This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sørensen, K. B.
Right arrow Articles by Oren, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sørensen, K. B.
Right arrow Articles by Oren, A.
Agricola
Right arrow Articles by Sørensen, K. B.
Right arrow Articles by Oren, A.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, November 2005, p. 7352-7365, Vol. 71, No. 11
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.11.7352-7365.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Community Composition of a Hypersaline Endoevaporitic Microbial Mat

Ketil Bernt Sørensen,1* Donald E. Canfield,2 Andreas P. Teske,3 and Aharon Oren4

Department of Geology and Geophysics Post 701, 1680 East-West Rd., University of Hawaii, Honolulu, Hawaii 96822,1 Danish Center for Earth System Science, Institute of Biology, University of Southern Denmark, University of Odense, Odense, Denmark,2 Marine Sciences Department, 12-7 Venable Hall CB 3300, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599,3 The Institute of Life Sciences and the Moshe Shilo Minerva Center for Marine Biogeochemistry, The Hebrew University of Jerusalem, 91904 Jerusalem, Israel4

Received 27 April 2005/ Accepted 30 May 2005


arrow
ABSTRACT
 
A hypersaline, endoevaporitic microbial community in Eilat, Israel, was studied by microscopy and by PCR amplification of genes for 16S rRNA from different layers. In terms of biomass, the oxygenic layers of the community were dominated by Cyanobacteria of the Halothece, Spirulina, and Phormidium types, but cell counts (based on 4',6'-diamidino-2-phenylindole staining) and molecular surveys (clone libraries of PCR-amplified genes for 16S rRNA) showed that oxygenic phototrophs were outnumbered by the other constituents of the community, including chemotrophs and anoxygenic phototrophs. Bacterial clone libraries were dominated by phylotypes affiliated with the Bacteroidetes group and both photo- and chemotrophic groups of {alpha}-proteobacteria. Green filaments related to the Chloroflexi were less abundant than reported from hypersaline microbial mats growing at lower salinities and were only detected in the deepest part of the anoxygenic phototrophic zone. Also detected were nonphototrophic {gamma}- and {delta}-proteobacteria, Planctomycetes, the TM6 group, Firmicutes, and Spirochetes. Several of the phylotypes showed a distinct vertical distribution in the crust, suggesting specific adaptations to the presence or absence of oxygen and light. Archaea were less abundant than Bacteria, their diversity was lower, and the community was less stratified. Detected archaeal groups included organisms affiliated with the Methanosarcinales, the Halobacteriales, and uncultured groups of Euryarchaeota.


arrow
INTRODUCTION
 
Photosynthetic communities containing distinct horizontal layers of oxygenic and anoxygenic phototrophs often cover the bottom of hypersaline ponds used for the production of sea salt. The physical appearance of these microbial communities varies according to salinity (55). At salinities below ca. 15%, the photosynthetic communities tend to form compact and highly active microbial mats on the surface of the pond floor, whereas in ponds containing between 15 and 25% salt, the mats are less compact since the photosynthetic layers tend to be embedded within the crystalline salt crust on the pond bottom. Such endoevaporitic gypsum- or halite-associated microbial systems have been reported from a number of solar salterns around the world, including those from the coasts of the Gulf of Mexico (55, 66), the Mediterranean Sea (12), the Baja Peninsula (60), and the Red Sea (53). In endoevaporitic microbial ecosystems associated with gypsum deposits, several layers of oxygenic and anoxygenic phototrophs are often visible, indicating some level of stratification in the populations. In photosynthetic communities growing within halite deposits, a vertical banding of the photosynthetic populations is still observed, but the complexity of the communities seems diminished compared to populations growing within gypsum (60).

The microbial ecology of hypersaline, endoevaporitic communities is interesting for a number of reasons. Some of the earliest evidence for life in the geologic record is preserved in the isotopic composition of organic carbon and sulfur species in 3.5 billion-year-old barite, originally deposited as gypsum, at North Pole, Australia (62). The endoevaporitic communities found today in solar salterns are likely modern homologues to the microbial communities once housed in these ancient sulfate deposits. The solar salterns may provide information about the prerequisites necessary for life to develop in evaporitic, sulfate-rich environments as once existed on the Martian surface (67, 68). Finally, endoevaporitic communities grow in a salinity range where numerous physiological groups are excluded, potentially altering the biogeochemical cycling in the system (48).

The endoevaporitic microbial communities in the salterns of Eilat have previously been studied in terms of light penetration, oxygen and sulfur biogeochemistry, and the salt tolerance of phototrophs, sulfate reducers, and methanogens (8, 53, 65). The upper oxygenic zone, which is typically 1 to 2 cm deep, consists of two layers of Cyanobacteria, sometimes separated by a white layer devoid of phototrophs, overlying a layer containing various anoxygenic phototrophs. The cell volume-specific photosynthesis rates are comparable to microbial mat communities from other environments, but the lower cell density results in lower overall oxygen production rates (8). This, and the deeper distribution of the phototrophs, results in a much decreased gas exchange with the overlying water such that the major part of oxygen produced in the crust is also consumed within the crust, mainly by heterotrophic organisms. The salinity tolerance of Cyanobacteria, anoxygenic phototrophs, sulfate reducers, and methanogens were in agreement with what has been observed in pure cultures (65). Thus, sulfate reducers and anoxygenic photoautotrophic organisms in the crust are inhibited at salinities greater than 12 and 15%, respectively, whereas methanogens and Cyanobacteria are not inhibited at the in situ salinity.

The purpose of the present study is to supplement these previous investigations with a broader phylogenetic overview of the organisms present in the crust. This should allow us to identify the major components of the heterotrophic community, which are not easily identified by microscopy, and to compare the phylogenetic composition of this community with other benthic phototrophic microbial systems.


arrow
MATERIALS AND METHODS
 
Site description and sampling.
The salterns of the Israel Salt Industries, Ltd., in Eilat consist of a series of ponds through which seawater and water desalination refuse brines are passed as they increase in salinity due to evaporation. An endoevaporitic, phototrophic community develops within the gypsum crust covering the bottom of a number of these ponds, where salinities range from ca. 15 to 25%. The pond chosen for the present study had a salinity of 20%, and the crust varied in thickness between 1 and 10 cm. The microbial populations in this crust had a well-developed laminated benthic phototrophic community resembling previous descriptions (8, 53, 65). Thus, the uppermost 2 to 6 mm of the crust was brownish in color (B layer), below which a 2- to 8-mm-thick white zone appeared to be devoid of phototrophs (W layer). A bright green layer was situated underneath the white layer (G layer), and finally a purple layer, sometimes overlying a deeper thin, olive-green layer, marked the bottom of the phototrophic community (P/O layer). Underneath the purple or olive-green layer, the crust and the underlying sediment were highly odorous and black or grayish due to sulfide accumulation (S layer). Pieces of crust of ca. 15 by 15 cm were sampled by using a hammer, chisel, and saw. Individual layers were isolated with a forceps, and 1- to 2-g samples were either frozen in liquid nitrogen for later DNA extraction or fixed in paraformaldehyde for microscopic analysis.

