This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Senko, J. M.
Right arrow Articles by Krumholz, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Senko, J. M.
Right arrow Articles by Krumholz, L. R.
Agricola
Right arrow Articles by Senko, J. M.
Right arrow Articles by Krumholz, L. R.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, November 2005, p. 7172-7177, Vol. 71, No. 11
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.11.7172-7177.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Effect of Oxidation Rate and Fe(II) State on Microbial Nitrate-Dependent Fe(III) Mineral Formation

John M. Senko,1,{dagger} Thomas A. Dewers,2 and Lee R. Krumholz1*

Department of Botany and Microbiology and Institute for Energy and the Environment,1 School of Geology and Geophysics, University of Oklahoma, Norman, Oklahoma 730192

Received 30 March 2005/ Accepted 16 July 2005


arrow
ABSTRACT
 
A nitrate-dependent Fe(II)-oxidizing bacterium was isolated and used to evaluate whether Fe(II) chemical form or oxidation rate had an effect on the mineralogy of biogenic Fe(III) (hydr)oxides resulting from nitrate-dependent Fe(II) oxidation. The isolate (designated FW33AN) had 99% 16S rRNA sequence similarity to Klebsiella oxytoca. FW33AN produced Fe(III) (hydr)oxides by oxidation of soluble Fe(II) [Fe(II)sol] or FeS under nitrate-reducing conditions. Based on X-ray diffraction (XRD) analysis, Fe(III) (hydr)oxide produced by oxidation of FeS was shown to be amorphous, while oxidation of Fe(II)sol yielded goethite. The rate of Fe(II) oxidation was then manipulated by incubating various cell concentrations of FW33AN with Fe(II)sol and nitrate. Characterization of products revealed that as Fe(II) oxidation rates slowed, a stronger goethite signal was observed by XRD and a larger proportion of Fe(III) was in the crystalline fraction. Since the mineralogy of Fe(III) (hydr)oxides may control the extent of subsequent Fe(III) reduction, the variables we identify here may have an effect on the biogeochemical cycling of Fe in anoxic ecosystems.


arrow
INTRODUCTION
 
Microbiological nitrate-dependent Fe(II) oxidation to Fe(III) is a widespread process among prokaryotes (3, 26, 34, 49, 53, 56). It has also been observed to occur in diverse ecosystems including activated sewage sludge (37), anoxic aquifer sediments (6, 24, 26, 48), and marine sediments (45). Solid-phase Fe(II) species [including sorbed Fe(II) as well as Fe(II) sulfides, carbonates, and phosphates] often represent a large fraction of Fe(II) in anoxic aquifers (12). Both dissolved and solid forms of Fe(II) are known to be susceptible to anaerobic oxidation (27, 33, 45, 61), with different biogenic Fe(III) (hydr)oxide mineral phases (including goethite, lepidocrocite, ferrihydrite, magnetite, and green rust) produced under similar physical and chemical conditions (11, 33, 34, 48, 54). The reason for the previously observed mineralogical differences in biogenic Fe(III) (hydr)oxide phases is unclear, but the chemical form of Fe(II) and the Fe(II) oxidation rate appear to exert control on the mineralogy for abiotically produced Fe(III) (hydr)oxides (19, 60).

The crystallinity of Fe(III) (hydr)oxide mineral phases strongly influences their susceptibility to microbiological reduction as well as their ability to act as a chemical oxidant (22, 28, 29, 35, 44, 62). For instance, the poorly crystalline Fe(III) (hydr)oxide ferrihydrite is biologically reduced to a greater extent than the crystalline (and more thermodynamically stable) hematite (29, 35, 62). Therefore, the mineralogy of Fe(III) (hydr)oxide products of nitrate-dependent Fe(II) oxidation may have a profound impact on the cycling of Fe in anoxic environments.

Here, we report on the characterization of a Klebsiella species (designated strain FW33AN) from a nitrate- and radionuclide-contaminated aquifer that is capable of anaerobic, nitrate-dependent Fe(II) oxidation. Strain FW33AN was previously shown to produce goethite by nitrate-dependent Fe(II) oxidation (48), and we show here that the chemical form of Fe(II) substrate and the rate of Fe(II) oxidation influence the mineralogy of biogenic Fe(III) (hydr)oxide products.


