevin. 2004. Dissimilatory Fe(III) and Mn(IV) reduction. Adv. Microb. Physiol. 49:219-286.[Medline]
  62. 32
  63. Lovley, D. R., and E. J. P. Phillips. 1986. Availability of trivalent iron for microbial reduction in bottom sediments of the freshwater tidal Potomac River. Appl. Environ. Microbiol. 52:751-757.[Abstract/Free Full Text]
  64. 33
  65. Lovley, D. R., and E. J. P. Phillips. 1986. Organic matter mineralization with reduction of ferric iron in anaerobic sediments. Appl. Environ. Microbiol. 51:683-689.[Abstract/Free Full Text]
  66. 34
  67. Mecsas, J. 2002. Use of signature-tagged mutagenesis in pathogenesis studies. Curr. Opin. Microbiol. 5:33-37.[CrossRef][Medline]
  68. 35
  69. Mei, J.-M., F. Nourbakhsh, C. W. Ford, and D. W. Holden. 1997. Identification of Staphylococcus aureus virulence genes in a murine model of bacteremia using signature-tagged mutagenesis. Mol. Microbiol. 26:399-407.[CrossRef][Medline]
  70. 36
  71. Merrell, D. S., D. L. Hava, and A. Camilli. 2002. Identification of novel factors involved in colonization and acid tolerance of Vibrio cholerae. Mol. Microbiol. 43:1471-1491.[CrossRef][Medline]
  72. 37
  73. Myers, C. R., and J. M. Myers. 1997. Replication of plasmids with the p15A origin in Shewanella putrefaciens MR-1. Lett. Appl. Microbiol. 24:221-225.[CrossRef][Medline]
  74. 38
  75. Myers, C. R., and K. H. Nealson. 1988. Bacterial manganese reduction and growth with manganese oxide as the sole electron acceptor. Science 240:1319-1321.[Abstract/Free Full Text]
  76. 39
  77. Nealson, K. H., D. P. Moser, and D. A. Saffarini. 1995. Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens. Appl. Environ. Microbiol. 61:1551-1554.[Abstract]
  78. 40
  79. Newman, D. K., and R. Kolter. 2000. A role for excreted quinones in extracellular electron transfer. Nature 405:94-97.[CrossRef][Medline]
  80. 41
  81. O'Toole, G. A., and R. Kolter. 1998. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol. Microbiol. 28:449-461.[CrossRef][Medline]
  82. 42
  83. Postgate, J. R. 1984. The sulfate reducing bacteria, 2nd ed. Cambridge University Press, Cambridge, United Kingdom.
  84. 43
  85. Potvin, E., D. E. Lehoux, I. Kukavica-Ibrulj, K. L. Richard, F. Sanschagrin, G. W. Lau, and R. C. Levesque. 2003. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environ. Microbiol. 5:1294-1308.[CrossRef][Medline]
  86. 44
  87. Rapp, B. J., and J. D. Wall. 1987. Genetic transfer in Desulfovibrio desulfuricans. Proc. Natl. Acad. Sci. USA 84:9128-9130.[Abstract/Free Full Text]
  88. 45
  89. Rubin, E. J., B. J. Akerley, V. N. Novik, D. J. Lampe, R. N. Husson, and J. J. Mekalanos. 1999. In vivo transposition of mariner-based elements in enteric bacteria and mycobacteria. Proc. Natl. Acad. Sci. USA 96:1645-1650.[Abstract/Free Full Text]
  90. 46
  91. Schena, M., R. A. Heller, T. P. Theriault, K. Konrad, E. Lachenmeier, and R. W. Davis. 1998. Microarrays: biotechnology's discovery platform for functional genomics. Trends Biotechnol. 16:301-306.[CrossRef][Medline]
  92. 47
  93. Shalon, D., S. J. Smith, and P. O. Brown. 1996. A DNA microarray system for analyzing complex DNA samples using two-color fluorescent probe hybridization. Genome Res. 6:639-645.[Abstract/Free Full Text]
  94. 48
  95. Shoemaker, D. D., D. A. Lashkari, D. Morris, M. Mittmann, and R. W. Davis. 1996. Quantitative phenotypic analysis of yeast deletion mutants using a highly parallel molecular bar-coding strategy. Nat. Genet. 14:450-456.[CrossRef][Medline]
  96. 49
  97. Smidt, H., J. Van der Oost, and W. M. De Vos. 2001. Development of a gene cloning and inactivation system for halorespiring Desulfitobacterium dehalogenans. Appl. Environ. Microbiol. 67:591-597.[Abstract/Free Full Text]
  98. 50
  99. Steger, J. L., C. Vincent, J. D. Ballard, and L. R. Krumholz. 2002. Desulfovibrio sp. genes involved in the metabolism of hydrogen and lactate. Appl. Environ. Microbiol. 68:1932-1937.[Abstract/Free Full Text]
  100. 51
  101. Stewart, R. C., and F. W. Dahlquist. 1987. Molecular components of bacterial chemotaxis. Chem. Rev. 87:997-1025.[CrossRef]
  102. 52
  103. Voordouw, G., and S. Brenner. 1986. Cloning and sequencing of the gene encoding cytochrome c3 from Desulfovibrio vulgaris (Hildenborough). Eur. J. Biochem. 159:347-351.[Medline]
  104. 53
  105. Wall, J. D., C. L. Hemme, B. Rapp-Giles, J. A. Ringbauer, L. Casalot, and T. Giblin. 2003. Genes and genetic manipulations of Desulfovibrio, p. 85-98. In M. W. Adams, J. G. Ferry, L. L. Barton, M. K. Johnson, and L. G. Ljungdahl (ed.), Biochemistry and physiology of anaerobic bacteria. Springer, New York, N.Y.