Microscopic examinations.
Unless otherwise stated, the chemicals used were purchased from Fisher Scientific. Crust samples from each layer were gently disaggregated in a mortar, and weighed subsamples were distributed into 50-ml centrifuge tubes. After centrifugation (6,000 x g, 10 min), the supernatant liquid was removed, and 10 ml of sterile-filtered pond water (0.2-µm pore size; Cameo25AS [Osmonics, Inc.]) containing 3% (wt/vol) paraformaldehyde was added. Each tube was shaken gently and let to sit for 4 h at 4°C. After this fixation step, the tubes were centrifuged, and the pellets were washed three times with sterile-filtered pond water. Finally, the pellet was resuspended in a 1:1 mixture of filtered pond water and ethanol and stored at –20°C. For cell counts, fixed samples were briefly vortexed and allowed to settle for ca. 30 s. Afterward, 10 to 100 µl of the water phase was collected with a pipette, mixed with 5 ml of distilled water, and filtered onto polycarbonate filters (0.22-µm pore size, 25-mm diameter [Osmonics, Inc.]) mounted in a filtering system. The filters were stained for 10 min with the DNA-specific stain 4,6-diamidino-2-phenylindole (DAPI) in a 1-µg ml–1 solution (56) and subsequently washed twice by filtering 5 ml of distilled water through each filter. The density of cells on each filter was quantified by using a fluorescence microscope (Leica Microsystems DMCB). The biovolume of each group was calculated from cell numbers and estimated average cell sizes.

DNA extraction procedure.
Genomic DNA was extracted from samples of the W, G, P/O, and S layers. Samples of 0.1 to 0.5 g were mixed with 900 µl of lysis buffer (50 mM Tris, 25% [wt/vol] sucrose; pH 8) and 60 µl of sodium dodecyl sulfate solution (10% [wt/vol]) and subjected to three cycles of freezing-thawing in liquid nitrogen and in a water bath at 65°C. Proteinase K (42 µl of a 20-mg ml–1 stock solution) was added, and the sample was incubated at 55°C for 60min. The DNA was extracted after addition of 1 volume phenol-chloroform-isoamyl alcohol (25:24:1, pH 7.9) by brief vortexing, followed by centrifugation (10,000 x g, 10 min). The aqueous phase from each sample was mixed with 0.1volume of 5 M NaCl and two volumes of 96% (vol/vol) ethanol and left overnight at –80°C. Each sample was centrifuged (10,000 x g, 40 min, 4°C), and the DNA pellet was washed with 70% ethanol. Finally, the extracted DNA was stored at –80°C in autoclaved Milli-Q water.

Cloning and sequencing.
PCRs were performed with the primers bac8f (AG(A/G)GTTTGATCCTGGCTCAG) and bac1492r (CGGCTACCTTGTTACGACTT) for amplification of bacterial genes for 16S rRNA or with the primers arc8f (TCCGGTTGATCCTGCC) and arc1492r (GGCTACCTTGTTACGACTT) for archaeal genes. Taq DNA polymerase and PCR buffer B were purchased from Promega, Madison, WI. PCRs of 50 µl containing 1.5 mM Mg2+ were prepared with 1 U of Taq polymerase, 10 nmol of deoxynucleoside triphosphate, and 50pmol of each primer (Promega). Between 1 and 5 µl of the DNA extractions was added, and PCRs were performed in an Eppendorf thermocycler using cycles consisting of a 45-s 94°C denaturing step, a 45-s annealing step at 58°C, and a 3-min elongation step at 72°C. In general, 28 and 32 PCR cycles were necessary in order to obtain sufficient DNA using the Bacteria- or Archaea-specific primers, respectively. PCR products were gel purified on 1% (wt/vol) low-melting-point agarose gels. About 50 ng of PCR product was loaded on the gel, run for 30 min at 70 V, and stained with SYBR gold (Invitrogen Corp., Carlsbad, CA). The PCR products were visualized on a Dark Reader transilluminator (Clare Chemicals, Dolores, CO) and excised, and DNA was extracted from the gel by using the QIAEXII gel extraction kit according to the manufacturer's instructions. The purified DNA samples were A-tailed to improve cloning efficiency by mixing the purified PCR product (40 µl) with 5 µl of adenosine deoxynucleoside triphosphate (2 mM), 5 µl of 10x PCR buffer, and 1 U of Taq DNA polymerase (Promega). The mixture was incubated at 72°C for 10 min, extracted with phenol-chloroform-isoamyl alcohol (25:24:1), and centrifuged at 6,000 x g for 5 min. The aqueous phase was then transferred to a fresh microcentrifuge tube and precipitated with 2.5 volumes of ethanol and 0.1 volume of 5 M NaCl. After centrifugation (10,000 x g, 10 min, 4°C), the pellet was washed once with 20 µl of 70% ethanol, air dried, and resuspended in 4 µl of PCR water. These PCR products were cloned using the TOPO XL PCR cloning kit (Invitrogen, Carlsbad, CA) and transformed by electroporation according to the manufacturer's specifications. After plating on LB agar and overnight incubation at 37°C, individual colonies were picked randomly for sequencing of plasmid inserts. Sequence data were obtained at the sequencing facility at Marine Biological Laboratory in Woods Hole, with the sequencing primers M13F (5'-GTA AAACGACGGCCAG-3') and M13R (5'-CAGGAAACAGCTATGAC-3'). Forward and reverse reads were assembled, aligned, and checked for chimeric structures by using the Bellerophon program (26), as well as the CHIMERA_CHECK application on the rdp Web site (http://rdp.cme.msu.edu/index.jsp).

Phylogenetic analysis.
Sequence data were BLAST analyzed against the GenBank 16S rRNA database (1). The sequences were then aligned with their closest relatives and representative cultured and uncultured Bacteria and Archaea by using the CLUSTAL W program, followed by manual alignment in Seqpup (21). Phylogenetic trees were constructed from the alignment sequences by using Jukes-Cantor distance matrices for inferring the tree topology and neighbor joining and maximum-parsimony for bootstrap analysis (1,000 replicates) of the branching pattern using the PHYLIP software package (17).

DGGE analysis.
For denaturing gradient gel electrophoresis (DGGE)-analysis, rRNA gene fragments of about 150 bp were amplified by using primers 341f [CCTACGGG(A/G)GGCAGCAG] and 521r (ACCGCGGCTGCTGGCAC) for Bacteria and primers 344f [ACGGGG(C/T)GCAGCAGGCG] and 518r [GGT(A/G)TTACCGCGGCGGCTG] for Archaea (modified from Muyzer et al. (42) and Øvreås et al. (53a). Both forward primers were supplied with aGC-clamp (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGG GGGG) at the 5' end. The reaction mixture and PCR program were as described above, except for the duration of the elongation step, which was decreased to 1 min, and the annealing temperature, which was increased to 60°C. The PCR products were separated by DGGE on a Bio-Rad Dcode system (42). Two stock solutions were prepared, representing 0 and 100% denaturing agent, respectively. The 0% solution consisted of 10% (wt/vol) acrylamide-bisacrylamide (37.5:1) in 0.5x Tris-acetic acid-EDTA buffer (TAE), and the 100% solution consisted of 10% (wt/vol) acrylamide-bisacrylamide, 420 g of urea liter–1, and 400 ml of formamide liter–1 in 0.5x TAE. The DGGE gels were cast by using mixtures of these stock solutions in linear denaturing gradients with 40% denaturing agent in the top and 70% in the bottom of the gels. The wells in each gel were loaded with 10 µl of PCR products, and the gels were run for 18 h at 70 V and 60°C. The gels were stained for 30 min in 0.5x TAE buffer containing 1:10,000 SYBR-gold (Bio-Rad) and evaluated on a Dark Reader transilluminator (Clare Chemicals, Dolores, CO). Individual bands were excised and reamplified, and 5 µl of the new PCR products was run on another DGGE gel together with the original sample to confirm the identity and purity of the excised DNA. Reamplified bands were sequenced at the DNA sequencing facility at the School of Medicine at the University of North Carolina at Chapel Hill.