arrow
MATERIALS AND METHODS
 
Isolation of strain FW33AN from FRC groundwater.
During push-pull tests to stimulate nitrate and U(VI) reduction at the Oak Ridge Field Research Center (FRC) in Oak Ridge, TN (30), biomass that had accumulated in injection well FW033 was collected, refrigerated, and shipped to the University of Oklahoma where it was stored at 4°C for less than one week. A 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-buffered (50 mM, pH 7) solid medium was used that contained 0.8 g/liter NaCl, 1 g/liter NH4Cl, 0.1 g/liter KCl, 0.03 g/liter KH2PO4, 0.2 g/liter MgSO4 · 7H2O, and 0.04 g/liter CaCl2 · 2H2O, vitamins, and trace metals (57). Acetate (30 mM CH3COONa) was provided as an electron donor, nitrate (20 mM NaNO3) was the sole terminal electron acceptor, and agar (20 g/liter) was used as a solidifying agent. Plates were prepared under oxic conditions before transfer to an anoxic glovebag (Coy Laboratory Products, Grass Lake, MI) where they equilibrated overnight. Biomass-containing groundwater samples were serially diluted and spread on agar plates for isolation. Plates were incubated for 2 days at room temperature. Colonies exhibiting different morphologies were picked and transferred to anoxic HEPES-buffered acetate-nitrate liquid medium (as above but with no agar) in serum tubes with an N2 headspace. Due to its robust nitrate-reducing activity in FRC groundwater (48), one isolate (designated FW33AN) was chosen for further study.

Resting cell incubations.
FW33AN was grown to early stationary phase on the acetate-nitrate medium described above, and cells were harvested by centrifugation. Cells were then washed three times with anoxic bicarbonate buffer (3.5 g NaHCO3/liter, pH 6.8), equilibrated under a headspace of 80:20 N2/CO2, and resuspended in the same buffer. For Fe(II) oxidation experiments, resting cell suspensions of FW33AN were incubated with 5 mM nitrate in 20 ml of bicarbonate-buffer with a headspace of 80:20 N2:CO2 contained in serum bottles that were sealed with thick rubber stoppers. FeCl2 (3.5 or 5 mM) or freshly prepared FeS (2.5 mM) was added to incubations from sterile stock solutions. Geochemical modeling using PHREEQC (38) revealed that Fe(II) in FeCl2-amended incubations was predominantly present as FeHCO3+ (51%) and Fe2+ (45%), with FeCO3 (siderite) representing a minor fraction of the total Fe(II) (3%).

DNA isolation, PCR amplification, cloning, sequencing, and phylogenetic analysis of isolates.
Cells were disrupted by bead-beating in sodium dodecyl sulfate lysis buffer, and DNA was isolated from other cellular material by extraction with phenol-chloroform-isoamyl alcohol (51). 16S rRNA genes were amplified by PCR as described by Elshahed et al. (25) using the universal forward primer 8f (5' AGAGTTTGAGCCTGGCTCAG 3') and the universal reverse primer 804r (5' GACTACCAGGGTATCTAATCC 3'). PCR products were cloned directly into a TOPO-TA vector (Invitrogen) according to the manufacturer's instructions. Inserts were sequenced as described by Elshahed et al. (25). Phylogenetic affiliations of isolates were roughly determined using Basic Local Alignment Search Tool (BLAST) (1). Nucleotide sequences were aligned using ClustalX software (58). An evolutionary distance tree (neighbor-joining algorithm with Jukes-Cantor corrections) was constructed using PAUP 4.0beta10 (Sinauer Associates, Sunderland, MA).

Analytical methods.
In preparation for X-ray diffraction (XRD) analysis, Fe(III) (hydr)oxides from incubations were dried on glass slides overnight in an anoxic glovebag and XRD was carried out on a Rigaku automated diffractometer (Rigaku/MSC, The Woodlands, TX). Fe phases were also extracted using 0.5 M HCl [for Fe(II)] (35), 0.25 M hydroxylamine-HCl in 0.25 M HCl [for amorphous Fe(III)] (35), and 0.2 M ammonium oxalate-0.2 M oxalic acid (pH 3.4) with exposure to light [for total Fe(III)] (40, 46). Fe in extracts was then quantified with the ferrozine assay (35). Acid volatile sulfide (AVS) and total reduced inorganic sulfur (TRIS) were extracted (59) and quantified by the methylene blue assay (13). Nitrate and nitrite were quantified by ion chromatography with conductivity detection (Dionex DX 500 fitted with an AS-4A column; Dionex Corp., Sunnyvale, CA). Acetate was quantified by ion chromatography using the same system fitted with an AS-11 column (47). Ammonium was quantified by the alkaline phenolate assay (20). Protein was quantified using the bicinchoninic acid assay (Pierce Biotechnology, Inc., Rockford, IL).


arrow
RESULTS AND DISCUSSION
 
Isolation and characterization of strain FW33AN.
Strain FW33AN was isolated from groundwater at the Oak Ridge FRC, which had received ethanol additions to stimulate nitrate and uranium reduction (30, 48). Phylogenetic analysis of 16S rRNA gene sequence of FW33AN revealed that it is most closely related to Klebsiella oxytoca and to Gly302-3, an organism that was present in Fe(III)-reducing enrichments from the FRC (39) (Fig. 1). FW33AN is not closely related phylogenetically to other groups of organisms capable of nitrate-dependent Fe(II) oxidation (Fig. 1), providing further evidence that the ability to couple Fe(II) oxidation to nitrate reduction is widespread among nitrate-reducing bacteria (52, 53, 56).