  106. 54
  107. Wall, J. D., T. Murnan, J. Argyle, R. S. English, and B. J. Rapp-Giles. 1996. Transposon mutagenesis in Desulfovibrio desulfuricans: development of a random mutagenesis tool from Tn7. Appl. Environ. Microbiol. 62:3762-3767.[Abstract]
  108. 55
  109. Wall, J. D., B. J. Rapp-Giles, and M. Rousset. 1993. Characterization of a small plasmid from Desulfovibrio desulfuricans and its use for shuttle vector construction. J. Bacteriol. 175:4121-4128.[Abstract/Free Full Text]
  110. 56
  111. Winzeler, E. A., D. D. Shoemaker, A. Astromoff, H. Liang, K. Anderson, B. Andre, R. Bangham, R. Benito, J. D. Boeke, H. Bussey, A. M. Chu, C. Connelly, K. Davis, F. Dietrich, S. W. Dow, M. El Bakkoury, F. Foury, S. H. Friend, E. Gentalen, G. Giaever, J. H. Hegemann, T. Jones, M. Laub, H. Liao, N. Liebundguth, D. J. Lockhart, A. Lucau-Danila, M. Lussier, N. M'Rabet, P. Menard, M. Mittmann, C. Pai, C. Rebischung, J. L. Revuelta, L. Riles, C. J. Roberts, P. Ross-MacDonald, B. Scherens, M. Snyder, S. Sookhai-Mahadeo, R. K. Storms, S. Veronneau, M. Voet, G. Volckaert, T. R. Ward, R. Wysocki, G. S. Yen, K. Yu, K. Zimmermann, P. Philippsen, M. Johnston, and R. W. Davis. 1999. Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285:901-906.[Abstract/Free Full Text]
  112. 57
  113. Wolk, C. P., Y. Cai, and J. M. Panoff. 1991. Use of a transposon with luciferase as a reporter to identify environmentally responsive genes in a cyanobacterium. Proc. Natl. Acad. Sci. USA 88:5355-5359.[Abstract/Free Full Text]


Applied and Environmental Microbiology, November 2005, p. 7064-7074, Vol. 71, No. 11
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.11.7064-7074.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Li, X., Krumholz, L. R. (2009). Thioredoxin Is Involved in U(VI) and Cr(VI) Reduction in Desulfovibrio desulfuricans G20. J. Bacteriol. 191: 4924-4933 [Abstract] [Full Text]  
  • Li, X., Luo, Q., Wofford, N. Q., Keller, K. L., McInerney, M. J., Wall, J. D., Krumholz, L. R. (2009). A Molybdopterin Oxidoreductase Is Involved in H2 Oxidation in Desulfovibrio desulfuricans G20. J. Bacteriol. 191: 2675-2682 [Abstract] [Full Text]  
  • Shimoda, Y., Mitsui, H., Kamimatsuse, H., Minamisawa, K., Nishiyama, E., Ohtsubo, Y., Nagata, Y., Tsuda, M., Shinpo, S., Watanabe, A., Kohara, M., Yamada, M., Nakamura, Y., Tabata, S., Sato, S. (2008). Construction of Signature-tagged Mutant Library in Mesorhizobium loti as a Powerful Tool for Functional Genomics. DNA Res 15: 297-308 [Abstract] [Full Text]  
  • Luo, Q., Groh, J. L., Ballard, J. D., Krumholz, L. R. (2007). Identification of Genes That Confer Sediment Fitness to Desulfovibrio desulfuricans G20. Appl. Environ. Microbiol. 73: 6305-6312 [Abstract] [Full Text]  
  • Cuccui, J., Easton, A., Chu, K. K., Bancroft, G. J., Oyston, P. C. F., Titball, R. W., Wren, B. W. (2007). Development of Signature-Tagged Mutagenesis in Burkholderia pseudomallei To Identify Genes Important in Survival and Pathogenesis. Infect. Immun. 75: 1186-1195 [Abstract] [Full Text]  
  • Groh, J. L., Luo, Q., Ballard, J. D., Krumholz, L. R. (2007). Genes That Enhance the Ecological Fitness of Shewanella oneidensis MR-1 in Sediments Reveal the Value of Antibiotic Resistance. Appl. Environ. Microbiol. 73: 492-498 [Abstract] [Full Text]  
  • Teal, T. K., Lies, D. P., Wold, B. J., Newman, D. K. (2006). Spatiometabolic Stratification of Shewanella oneidensis Biofilms. Appl. Environ. Microbiol. 72: 7324-7330 [Abstract] [Full Text]  
  • Pobigaylo, N., Wetter, D., Szymczak, S., Schiller, U., Kurtz, S., Meyer, F., Nattkemper, T. W., Becker, A. (2006). Construction of a Large Signature-Tagged Mini-Tn5 Transposon Library and Its Application to Mutagenesis of Sinorhizobium meliloti.. Appl. Environ. Microbiol. 72: 4329-4337 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groh, J. L.
Right arrow Articles by Krumholz, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groh, J. L.
Right arrow Articles by Krumholz, L. R.
Agricola
Right arrow Articles by Groh, J. L.
Right arrow Articles by Krumholz, L. R.