arrow
RESULTS
 
Microscopy and enumeration of the microorganisms in the crust.
We divided the organisms into the following categories: (i) unicellular Halothece-like Cyanobacteria (20); (ii) green filaments with red autofluorescence during epifluorescence microscopy; (iii) organisms resembling Halochromatium (28) with intracellular globules (presumably sulfur); (iv) thread-like organisms with no autofluorescence; and (v) unicellular, small morphotypes, including vibrios, cocci, and oval cell shapes. Representatives from each of these groups are shown in Fig. 1. Each group was counted after DAPI staining, and the resulting cell numbers and estimated biovolumes are summarized in Table 1.



View larger version (74K):
[in this window]
[in a new window]
  		FIG. 1. Phase-contrast and epifluorescence micrographs of organisms in the gypsum crust. (a) Halothece-like unicellular cyanobacterium from the upper brown layer; (b) Spirulina/Halospirulina- like cyanobacterium from the green layer; (c) Phormidium-like and Halothece-like Cyanobacteria from the green layer; (d) DAPI stain of a P/O layer sample showing the abundant thread-like organisms and various small morphotypes; (e) Halochromatium-like bacterium with internal granules (presumably sulfur).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Results of cell counts from different layers of the crusta

Small unicellular or thread-like organisms constituted 88% of the population in the B layer. However, the Cyanobacteria accounted for the major part of the biovolume in the layer due to their larger cell size (Table 1). All of the Cyanobacteria observed in this layer resembled members of the Halothece cluster. The W layer that separated the two oxygenic layers in the crust was comprised entirely of small unicellular prokaryotes, and no obvious phototrophs were observed. The brightly colored G layer, located just below the W layer, consisted of 28% by numbers of Cyanobacteria, 24% thread-like, nonfluorescing organisms resembling their counterparts from the brown layer, and 48% small organisms of various morphotypes. The filamentous Cyanobacteria were straight or coiled with only one trichome per sheath and cell diameters from 1 to 6 µm. Heterocysts were not observed. Thus, they appeared to be members of the Oscillatoriales (75). The unicellular Cyanobacteria in this layer resembled those from the upper brown layer. As in the B layer above, the Cyanobacteria dominated in terms of biovolume. In the P/O layer, prokaryotes resembling purple anoxygenic phototrophic Halochromatium spp. with internal sulfur granules constituted 6% of the prokaryotes. Green, usually autofluorescing filaments ranging in diameter from <1 µm to about 6 µm accounted for another 4% of the community. Small, unicellular morphotypes made up more than 99% of the community in the permanently sulfidic S layer.

Cloning and sequencing of bacterial 16S rRNA genes.
A total of 576 clones were sequenced, yielding 407 high-quality sequences, of which 147, 133, and 127 were from the W, G, and P/O layers, respectively. Sequences that were >99% similar were considered to have the same phylotype. The bacterial phylotypes detected are summarized in Tables 2 to 4, and phylogenetic trees constructed by Jukes-Cantor and neighbor-joining are shown in Fig. 2. Both in terms of absolute numbers and diversity, the Bacteroidetes and the {alpha}-proteobacteria were the two most prominent groups of organisms represented in the clone libraries. Together, these two groups accounted for more than three-quarters of the clones and phylotypes detected in any layer. As is evident in Fig. 2A and B, including the Bacteroidetes-related and {alpha}-proteobacteria-related phylotypes, there was considerable diversity within each of the groups, although a few phylotypes were particularly abundant in theclone libraries. Phylotype E2aA01 affiliated with the "Flavobacteriales" constituted 73% of the Bacteroidetes-related clones and 37% of the total clone library from the white layer but was rarely detected among clones from the layers below. E4aG09, a close relative of the halophilic, aerobic genus Salinibacter, typically found in the hypersaline water of the salterns (2, 51), was abundant in the clone library form the G layer but rare in the clone library from the permanently anoxic P/O layer. The {alpha}-proteobacteria-related phylotype E6aD01 dominated the P/O layer with 34% of the total number of clones and 61% of the {alpha}-proteobacteria-related clones. This phylotype was affiliated with the genus Roseospira of phototrophic purple nonsulfur bacteria. Another {alpha}-proteobacterial phylotype, E6aD10, was abundant in the W and G layers of the crust. Together with some less frequent phylotypes, it formed a phylogenetically coherent cluster, branching from the root of the "Rhodobacterales."


View this table:
[in this window]
[in a new window]
  		TABLE 2. Summary of Bacteroidetes-affiliated phylotypes


View this table:
[in this window]
[in a new window]
  		TABLE 4. Summary of bacterial phylotypes not belonging to the Bacteroidetes or {alpha}-proteobacteria





View larger version (110K):
[in this window]
[in a new window]
  		FIG. 2. Phylogenetic trees showing phylotypes affiliated with Bacteroidetes (A), {alpha}-proteobacteria (B), and other groups (C). The trees were constructed by using Jukes-Cantor distance calculations and neighbor joining. Bootstrap values were determined with 1,000 replicates. Nodes with bootstrap values smaller than 60% are marked with squares (40 to 60%) or circles (<40%).

A number of {gamma}- and {delta}-proteobacteria were also detected in the crust. The phylotypes of {delta}-proteobacteria were members of predominantly sulfate-reducing groups such as the "Desulfovibrionales" and the "Desulfobacterales." They constituted 1, 7, and 4% of clone libraries from the W, G, and P/O layers, respectively. The most abundant phylotype affiliated with the {gamma}-proteobacteria, E2aA03, was detected only in the white layer. It was a member of the genus Thioalkalivibrio, which consist of chemoautotrophic sulfur-oxidizing organisms (63). Another phylotype, E2bG06, was also a member of the Ectothiorhodospiraceae but could not be assigned to a specific genus.

Three phylotypes were affiliated with the Cyanobacteria. These included E4aB08 and E4bG02, both affiliated with the Halothece cluster, and E6aG07, with a more uncertain affiliation (Fig. 2C). Other components of the community detected included organisms related to the Spirochetes, Chloroflexi, Planctomycetes, candidate division TM6 (5), and the order Halanaerobiales of the phylum Firmicutes (49).

Cloning and sequencing of archaeal 16S rRNA genes.
Archaeal genes for 16S rRNA were amplified from the P/O layer. A total of 96 clones were sequenced, resulting in 53 archaeal sequences that were distributed among 16 phylotypes, all affiliated with the Euryarchaeota (Table 5 and Fig. 3). The phylotypes ArcG01, ArcF12, ArcH05, ArcA11, ArcH07, and ArcG09 were members of the order Halobacteriales and accounted for 19% of the archaeal clones sequenced. One phylotype (ArcB06), encountered three times among the 53 sequences, was closely related to the genus Methanohalophilus within the Methanosarcinales (61).