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. Distance dendrogram constructed using the 16S rRNA gene sequence of FW33AN. This shows the phylogenetic relatedness of FW33AN to nitrate-dependent Fe(II) oxidizing organisms (bold) and other enterobacteria (underlined). Bootstrap values were determined on the basis of results for 1,000 replicates and are shown for branches with more than 50% bootstrap support. Accession numbers are provided in parentheses.

FW33AN is capable of nitrate-dependent Fe(II) oxidation under nongrowth conditions (48) (see Fig. 3), but it is still not clear whether FW33AN can obtain energy from this reaction for growth. It also coupled acetate oxidation to nitrate reduction with transient nitrite accumulation during growth (Fig. 2). No ammonium accumulation was observed during growth of FW33AN on acetate. However, denitrification of nitrate to N2 by FW33AN is unlikely, since denitrification has not been previously reported in enterobacteria (14). PCR experiments repeatedly were not able to generate product using primers specific to nirK or nirS (genes encoding dissimilatory nitrite reductases in denitrifiers) (Anne Spain, personal communication), providing further evidence for the absence of a denitrification pathway. Production of N2O during nitrate reduction by a Klebsiella species has been previously reported (4), but only 30% of the nitrate in those experiments was converted to N2O, with the remainder of the nitrate reduced to ammonium. This latter scenario is also unlikely to be occurring in our experiments, as we would then expect to see the accumulation of 14 mM ammonium. Pinar and Ramos (41) showed that Klebsiella oxytoca may completely assimilate ammonium produced by the reduction of 40 mM nitrate provided as a terminal electron acceptor, a process that is the most likely explanation for why ammonium accumulation was not observed in nitrate-reducing cultures of FW33AN.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. Fe(II) oxidation by strain FW33AN with Fe(II)sol ({circ}) or FeS (•) under nitrate-reducing conditions (A). Fe(II) concentrations in uninoculated incubations are represented by {diamond} and {blacklozenge} for Fe(II)sol and FeS, respectively. Acid volatile sulfide (AVS) and total reduced inorganic sulfur (TRIS) were extracted from FeS oxidizing incubations at t = 14 days and quantified (B).



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 2. Growth (as indicated by protein concentration [{blacklozenge}]) of FW33AN with acetate ({diamond}) consumption, nitrate ({circ}) reduction, and transient nitrite (•) accumulation.

The effect of Fe(II) form on biogenic Fe(III) mineralogy.
FW33AN has been previously shown to couple oxidation of soluble Fe(II) to nitrate reduction (48). Since Fe(II) may be present in anoxic aquifers as insoluble FeS (12), we tested the ability of FW33AN to oxidize Fe(II) in the form of FeS. Despite its relative insolubility, FeS was oxidized at a rate comparable to soluble Fe(II) [Fe(II)sol] (Fig. 3A). At the conclusion of the incubations, we quantified acid-volatile sulfide (AVS) and total reduced inorganic sulfur (TRIS). The latter fraction includes partially oxidized sulfur species, including elemental sulfur, polysulfides, and polythionates (heretofore referred to as zero-valent sulfur) (59). These extractions showed that sulfide was oxidized over the course of the incubations (Fig. 3B), but no sulfate or thiosulfate could be detected, suggesting that the product of sulfide oxidation was zero-valent sulfur. Products of sulfide oxidation by hematite are zero-valent sulfur, thiosulfate, sulfite, and sulfate (21, 23, 36), but sulfide oxidation by goethite or ferrihydrite yields primarily zero-valent sulfur (7, 42, 43, 55). The small amount of Fe(III) we could detect in Fe(II) stocks (approximately 1%) would be sufficient to mediate the oxidation of only 13 µM sulfide to zero-valent sulfur. We did not test the ability of this organism to enzymatically oxidize sulfide, but we are not aware of sulfide oxidation by Klebsiella species, and it is likely that the zero-valent sulfur arose from the reaction of biogenic Fe(III) with sulfide (7, 42, 43, 55).