View this table:
[in this window]
[in a new window]
  		TABLE 5. Summary of archaeal phylotypes



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 3. Phylogenetic tree showing the affiliation of the archaeal phylotypes detected in the gypsum crust. The tree was constructed by using Jukes-Cantor distance calculations and neighbor joining. Bootstrap values were determined with 1,000 replicates. Nodes with bootstrap values smaller than 60% are marked with squares (40 to 60%) or circles (<40%). MBGD, marine benthic group D; MGIII, marine group III.

The majority of the phylotypes were affiliated with uncultured groups of Archaea. Thus, the most frequently encountered phylotypes were members of the marine benthic group D (MBGD) euryarchaeotes (73). Together, these phylotypes accounted for 64% of the archaeal clones. Other groups of uncultured Archaea detected in the present study included the marine group III (18), the MSBL-1 group (72), and phylotypes forming two clusters (halophilic clusters 1 and 2) that also included sequences from pond water in a Mediterranean solar saltern (4) and hypersaline sediments of the Kebrit Deep (15).

Molecular fingerprinting.
Examples of the resulting DGGE gels are shown in Fig. 4. Gels run with DNA amplified with the Bacteria-specific primer set demonstrated a changing bacterial population with depth in the crust, whereas the archaeal community seemed more homogeneous with depth. Figure 5 illustrates the succession of bacterial bands through the W, G, P/O, and S layers. DGGE bands were excised, sequenced, and aligned with the phylotypes obtained from clone libraries. Three bacterial Bacteroidetes phylotypes and three archaeal phylotypes of the Halobacteriales or the halophilic archaeal cluster 2 were found again on the DGGE gels this way (Fig. 4). The DGGE band pattern suggested that phylotype E2aH11, retrieved once from the W layer, was present in the other layers as well. The band affiliated with phylotype E2aA05, which was common in all three clone libraries, was strong in the W, G, and P/O layer but barely visible in the deep, permanently sulfidic S layer. Finally, the apparent preference of phylotype E6aC02 for the deeper layers of the crust was confirmed by the DGGE pattern. The three archaeal phylotypes detected during DGGE analysis were all present throughout the crust.



View larger version (59K):
[in this window]
[in a new window]
  		FIG. 4. Representative DGGE gels with PCR products obtained with primers specific for Bacteria (a) and Archaea (b). The gels contained 10% acrylamide-bisacrylamide and a 40 to 70% denaturing gradient. Bands that were identified as a phylotype from one of the clone libraries are indicated in the figure.



View larger version (66K):
[in this window]
[in a new window]
  		FIG. 5. Number and distribution of bands on DGGE gels loaded with bacterial PCR products from the white (W), green (G), purple/olive-green (P/O), and deep sulfidic (S) layers.


arrow
DISCUSSION
 
Cyanobacteria.
Visually, Cyanobacteria dominate the brown and green layers due to their large cell size and conspicuous pigmentation, but in terms of cell numbers they amount to only a minor part of the population. We observed three main types of Cyanobacteria in the green layer during microscopy: unicellular bacteria resembling members of the genus Halothece and filamentous organisms of Halospirulina- or Phormidium-like morphologies (44, 75). Green filamentous forms were observed both in the G and in the P/O layers. The identity of the unicellular Cyanobacteria was confirmed by the detection of phylotypes affiliated with the Halothece cluster. The Cyanobacteria were underrepresented among the phylotypes found in the clone libraries (3%) compared to the in situ abundance of cells (28%) in the green layer. The clone libraries are built from rRNA genes within the extracted pool of genomic DNA. Apart from relative cell numbers, the abundance of 16S rRNA phylotypes in the DNA extract depends on the number of rRNA operons in each prokaryotic cell, which may vary from 1 to at least 15 (34). Further selection for or against individual or groups of organisms may occur during DNA extraction and subsequent PCR amplification.

The three types of Cyanobacteria observed here have previously been found to dominate the biomass in environments of similar salinity. Thus, a salinity-dependent succession was observed in the salterns of Guerrero Negro, Mexico, where Microcoleus dominated at salinities of <12% and Phormidium-like organisms and members of the Halospirulina and the Halothece cluster dominated at higher salinities (43).

Bacteroidetes.
Of the three main orders in this phylum, "Sphingobacteriales" and "Flavobacteriales" consist mainly of aerobic organisms while known strains of order "Bacteroidales" are all anaerobic (32, 59). This is consistent with the distribution of clones in the crust, where "Bacteroidales" phylotypes were mainly observed in the P/O layer while members of the "Flavobacteriales" and "Sphingobacteriales" with just a few exceptions were most abundant in the W and/or G layer. The results of both cloning and DGGE analysis indicate that significant physiological diversity exists among the Bacteroidetes in the crust.

{alpha}-Proteobacteria.
Numerous phylotypes were affiliated with the Rhodospirillales, the "Rhodobacterales" or the "Sphingomonadales." Cultured members of the Rhodospirillales are predominantly phototrophic, although some reference species also exhibit chemoorganotrophic growth under oxic or microoxic conditions (24, 27, 37). Most notable among the detected phylotypes affiliated with this group was E6aD01. It dominated in the P/O layer, where it made up almost one-third of the clones, but was virtually absent in the layers above. This, and the fact that it was closely related to known halophilic species of the phototrophic genus Roseospira, indicates that it represents an important anoxygenic phototroph contributing to the pink coloration in the crust. Its closest relatives include curved to spiral-shaped organisms with cell diameters of <1µm and variable cell lengths, exhibiting infrared autofluorescence (24). During epifluorescence microscopy, the organism corresponding to phylotype E6aD01 was probably counted as one of the small, unicellular organisms that were abundant in all layers.

Phylotype E6aD10, which was abundant in the W and G layers, formed a cluster with four less-common phylotypes. These phylotypes were only distantly related to known groups of {alpha}-proteobacteria and may represent a new lineage of high-salt-adapted organism.

A number of phylotypes were affiliated with the Roseobacter clade, a phylogenetically coherent group of marine {alpha}-proteobacteria within the "Rhodobacterales" (22, 39). Members of the Roseobacter clade are abundant in marine environments, where the group is involved in the degradation of organic sulfur compounds (23). Phototrophic members of the group have been cultured from hypersaline environments (31, 36, 69), and environmental clones have been retrieved from the water phase of marine solar salterns (4). However, the role of the group in the crust environment is uncertain. Since members of the Roseobacter clade are likely present in the water delivered to the ponds, their occurrence in the upper layers of the crust would be consistent with entrainment into the mat from near-shore seawater.

{gamma}- and {delta}-proteobacteria.
One of the {gamma}-proteobacterial phylotypes was closely related to the nonphototrophic genus Thioalkalivibrio within the Ectothiorhodospiraceae. This organism was most abundant in the W and G layers, undergoing daily fluctuations in oxygen and sulfide content. The genus Thioalkalivibrio consists of sulfur-oxidizing organisms that use nitrate or oxygen as electron acceptors, and it seems likely that the phylotype detected in the crust shares this metabolism. Phototrophic {gamma}-proteobacteria with internal sulfur globules were seen during microscopy, and organisms resembling members of the Chromatiaceae and Ectothiorhodospiraceae were also observed in the crust prior to the present study (53). Furthermore, phototrophic halophilic members of the "Chromatiales" have been isolated from solar salterns (10, 11). Thus, it is surprising that sequences affiliated with phototrophic {gamma}-proteobacteria were not observed in clone libraries constructed from genomic DNA extracts. As was discussed above for the Cyanobacteria, a number of factors including relatively low cell numbers of large organisms and a variable number of rRNA operons among organisms, as well as extraction and PCR bias, may lead to under-representation of phylotypes relative to their in situ abundance.

Phylotypes of {delta}-proteobacteria were associated with the predominantly sulfate-reducing "Desulfobacteraceae" and "Desulfovibrionaceae," members of which have previously been observed in hypersaline environments (14, 38). The salinity tolerance of isolated strains of sulfate-reducing {delta}-proteobacteria, as well as observations of in situ populations, indicate that the group is best adapted to much lower salinities and hence is growing at a considerable salinity stress in the gypsum crust (6, 7, 9, 35, 65). The depth distribution of the sulfate-reducing organisms, as reflected in the clone library, shows a maximum frequency of clones in the green layer and below. This is in accordance with previous measurements showing low sulfate reduction rates above the green layer (8).

Chloroflexi.
Phylotype E6aA10, which was highly similar (98% identity) to the filamentous green nonsulfur bacterium "Candidatus Chlorothrix halophilus," was abundant in the clone library from the P/O layer. "Candidatus Chlorothrix halophilus" is an obligately anaerobic sulfide-dependent phototrophic green nonsulfur bacterium that was cultured from a hypersaline microbial mat (33). Given the phylogenetic similarity and its affinity for the sulfidic part of the crust, phylotype E6aA10 seems likely to share this physiology.

Filamentous green nonsulfur bacteria are among the most abundant organisms in both oxic and anoxic layers of microbial mats from a variety of environments (30, 45, 46, 55, 74). They include both photo- and chemotrophs, but the overall physiological capability and ecological role of the group is poorly understood. The fact that only a single phylotype was detected in the crust and only in the deeper permanently anoxic part of the photic zone may indicate that the ecological significance of the group is reduced compared to other studied microbial mats, possibly as a consequence of the higher salinity. Alternatively, DNA extraction and PCR bias may have selected against the group during construction of clone libraries as was discussed above.

Most of the green filaments making up 4% of the organisms in the P/O layer were autofluorescing in the visible red under UV light, indicating that the samples contained more Cyanobacteria than Chloroflexi relatives. The Cyanobacteria probably originate from the purple portion of the layer which is in close contact with the overlying G layer and may contain organisms that are buried as the crust expands through precipitation and growth of crystals. The Chloroflexi phylotype, on the other hand, is probably a contribution from the olive-green layer below. To confirm this, it will be necessary to separate the purple from the olive-green portion of the crust and study them separately.

Firmicutes, Spirochetes, and Planctomycetes.
Firmicutes of the Halanaerobiales are abundant in hypersaline environments, including the Great Salt Lake, the Dead Sea, oil wells, saltern ponds in France and California, and a variety of other locations (40, 47, 57, 58, 76). Known members are obligately anaerobic, moderately halophilic organisms that gain energy by fermentation of various organic compounds. In the present study they were retrieved from the G- and P/O layer, suggesting an affinity for the deeper parts of the crust, which is consistent with a fermentative mode of life. Although not observed during microscopy, Spirochetes related to Spirochaeta halophila, a facultative anaerobe, were detected in all 3 libraries. These organisms as well as two relatives of the Planctomycetes probably contribute to the mineralization of organic material created by phototrophic primary producers in the crust.

Methanogens.
Previous measurements have documented the presence of methanogens in the crust, although methanogenesis amounts to less than 0.1% of the total anaerobic mineralization (65). Cultured members of the Methanohalophilus genus are methylotrophic, mesophilic halophiles, and the type species M. mahii grows optimally at salinities up to ca. 15% NaCl (19, 54). Earlier enrichment experiments have suggested the presence of methylotrophic methanogens in the crust. Thus, methane accumulated in enrichment cultures in which pieces of crust was added to anoxic media containing methanol (64).

Halobacteriales.
DNA from the Halobacteriales has been extracted from the Dead Sea, solar salterns, Antarctic hypersaline lakes, alkaline African hypersaline lakes, and Solar Lake, Sinai (3, 13, 41, 50). Isolated strains of this group are aerobic halophiles growing at salinities up to NaCl precipitation, although some are capable of anaerobic growth either in the light using bacteriorhodopsin or in the dark by fermentation (25, 52). Although clone libraries of archaeal 16S rRNA genes were constructed from samples of the P/O layer, the DGGE-analysis indicated that at least two of the Halobacteriales-related phylotypes were also present in the layers above. This may indicate that the phylotypes detected in the P/O layer are remains of aerobic organisms either from the surface layers of the crust or from the pond water that has been entrained and buried.

Uncultured archaeal groups.
The MBGD, which was the most numerous group of Archaea in the clone libraries, has previously been encountered in both marine (70, 71, 73) and terrestrial environments (16), and also the candidate order MSBL1 and the Halophilic Clusters 1 and 2 seem to have some affinity for marine and/or hypersaline environments. However, since no representative organisms of these groups have been cultured, their ecological significance is unknown.

Endoevaporitic benthic communities at high salinity.
The groups found to dominate the clone libraries from the gypsum crust in Eilat have previously been associated with other hypersaline environments. Thus, the cultivable aerobic heterotrophs of a hypersaline microbial mat with a salinity of 9% maintained at the Interuniversity Institute for Marine Sciences of Eilat included organisms related to the Bacteroidetes, {alpha}-proteobacteria of the Roseobacter clade or the "Rhizobiales," and {gamma}-proteobacteria (29). These organisms were enriched on yeast extract or glycolate. In a molecular study of anoxic sediments below a gypsum encrusted community in Salin-de-Giraud, France, the most abundant groups were the Bacteroidetes, Firmicutes, and {alpha}-, {gamma}-, and {delta}-proteobacteria (41). Finally, in a 16S rRNA survey of endoevaporitic microbial communities in the salterns of Guerrero Negro, Spear et al. (66) found a predominance of bacterial phylotypes affiliated with Cyanobacteria, Bacteroidetes, {alpha}-, {gamma}-, and {delta}-proteobacteria, Planctomycetes, and Firmicutes. Green sulfur bacteria and {varepsilon}-proteobacteria were also detected but in low numbers. The archaeal phylotypes included Halobacteria and a few methanogens. Together, these studies indicate that a few prokaryotic phyla—including Cyanobacteria, Bacteroidetes, Proteobacteria of the {alpha}-, {gamma}-, and {delta}-classes, and Firmicutes—are particularly well adapted to the high-salt and variable redox conditions within the evaporites.

The DGGE analysis revealed a highly structured bacterial community, where organisms were occupying specific horizontal layers. This stratification was also evident from the distribution of the most abundant phylotypes of Bacteroidetes, Chloroflexi, and Proteobacteria in clone libraries from the different layers. Among the Bacteroidetes, phylotypes E2aA01 showed an affinity for the W layer, whereas phylotype E4aG09 was abundant in the G layer. Similarly, among the Rhodospirillales, E6aD01 had a strong affinity for the P/O layer, whereas E4aE08 was most abundant in the W and G layers. This indicates that substantial physiological and/or metabolic diversity exists within the Bacteroidetes and the {alpha}-proteobacteria in the crust.

The high number of PCR cycles that was necessary in order to amplify DNA with Archaea-specific primers, the low diversity of Archaea compared to Bacteria, and the lack of a vertical succession in the archaeal community indicate that the role of Archaea is limited in the endoevaporitic environment.