X-ray diffraction (XRD) analysis of biogenic Fe(III) (hydr)oxides at the conclusion of the incubations revealed the presence of goethite in the Fe(III) product of nitrate-dependent oxidation of Fe(II)sol (Fig. 4, spectrum D), while nitrate-dependent FeS (characterized as largely amorphous, but with traces of mackinawite [Fig. 4, spectrum A]) oxidation yielded amorphous Fe(III) (hydr)oxide (Fig. 4, spectrum C). The amounts of amorphous and crystalline Fe(III) phases were then determined using differential extractions of Fe(III) phases. Amorphous Fe(III) (hydr)oxide was operationally defined as the fraction of Fe that could be extracted with hydroxylamine-HCl (35), while crystalline Fe(III) (hydro)oxide was operationally defined as the fraction of Fe that could only be extracted with ammonium oxalate (40, 46). These extractions revealed that all Fe(III) (hydr)oxide produced by bacterial oxidation of FeS was amorphous, while 52% of the Fe(III) (hydr)oxide produced by oxidation of Fe(II)sol was in the crystalline fraction (Table 1).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4. X-ray diffraction spectra for Fe minerals in FeS-oxidizing incubations at t = 0 days (A), t = 8 days (B), t = 14 days (C) and in soluble Fe(II)-oxidizing incubations at t = 8 days (D). Reference plots for goethite and mackinawite are from JADE 3.1 (Materials Data Inc., Livermore, CA).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Composition of Fe(III) (hydr)oxides formed by nitrate- dependent oxidation of soluble Fe(II) or FeS by FW33AN

These results suggest that different forms of Fe(II) substrate give rise to different Fe(III) mineral phases upon nitrate-dependent Fe(II) oxidation. Similarly, Kappler and Newman (33) observed formation of the poorly crystalline Fe(III) (hydr) oxide ferrihydrite from anaerobic FeS oxidation by an anoxygenic, Fe(II)-oxidizing phototrophic bacterium, but goethite and lepidocrocite from oxidation of Fe(II)sol by the same organism. In those experiments, goethite and lepidocrocite were formed after 12 days of maturation, but no such transformation was observed in Fe(III) produced by FeS oxidation over a similar time period. The lack of Fe(III) (hydr)oxide crystallinity in FeS-oxidizing incubations may be the result of a low level of Fe(II) in solution. Soluble Fe(II) may have stimulated the transition of amorphous Fe(III) to more crystalline products (2, 15-18, 31), and the lack of it in the FeS-oxidizing incubations may have limited goethite formation.

The effect of Fe(II) oxidation rate on biogenic Fe(III) mineralogy.
We hypothesized that the rate of nitrate-dependent Fe(II) oxidation may also control the crystallinity of Fe(III) (hydr)oxide products. We tested the effect of the Fe(II) oxidation rate on biogenic Fe(III) mineralogy by incubating resting cells of strain FW33AN at protein levels of 0, 0.8, 1.4, and 4.4 mg protein with Fe(II)sol under nitrate-reducing conditions. Fe(II) was oxidized at initial rates of 0, 0.10, 0.20, and 0.61 mmol/day, respectively (Fig. 5). The mean specific initial Fe(II) oxidation rate in the incubations was 0.13 ± 0.01 mmol/mg protein/day. After 7 days of incubation, solids were removed, dried, and characterized by XRD. Fe(II) oxidation at the most rapid initial rate yielded amorphous Fe(III) (hydr)oxide (Fig. 6A) but with progressively lower rates of Fe(II) oxidation, a stronger goethite signal was observed (Fig. 6B and C), and a progressively larger proportion of Fe(III) was in the crystalline fraction (Table 1). Similarly, an increase in the crystallinity of Fe(III) (hydr)oxides has been observed under conditions of slow abiotic hydrolysis (19, 60).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 5. Nitrate-dependent Fe(II) oxidation by strain FW33AN at cell densities of 0 mg protein ({blacklozenge}), 0.8 mg protein (•), 2 mg protein ({oplus}), and 4 mg protein ({circ}) in 20-ml reaction solutions.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 6. X-ray diffraction spectra for biogenic Fe(III) minerals produced by strain FW33AN at Fe(II) oxidation rates of 0.61 mmol/day (A), 0.20 mmol/day (B), and 0.10 mmol/day (C). Reference plot for goethite is from JADE 3.1 (Materials Data Inc., Livermore, CA).

Residual Fe(II) present in slow-oxidizing incubations may have enhanced goethite crystal formation (2, 15-18, 31, 33). In this scenario, biogenic Fe(III) (hydr)oxide in all incubations may have initially been amorphous, but with the slower rate of Fe(II) consumption in slow-oxidizing incubations, this Fe(II) was available to catalyze goethite formation. It is unlikely that increased cell material altered Fe(III) dissolution/reprecipitation (33), since the Fe(III) was removed for XRD analysis soon after Fe(II) oxidation ceased (t = 7 days). The rapidity of goethite formation (within 1 week) by strain FW33AN is striking. In experiments by Kappler and Newman (33), minerals collected 5 days after complete oxidation of approximately 5 mM Fe(II) were amorphous. Goethite and lepidocrocite formation only appeared after extended incubation (≥12 days) in the growth medium. We conclude that as with abiotic Fe(III) mineral formation (19), the rate of biological nitrate-dependent Fe(II) oxidation exerts a strong influence on biogenic Fe(III) (hydr)oxide mineralogy. Indeed, ferrihydrite was formed by Dechlorosoma suillum at an initial nitrate-dependent Fe(II) oxidation rate of approximately 72 mM/day (34), while magnetite was formed when this organism oxidized Fe(II) at a rate of approximately 0.6 mM/day (11). A nitrate-dependent Fe(II) oxidizing organism isolated by Straub et al. (54) produced ferrihydrite, but the rate of Fe(II) oxidation was not provided.

The mineralogy of biogenic Fe(III) is likely to play an important role in the biogeochemical cycling of Fe(III) (29, 44, 50, 62). Our results suggest that the Fe(II) chemical form and Fe(II) oxidation rate exert a strong influence on biogenic Fe(III) mineralogy, but these factors are by no means the exclusive determinants of biogenic Fe(III) mineralogy. For instance, phosphate may be an especially important factor in controlling Fe(III) crystallinity (10, 32; E. E. Roden, personal communication). Geophysical and geochemical conditions (e.g., temperature or pH) and the presence of cellular material will certainly affect biogenic Fe(III) mineralogy (5, 8, 9, 17, 19, 31, 43). Further work is necessary to determine the relative contributions of these other variables to Fe(III) mineralogy in situ.


arrow
ACKNOWLEDGMENTS
 
We thank Yasser Mohammed and Robert Turner for assistance with XRD work.

This work was supported by grants FG03-02ER63443 and DE-FC02-96ER62278 from the Office of Biological and Environmental Research (OBER) of the Office of Science, U.S. Department of Energy (DOE), Natural and Accelerated Bioremediation Research (NABIR) Program. Preparation of the manuscript was partially supported by the Center for Environmental Chemistry and Geochemistry at the Pennsylvania State University (J.M.S.).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Botany and Microbiology, University of Oklahoma, 770 Van Vleet Oval, Norman, OK 73019. Phone: (405) 325-0437. Fax: (405) 325-7619. E-mail: krumholz{at}ou.edu. Back

{dagger} Present address: Department of Civil and Environmental Engineering, The Pennsylvania State University, 212 Sackett Building, University Park, PA 16802. Back