Conclusion.
This study provides a window into the diversity and structure of endoevaporitic communities found in gypsum-precipitating saltern ponds. In spite of the high salinity, a rich prokaryotic community is thriving in the gypsum, and although Cyanobacteria dominate the system in terms of biomass, they are far outnumbered by other groups of prokaryotes. The community is highly stratified with organisms inhabiting specific layers according to their metabolic needs and capabilities. Particularly members of the Bacteroidetes and {alpha}-proteobacteria were numerous. The Chloroflexi appeared to be less abundant compared to phototrophic benthic communities growing at lower salinities, and Archaea seem to play only a minor role in the crust.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Summary of phylotypes affiliated with the {alpha}-proteobacteria


arrow
ACKNOWLEDGMENTS
 
We thank Israel Salt Industries, Ltd., for allowing access to the saltern ponds and the Interuniversity Institute for Marine Sciences in Eilat and the Moshe Shilo Minerva Center for Marine Biogeochemistry for logistic support.

This study was supported by the Danish Basic Research Foundation (Grundforskningsfonden), the Danish Research Agency (Statens Naturvidenskabelige Forskningsråd), the Israel Science Foundation (founded by the Israel Academy of Sciences and Humanities), and by the NASA Astrobiology Institute "Subsurface Biospheres" and "Environmental Genomics."


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Geology and Geophysics Post 701, 1680 East-West Rd., University of Hawaii, Honolulu, HI 96822. Phone: (808) 956-0720. Fax: (808) 956-5512. E-mail: ketil{at}hawaii.edu. Back