arrow
REFERENCES
 
    1
  1. Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  2. 2
  3. Andreeva, D., I. Mitov, T. Tabakova, V. Mitrov, and A. Andreev. 1995. Influence of iron(II) on the transformation of ferrihydrite into goethite in acid medium. Mater. Chem. Phys. 41:146-149.[CrossRef]
  4. 3
  5. Benz, M., A. Brune, and B. Schink. 1998. Anaerobic and aerobic oxidation of ferrous iron at neutral pH by chemoheterotrophic nitrate-reducing bacteria. Arch. Microbiol. 169:159-165.[CrossRef][Medline]
  6. 4
  7. Bleakley, B. H., and J. M. Tiedje. 1982. Nitrous oxide production by organisms other than nitrifiers or denitrifiers. Appl. Environ. Microbiol. 44:1342-1348.[Abstract/Free Full Text]
  8. 5
  9. Brown, D. A., J. A. Sawicki, and B. L. Sherriff. 1998. Alteration of microbially precipitated iron oxides and hydroxides. Am. Mineral. 83:1419-1425.[Abstract]
  10. 6
  11. Caldwell, M. E., R. S. Tanner, and J. M. Suflita. 1999. Microbial metabolism of benzene and the oxidation of ferrous iron under anaerobic conditions: implications for bioremediation. Anaerobe 5:595-603.
  12. 7
  13. Cantrell, K. J., S. B. Yabusaki, M. H. Engelhard, A. V. Mitroshkov, and E. C. Thornton. 2003. Oxidation of H2S by iron oxides in unsaturated conditions. Environ. Sci. Technol. 37:2192-2199.[Medline]
  14. 8
  15. Chan, C. S., G. De Stasio, S. A. Welch, M. Girasole, B. H. Frazer, M. V. Nesterova, S. Fakra, and J. F. Banfield. 2004. Microbial polysaccharides template assembly of nanocrystal fibers. Science 303:1656-1658.[Abstract/Free Full Text]
  16. 9
  17. Chatellier, X., D. Fortin, M. M. West, G. G. Leppared, and F. G. Ferris. 2001. Effect of the presence of bacterial surfaces during the synthesis of Fe oxides by oxidation of ferrous ions. Eur. J. Mineral. 13:705-714.
  18. 10
  19. Chatellier, X., M. M. West, J. Rose, D. Fortin, G. G. Leppared, and F. G. Ferris. 2004. Characterization of iron-oxides formed by oxidation of ferrous ions in the presence of various bacterial species and inorganic ligands. Geomicrobiol. J. 21:99-112.[CrossRef]
  20. 11
  21. Chaudhuri, S. K., J. G. Lack, and J. D. Coates. 2001. Biogenic magnetite formation through anaerobic biooxidation of Fe(II). Appl. Environ. Microbiol. 67:2844-2848.[Abstract/Free Full Text]
  22. 12
  23. Christiansen, T. H., P. L. Berg, S. A. Banwart, R. Jakobsen, G. Heron, and H.-J. Albrechtsen. 2000. Characterization of redox conditions in groundwater contaminant plumes. J. Contam. Hydrol. 45:165-241.
  24. 13
  25. Cline, J. D. 1969. Spectrophotometric detection of hydrogen sulfide in natural waters. Limnol. Oceanogr. 14:454-458.
  26. 14
  27. Cole, J. 1996. Nitrate reduction to ammonia by enteric bacteria: redundancy, or a strategy for survival during oxygen starvation? FEMS Microbiol. Rev. 136:1-11.
  28. 15
  29. Cornell, R. M., and R. Giovanoli. 1987. Effect of manganese on the transformation of ferrihydrite into goethite and jacobsite in alkaline media. Clays Clay Minerals 35:11-20.[Abstract]
  30. 16
  31. Cornell, R. M., and W. Schneider. 1989. Formation of goethite from ferrihydrite at physiological pH under the influence of cysteine. Polyhedron 8:149-155.
  32. 17
  33. Cornell, R. M., W. Schneider, and R. Giovanoli. 1989. The transformation of ferrihydrite to lepidocrocite. Clay Minerals 24:549-553.[Abstract]
  34. 18
  35. Cornell, R. M., W. Schneider, and R. Giovanoli. 1991. Preparation and characterization of colloidal {alpha}-FeOOH with a narrow size distribution. J. Chem. Soc. Faraday Trans. 87:869-873.[CrossRef]
  36. 19
  37. Cornell, R. M., and U. Schwertmann. 2003. The iron oxides, 2nd ed. Wiley-VCH, Weinheim, Germany.
  38. 20
  39. Daniels, L., R. S. Hanson, and J. A. Phillips. 1994. Chemical analysis, p. 512-554. In P. Gerhardt, R. G. E. Murray, W. A. Wood, and N. R. Krieg (ed.), Methods for general and molecular bacteriology. American Society for Microbiology, Washington, D.C.
  40. 21
  41. Davydov, A., K. T. Chuang, and A. R. Sanger. 1998. Mechanism of H2S oxidation by ferric oxide and hydroxide surfaces. J. Phys. Chem. B 102:4745-4752.[CrossRef]
  42. 22
  43. Deng, Y., and W. Stumm. 1994. Reactivity of aquatic iron(III) oxyhydroxides—implications for redox cycling of iron in natural waters. Appl. Geochem. 9:23-36.
  44. 23
  45. dos Santos Afonso, M., and W. Stumm. 1992. Reductive dissolution of iron(III) (hydr)oxides by hydrogen sulfide. Langmuir 8:1671-1675.[CrossRef]
  46. 24
  47. Elias, D. E., L. R. Krumholz, D. Wong, P. E. Long, and J. M. Suflita. 2003. Characterization of microbial activities and U reduction in a shallow aquifer contaminated by uranium mill tailings. Microbial Ecol. 46:83-91.[CrossRef][Medline]
  48. 25
  49. Elshahed, M. S., J. M. Senko, F. Z. Najar, S. M. Kenton, B. A. Roe, T. A. Dewers, J. R. Spear, and L. R. Krumholz. 2004. Bacterial diversity and sulfur cycling in a mesophilic sulfide-rich spring. Appl. Environ. Microbiol. 69:5609-5621.
  50. 26
  51. Finneran, K. T., M. E. Housewright, and D. R. Lovley. 2002. Multiple influences of nitrate on uranium solubility during bioremediation of uranium-contaminated subsurface sediments. Environ. Microbiol. 4:510-516.[CrossRef][Medline]
  52. 27
  53. Frankel, R. B., and D. A. Bazylinski. 2003. Biologically induced mineralization by bacteria. Rev. Mineral. Geochem. 54:95-114.[Free Full Text]
  54. 28
  55. Glasauer, S., P. G. Weidler, S. Langley, and T. J. Beveridge. 2003. Controls on Fe reduction and mineral formation by a subsurface bacterium. Geochim. Cosmochim. Acta 67:1277-1288.
  56. 29
  57. Hansel, C. M., S. G. Benner, P. Nico, and S. Fendorf. 2004. Structural constraints of ferric (hydr)oxides on dissimilatory iron reduction and the fate of Fe(II). Geochim. Cosmochim. Acta 68:3217-3329.
  58. 30
  59. Istok, J. D., J. M. Senko, L. R. Krumholz, D. Watson, M. A. Bogle, A. Peacock, Y.-J. Chang, and D. C. White. 2004. In situ bioreduction of technetium and uranium in a nitrate contaminated aquifer. Environ. Sci. Technol. 38:468-475.[Medline]
  60. 31
  61. Jang, J.-H., B. A. Dempsey, G. L. Catchen, and W. D. Burgos. 2003. Effects of Zn(II), Cu(II), Mn(II), Fe(II), NO3, or SO42–, at pH 6.5 and 8.5 on transformations of hydrous ferric oxide (HFO) as evidenced by Mössbauer spectroscopy. Colloids Surfaces A Physicochem. Eng. Aspects 221:55-68.[CrossRef]
  62. 32
  63. Jurado, M. J., V. Barrón, and J. Torrent. 2003. Can the presence of structural phosphorous help discriminate between abiogenic and biogenic magnetites? J. Biol. Inorg. Chem. 8:810-814.[CrossRef][Medline]
  64. 33
  65. Kappler, A., and D. K. Newman. 2004. Formation of Fe(III) minerals by Fe(II)-oxidizing photoautotrophic bacteria. Geochim. Cosmochim Acta 68:1217-1226.
  66. 34
  67. Lack, J. G., S. K. Chaudhuri, R. Chakraborty, L. A. Achenbach, and J. D. Coates. 2002. Anaerobic biooxidation of Fe(II) by Dechlorosoma suillum. Microbial Ecol. 43:424-431.[CrossRef][Medline]
  68. 35
  69. Lovley, D. R., and E. J. P. Phillips. 1987. Rapid assay for microbially reducible ferric iron in aquatic sediments. Appl. Environ. Microbiol. 53:1536-1540.[Abstract/Free Full Text]
  70. 36
  71. Neal, A. L., S. Techkarnjanaruk, A. Dohnalkova, D. McCready, B. M. Peyton, G. G. Geesey. 2001. Iron sulfides and sulfur species produced at hematite surfaces in the presence of sulfate-reducing bacteria. Geochim. Cosmochim. Acta 65:223-235.[CrossRef]
  72. 37
  73. Nielsen, J. L., and P. H. Nielsen. 1998. Microbial nitrate-dependent oxidation of ferrous iron in activated sludge. Environ. Sci. Technol. 32:3556-3561.[CrossRef]
  74. 38
  75. Parkhurst, D. L. 1995. Users guide to PHREEQC—a computer program for speciation, reaction-path, advective transport and inverse geochemical calculations. Water Resources Report 95-4227. U.S. Geological Survey, Lakewood, Colo.
  76. 39
  77. Petrie, L., N. N. North, S. L. Dollhopf, D. L. Balkwill, and J. E. Kostka. 2003. Enumeration and characterization of iron(III)-reducing microbial communities from acidic subsurface sediments contaminated with uranium (VI). Appl. Environ. Microbiol. 69:7467-7479.[Abstract/Free Full Text]
  78. 40
  79. Phillips, E. J. P., and Lovley, D. R. 1987. Determination of Fe(III) and Fe(II) in oxalate extracts of sediments. Soil Sci. Soc. Am. J. 51:938-941.[Abstract/Free Full Text]
  80. 41
  81. Pinar, G., and J. L. Ramos. 1998. Recombinant Klebsiella oxytoca strains with improved efficiency in removal of high nitrate loads. Appl. Environ. Microbiol. 64:5016-5019.[Abstract/Free Full Text]
  82. 42
  83. Poulton, S. W., M. D. Krom, and R. Raiswall. 2004. A revised scheme for the reactivity of iron (oxyhydr)oxide minerals towards dissolved sulfide. Geochim. Cosmochim. Acta 68:3703-3715.
  84. 43
  85. Pyzic, A. J., and S. E. Sommers. 1981. Sedimentary iron monosulfides: kinetics and mechanism of formation. Geochim. Cosmochim. Acta 45:687-698.
  86. 44
  87. Roden, E. E. 2003. Fe(III) oxide reactivity toward biological versus chemical reduction. Environ. Sci. Technol. 37:1319-1324.[CrossRef]
  88. 45
  89. Schippers, A., and B. B. Jørgensen. 2002. Biogeochemistry of pyrite and iron sulfide oxidation in marine sediments. Geochim. Cosmochim. Acta 66:85-92.[CrossRef]