arrow
REFERENCES
 
    1
  1. Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-blast: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
    2. 2
  2. Antón, J., R. Rosselló-Mora, F. Rodríguez-Valera, and R. Amann. 2000. Extremely halophilic Bacteria in crystallizer ponds from solar salterns. Appl. Environ. Microbiol. 66:3052-3057.[Abstract/Free Full Text]
    3. 3
  3. Benlloch, S., S. G. Acinas, J. Antón, A. López-López, S. P. Luz, and F. Rodríguez-Valera. 2001. Archaeal biodiversity in crystallizer ponds from a solar saltern: culture versus PCR. Microb. Ecol. 41:12-19.[Medline]
    4. 4
  4. Benlloch, S., A. López-López, E. O. Casamayor, L. Øvreås, V. Goddard, F. L. Daae, G. Smerdon, R. Massana, I. Joint, F. Thingstad, C. Pedrós-Alió, and F. Rodríguez-Valera. 2002. Prokaryotic genetic diversity throughout the salinity gradient of a coastal solar saltern. Environ. Microbiol. 4:349-360.[CrossRef][Medline]
    5. 5
  5. Bowman, J. P., S. M. Rea, S. A. McCammon, and T. A. McMeekin. 2000. Diversity and community structure within anoxic sediment from marine salinity meromictic lakes and a coastal meromictic marine basin, Vestfold Hills, Eastern Antarctica. Environ. Microbiol. 2:227-237.[CrossRef][Medline]
    6. 6
  6. Brandt, K. K., B. K. C. Patel, and K. Ingvorsen. 1999. Desulfocella halophila gen. nov., sp. nov., a halophilic, fatty-acid-oxidizing, sulfate-reducing bacterium isolated from sediments of the Great Salt Lake. Int. J. Syst. Bacteriol. 49:193-200.[Abstract/Free Full Text]
    7. 7
  7. Brandt, K. K., F. Vester, A. N. Jensen, and K. Ingvorsen. 2001. Sulfate reduction dynamics and enumeration of sulfate-reducing bacteria in hypersaline sediments of the Great Salt Lake. Microb. Ecol. 41:1-11.[Medline]
    8. 8
  8. Canfield, D. E., K. B. Sørensen, and A. Oren. 2004. Biogeochemistry of a gypsum-encrusted microbial ecosystem. Geobiology 2:133-150.[CrossRef]
    9. 9
  9. Caumette, P. 1993. Ecology and physiology of phototrophic bacteria and sulphate-reducing bacteria in marine salterns. Experientia 49:473-481.[CrossRef]
    10. 10
  10. Caumette, P., R. Baulaigue, and R. Matheron. 1988. Characterization of Chromatium salexigens sp. nov., a halophilic Chromatiaceae isolated from Mediterranean salinas. Syst. Appl. Microbiol. 10:284-292.
    11. 11
  11. Caumette, P., R. Baulaigue, and R. Matheron. 1991. Thiocapsa halophila sp. nov., a new halophilic phototrophic purple sulfur bacterium. Arch. Microbiol. 155:170-176.[CrossRef]
    12. 12
  12. Caumette, P., R. Matheron, N. Raymond, and J. C. Relexans. 1994. Microbial mats in the hypersaline ponds of Mediterranean salterns (Salins-de-Giraud, France). FEMS Microbiol. Ecol. 13:273-286.[CrossRef]
    13. 13
  13. Cytryn, E., D. Minz, R. S. Oremland, and Y. Cohen. 2000. Distribution and diversity of Archaea corresponding to the limnological cycle of a hypersaline stratified lake (Solar Lake, Sinai, Egypt). Appl. Environ. Microbiol. 66:3269-3276.[Abstract/Free Full Text]
    14. 14
  14. de Souza, M. P., A. Amini, M. A. Dojka, I. J. Pickering, S. C. Dawson, N. R. Pace, and N. Terry. 2001. Identification and characterization of bacteria in a selenium-contaminated hypersaline evaporation pond. Appl. Environ. Microbiol. 67:3785-3794.[Abstract/Free Full Text]
    15. 15
  15. Eder, W., W. Ludwig, and R. Huber. 1999. Novel 16S rRNA gene sequences retrieved from highly saline brine sediments of Kebrit Deep, Red Sea. Arch. Microbiol. 172:213-218.[CrossRef][Medline]
    16. 16
  16. Elshahed, M. S., F. Z. Najar, B. A. Roe, A. Oren, T. A. Dewers, and L. R. Krumholz. 2004. Survey of archaeal diversity reveals an abundance of halophilic Archaea in a low-salt, sulfide- and sulfur-rich spring. Appl. Environ. Microbiol. 70:2230-2239.[Abstract/Free Full Text]
    17. 17
  17. Felsenstein, J. 1989. PHYLIP: phylogeny inference package (version 3.2). Cladistics 5:164-166.
    18. 18
  18. Fuhrman, J. A., and A. A. Davis. 1997. Widespread archaea and novel bacteria from the deep sea as shown by 16S rRNA gene sequences. Mar. Ecol. Prog. Ser. 150:275-285.
    19. 19
  19. Garcia J.-L., B. K. C. Patel, and B. Ollivier. 2000. Taxonomic, phylogenetic, and ecological diversity of methanogenic Archaea. Anaerobe 6:205-226.
    20. 20
  20. Garcia-Pichel, F., U. Nübel, and G. Muyzer. 1998. The phylogeny of unicellular, extremely halotolerant cyanobacteria. Arch. Microbiol. 169:469-482.[CrossRef][Medline]
    21. 21
  21. Gilbert, D. G. 1995. SeqPup 0.5b: a biosequence editor and analysis application. Indiana University, Bloomington.
    22. 22
  22. González, J. M., and M. A. Moran. 1997. Numerical dominance of a group of marine bacteria in the {alpha}-subclass of the class Proteobacteria in coastal seawater. Appl. Environ. Microbiol. 63:4237-4242.[Abstract]
    23. 23
  23. González, J. M., R. P. Kiene, and M. A. Moran. 1999. Transformation of sulfur compounds by an abundant lineage of marine Bacteria in the {alpha}-subclass of the class Proteobacteria. Appl. Environ. Microbiol. 65:3810-3819.[Abstract/Free Full Text]
    24. 24
  24. Guyoneaud, R., S. Mouné, C. Eatock, V. Bothorel, A. S. Hirschler-Rea, J. Willison, R. Duran, W. Liesack, R. Herbert, R. Matheron, and P. Caumette. 2002. Characterization of three spiral-shaped purple nonsulfur bacteria isolated from coastal lagoon sediments, saline sulfur springs, and microbial mats: emended description of the genus Roseospira and description of Roseospira marina sp. nov., Roseospira navarrensis sp. nov., and Roseospira thiosulfatophila sp. nov. Arch. Microbiol. 178:315-324.[CrossRef][Medline]
    25. 25
  25. Hartmann, R., H. D. Sickinger, and D. Oesterhelt. 1980. Anaerobic growth of halobacteria. Proc. Natl. Acad. Sci. USA 77:3821-3825.[Abstract/Free Full Text]
    26. 26
  26. Huber, T., G. Faulkner, and Hugenholtz, P. 2004. Bellerophon; a program to detect chimeric sequences in multiple sequence alignments. Bioinformatics 20:2317-2319.[Abstract/Free Full Text]
    27. 27
  27. Imhoff, J. F. 2001. True marine and halophilic anoxygenic phototrophic bacteria. Arch. Microbiol. 176:243-254.[CrossRef][Medline]
    28. 28
  28. Imhoff, J. F., J. Süling, and R. Petri. 1998. Phylogenetic relationships among the Chromatiaceae, their taxonomic reclassification and description of the new genera Allochromatium, Halochromatium, Isochromatium, Marichromatium, Thiococcus, Thiohalocapsa, and Thermochromatium. Int. J. Syst. Bacteriol. 48:1129-1143.[Abstract/Free Full Text]
    29. 29
  29. Jonkers, H. M., and R. M. M. Abed. 2003. Identification of aerobic heterotrophic bacteria from the photic zone of a hypersaline microbial mat. Aquat. Microb. Ecol. 30:127-133.
    30. 30
  30. Jonkers, H. M., R. Ludwig, R. de Wit, O. Pringault, G. Muyzer, H. Niemann, N. Finke, and D. de Beer. 2003. Structural and functional analysis of a microbial mat ecosystem from a unique permanent hypersaline inland lake: ‘La Salada de Chiprana’ (NE Spain). FEMS Microbiol. Ecol. 44:175-189.[CrossRef]
    31. 31
  31. Kersters, K., P. de Vos, M. Gillis, J. Swings, P. Vandamme, and E. Stackebrandt. 2003. Introduction to the Proteobacteria. In M. Dworkin et al. (ed.), The prokaryotes: an evolving electronic resource for the microbiological community, 3rd ed., release 3.12. [Online.] Springer-Verlag, New York, N.Y. http://link.springer-ny.com/link/service/books/10125/.
    32. 32
  32. Kirchman, D. L. 2002. The ecology of Cytophaga-Flavobacteria in aquatic environments. FEMS Microbiol. Ecol. 39:91-100.[CrossRef]
    33. 33
  33. Klappenbach, J. A., and B. K. Pierson. 2004. Phylogenetic and physiological characterization of a filamentous anoxygenic photoautotrophic bacterium "Candidatus Chlorothrix halophila" gen. nov., sp. nov., recovered from hypersaline microbial mats. Arch. Microbiol. 181:17-25.[CrossRef][Medline]
    34. 34
  34. Klappenbach, J. A., J. M. Dunbar, and T. M. Schmidt. 2000. rRNA operon copy number reflects ecological strategies of bacteria. Appl. Environ. Microbiol. 66:1328-1333.0.[Abstract/Free Full Text]
    35. 35
  35. Krekeler, D., P. Sigalevich, A. Teske, H. Cypionka, and Y. Cohen. 1997. A sulfate reducing bacterium from the oxic layer of a microbial mat from Solar Lake (Sinai), Desulfovibrio oxyclinae sp. nov. Arch. Microbiol. 167:369-375.[CrossRef]