  90. 46
  91. Schwertmann, U., and R. M. Cornell. 2000. Iron oxides in the laboratory, 2nd ed. Wiley-VCH, New York, N.Y.
  92. 47
  93. Senko, J. M., J. D. Istok, J. M. Suflita, and L. R. Krumholz. 2002. In-situ evidence for uranium immobilization and remobilization. Environ. Sci. Technol. 36:1491-1496.[Medline]
  94. 48
  95. Senko, J. M., Y. Mohammed, T. A. Dewers, and L. R. Krumholz. 2005. Role for Fe(III) minerals in nitrate-dependent microbial U(IV) oxidation. Environ. Sci. Technol. 39:2529-2536.[Medline]
  96. 49
  97. Shelobolina, E. S., C. G. VanPraagh, and D. R. Lovley. 2003. Use of ferric and ferrous iron containing minerals for respiration by Desulfitobacterium frappieri. Geomicrobiol. J. 20:143-156.[CrossRef]
  98. 50
  99. Shelobolina, E. S., R. T. Anderson, Y. N. Vodyanitskii, A. V. Sivtsov, R. Yuretich, and D. R. Lovley. 2004. Importance of clay size minerals for Fe(III) respiration in a petroleum-contaminated aquifer. Geobiology 2:67-76.
  100. 51
  101. Steger, J. L., C. Vincent, J. D. Ballard, and L. R. Krumholz. 2002. Desulfovibrio sp. genes involved in the metabolism of hydrogen and lactate. Appl. Environ. Microbiol. 68:1932-1937.[Abstract/Free Full Text]
  102. 52
  103. Straub, K. L., M. Benz, B. Schink, and F. Widdel. 1996. Anaerobic, nitrate-dependent microbial oxidation of ferrous iron. Appl. Environ. Microbiol. 62:1458-1460.[Abstract]
  104. 53
  105. Straub, K. L., and B. E. E. Buchholz-Cleven. 1998. Enumeration and detection of anaerobic ferrous iron-oxidizing, nitrate-reducing bacteria from diverse European sediments. Appl. Environ. Microbiol. 64:4846-4856.[Abstract/Free Full Text]
  106. 54
  107. Straub, K. L., M. Hanzlik, and B. E. E. Buchholz-Cleven. 1998. The use of biologically produced ferrihydrite for the isolation of novel iron-reducing bacteria. Syst. Appl. Microbiol. 21:442-449.[Medline]
  108. 55
  109. Straub, K. L., and B. Schink. 2004. Ferrihydrite-dependent growth of Sulfurospirillum deleyianum through electron transfer via sulfur cycling. Appl. Environ. Microbiol. 70:5744-5749.[Abstract/Free Full Text]
  110. 56
  111. Straub, K. L., W. A. Schönhuber, B. E. E. Buchholz-Cleven, and B. Schink. 2004. Diversity of ferrous iron-oxidizing, nitrate-reducing bacteria and their involvement in oxygen-independent iron cycling. Geomicrobiol. J. 21:371-378.
  112. 57
  113. Tanner, R. S. 1997. Cultivation of bacteria and fungi, p. 52-55. In C. J. Hurst, G. R. Knudsen, M. J. McInerney, L. D. Stetzenbach, and M. V. Walter (ed.), Manual of environmental microbiology. American Society for Microbiology, Washington, D.C.
  114. 58
  115. Thompson, J. D., T. J. Gibson, F. Pleioniak, F. Jeanmougin, and D. G. Higgins. 1997. The Clustal X interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.[Abstract/Free Full Text]
  116. 59
  117. Ulrich, G. A., L. R. Krumholz, and J. M. Suflita. 1997. A rapid and simple method for estimating sulfate reduction activity and quantifying inorganic sulfides. Appl. Environ. Microbiol. 63:1627-1630.[Abstract]
  118. 60
  119. van der Zee, C., D. R. Roberts, D. G. Rancourt, and C. P. Slomp. 2003. Nanogoethite is the dominant reactive oxyhydroxide phase in lake and marine sediments. Geology 31:993-996.[Abstract/Free Full Text]
  120. 61
  121. Weber, K. A., F. W. Picardal, and E. E. Roden. 2001. Microbially catalyzed nitrate-dependent oxidation of biogenic solid-phase Fe(II) compounds. Environ. Sci. Technol. 35:1644-1650.[Medline]
  122. 62
  123. Zachara, J. M., J. K. Fredrickson, S.-M. Li, D. W. Kennedy, S. C. Smith, and P. L. Gassman. 1998. Bacterial reduction of crystalline Fe3+ oxides in single phase suspensions and subsurface materials. Am. Mineral. 83:1426-1443.[Abstract]


Applied and Environmental Microbiology, November 2005, p. 7172-7177, Vol. 71, No. 11
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.11.7172-7177.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Akob, D. M., Mills, H. J., Gihring, T. M., Kerkhof, L., Stucki, J. W., Anastacio, A. S., Chin, K.-J., Kusel, K., Palumbo, A. V., Watson, D. B., Kostka, J. E. (2008). Functional Diversity and Electron Donor Dependence of Microbial Populations Capable of U(VI) Reduction in Radionuclide-Contaminated Subsurface Sediments. Appl. Environ. Microbiol. 74: 3159-3170 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Senko, J. M.
Right arrow Articles by Krumholz, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Senko, J. M.
Right arrow Articles by Krumholz, L. R.
Agricola
Right arrow Articles by Senko, J. M.
Right arrow Articles by Krumholz, L. R.