    36. 36
  36. Labrenz, M., M. D. Collins, P. A. Lawson, B. J. Tindall, P. Schumann, and P. Hirsch. 1999. Roseovarius tolerans gen. nov., sp. nov., a budding bacterium with variable bacteriochlorophyll a production from hypersaline Lake Ekho. Int. J. Syst. Bacteriol. 49:137-147.[Abstract/Free Full Text]
    37. 37
  37. Madigan, M. T. 2003. Anoxygenic phototrophic bacteria from extreme environments. Photosynth. Res. 76:157-171.[CrossRef][Medline]
    38. 38
  38. Minz, D. J., L. Flax, S. J. Green, G. Muyzer, Y. Cohen, M. Wagner, B. E. Rittmann, and D. A. Stahl. 1999. Diversity of sulfate-reducing bacteria in oxic and anoxic regions of a microbial mat characterized by comparative analysis of dissimilatory sulfite reductase genes. Appl. Environ. Microbiol. 65:4666-4671.[Abstract/Free Full Text]
    39. 39
  39. Moran, M. A., J. M. González, and R. P. Kiene. 2003. Linking a bacterial taxon to sulfur cycling in the sea: studies of the marine Roseobacter group. Geomicrobiol. J. 20:375-388.[CrossRef]
    40. 40
  40. Mouné, S., N. Manac'h, A. Hirschler, P. Caumette, J. C. Willison, and R. Matheron. 1999. Haloanaerobacter salinarius sp. nov., a novel halophilic fermentative bacterium that reduces glycine-betaine to trimethylamine with hydrogen or serine as electron donors; emendation of the genus Haloanaerobacter. Int. J. Syst. Bacteriol. 49:103-112.[Abstract/Free Full Text]
    41. 41
  41. Mouné, S., P. Caumette, R. Matheron, and J. Willison. 2003. Molecular sequence analysis of prokaryotic diversity in the anoxic sediments underlying cyanobacterial mats of two hypersaline ponds in Mediterranean salterns. FEMS Microbiol. Ecol. 44:117-130.
    42. 42
  42. Muyzer, G., E. C. de Waal, and A. G. Uitterlinden. 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:695-700.[Abstract/Free Full Text]
    43. 43
  43. Nübel, U., F. Garcia-Pichel, E. Clavero, and G. Muyzer. 2000. Matching molecular diversity and ecophysiology of benthic cyanobacteria and diatoms in communities along a salinity gradient. Environ. Microbiol. 2:217-226.[CrossRef][Medline]
    44. 44
  44. Nübel, U., F. Garcia-Pichel, and G. Muyzer. 2000. The halotolerance and phylogeny of cyanobacteria with tightly coiled trichomes (Spirulina Turpin) and the description of Halospirulina tapeticola gen. nov. sp. nov. Int. J. Syst. Evol. Microbiol. 50:1265-1277.[Abstract]
    45. 45
  45. Nübel, U., M. M. Bateson, M. T. Madigan, M. Kühl, and D. M. Ward. 2001. Diversity and distribution in hypersaline microbial mats of bacteria related to Chloroflexus spp. Appl. Environ. Microbiol. 67:4365-4371.[Abstract/Free Full Text]
    46. 46
  46. Nübel, U., M. M. Bateson, V. Vandieken, A. Wieland, M. Kühl, and D. M. Ward. 2002. Microscopic examination of distribution and phenotypic properties of phylogenetically diverse Chloroflexaceae-related bacteria in hot spring microbial mats. Appl. Environ. Microbiol. 68:4593-4603.[Abstract/Free Full Text]
    47. 47
  47. Ollivier, B., P. Caumette, J. L. Garcia, and R. A. Mah. 1994. Anaerobic bacteria from hypersaline environments Microbiol. Rev. 58:27-38.
    48. 48
  48. Oren, A. 1999. Bioenergetic aspects of halophilism. Microbiol. Mol. Biol. Rev. 63:334-348.[Abstract/Free Full Text]
    49. 49
  49. Oren, A. 2000. Change of the names Haloanaerobiales, Haloanaerobiaceae and Haloanaerobium to Halanaerobiales, Halanaerobiaceae and Halanaerobium, respectively, and further nomenclatural changes within the order Halanaerobiales. Int. J. Syst. Evol. Microbiol. 50:2229-2230.[Abstract]
    50. 50
  50. Oren, A. 2002. Diversity of halophilic microorganisms: environments, phylogeny, physiology, and applications. J. Indust. Microbiol. Biotechnol. 28:55-63.
    51. 51
  51. Oren, A., and F. Rodríguez-Valera. 2001. The contribution of halophilic bacteria to the red coloration of saltern crystallizer ponds. FEMS Microbiol. Ecol. 36:123-130.[Medline]
    52. 52
  52. Oren, A., and H. G. Trüper. 1990. Anaerobic growth of halophilic archaeobacteria by reduction of dimethylsulfoxide and trimethylamine N-oxide. FEMS Microbiol. Lett. 70:33-36.[CrossRef]
    53. 53
  53. Oren, A., M. Kühl, and U. Karsten. 1995. An endoevaporitic microbial mat within a gypsum crust: zonation of phototrophs, photopigments, and light penetration. Mar. Ecol. Prog. Ser. 128:151-159.
    54. 53
  54. Øvreås, L., L. Forney, F. L. Daae, and V. Torsvik. 1997. Distribution of bacterioplankton in meromictic Lake Saelenvannet, as determined by denaturing gradient gel electrophoresis of PCR-amplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol. 63:3367-3373.[Abstract]
    55. 54
  55. Paterek J. R., and P. H. Smith. 1988. Methanohalophilus mahii gen. nov. sp. nov., a methylotrophic halophilic methanogen. Int. J. Syst. Bacteriol. 38: 122-123.
    56. 55
  56. Pierson, B. K., D. Valdez, M. Larsen, E. Morgan, and E. E. Mack. 1994. Chloroflexus-like organisms from marine and hypersaline environments: distribution and diversity. Photosynth. Res. 41:35-52.
    57. 56
  57. Porter, K., and Y. Feig. 1980. The use of DAPI for identifying and counting aquatic microflora. Limnol.Oceanogr. 25:943-948.
    58. 57
  58. Rainey, F. A., T. N. Zhilina, E. S. Boulygina, E. Stackebrandt, T. P. Tourova, and G. A. Zavarzin. 1995. The taxonomic status of the fermentative halophilic anaerobic bacteria: description of Halobacteriales ord. nov., Halobacteroidaceae fam. nov., Orenia gen. nov., and further taxonomic rearrangements at the genus and species level. Anaerobe 1:185-199.
    59. 58
  59. Ravot, G., M. Magot, B. Ollivier, B. K. C. Patel, E. Ageron, P. A. D. Grimont, P. Thomas, and J. L. Garcia. 1997. Haloanaerobium congolense sp. nov., an anaerobic, moderately halophilic, thiosulfate- and sulfur-reducing bacterium from an African Oil Field. FEMS Microbiol. Lett. 147:81-88.[CrossRef][Medline]
    60. 59
  60. Reichenbach, H. 1991. The order Cytophagales, p. 3631-3675. In A. Balows, H. G. Trüper, M. Dworkin, W. Harder, and K.-H. Schleifer (ed.), The prokaryotes, 2nd ed., vol. 3. Springer-Verlag, New York, N.Y.
    61. 60
  61. Rothschild, L. J., L. J. Giver, M. R. White, and R. L. Mancinelli. 1994. Metabolic activity of microorganisms in evaporites. J. Phycol. 30:431-438.[CrossRef][Medline]
    62. 61
  62. Rouvière, P., L. Mandelco, S. Winker, and C. R. Woese. 1992. A detailed phylogeny for the Methanomicrobiales. Syst. Appl. Microbiol. 15:363-371.[Medline]
    63. 62
  63. Shen, Y., R. Buick, and D. E. Canfield. 2001. Isotopic evidence for microbial sulphate reduction in the early Archaean era. Nature 410:77-81.[CrossRef][Medline]
    64. 63
  64. Sorokin, D. Y., A. M. Lysenko, L. L. Mityushina, T. P. Tourova, B. E. Jones, F. A. Rainey, L. A. Robertson, and J. G. Kuenen. 2001. Thioalkalimicrobium aerophilum gen. nov., sp. nov. and Thioalkalimicrobium sibericum sp. nov., and Thioalkalivibrio versutus gen. nov., sp. nov., Thioalkalivibrio nitratis sp. nov., and Thioalkalivibrio denitrificans sp. nov., novel obligately alkaliphilic and obligately chemolithoautotrophic sulfur-oxidizing bacteria from soda lakes. Int. J. Syst. Evol. Microbiol. 51:565-580.[Abstract]
    65. 64
  65. Sørensen, K. B. 2002. Microbial ecology of gradient systems. Ph.D. dissertation. Institute of Biology, University of Southern Denmark, Odense, Denmark.
    66. 65
  66. Sørensen, K. B., D. E. Canfield, and A. Oren. 2004. Salinity response of benthic microbial communities in a solar saltern (Eilat, Israel). Appl. Environ. Microbiol. 70:1608-1616.[Abstract/Free Full Text]
    67. 66
  67. Spear, J. R., R. E. Ley, A. B. Berger, and N. R. Pace. 2003. Complexity in natural microbial ecosystems: the Guerrero Negro experience. Biol. Bull. 204:168-173.[Abstract/Free Full Text]
    68. 67
  68. Squyres, S. W., J. P. Grotzinger, R. E. Arvidson, J. F. Bell, W. Calvin, P. R. Christensen, B. C. Clark, J. A. Crisp, W. H. Farrand, K. E. Herkenhoff, J. R. Johnson, G. Klingelhofer, A. H. Knoll, S. M. McLennan, H. Y. McSween, R. V. Morris, J. W. Rice, R. Rieder, and L. A. Soderblom. 2004. In situ evidence for an ancient aqueous environment at Meridiani Planum, Mars. Science 306:1709-1714.[Abstract/Free Full Text]
    69. 68
  69. Squyres, S. W., R. E. Arvidson, J. F. Bell, J. Bruckner, N. A. Cabrol, W. Calvin, M. H. Carr, P. R. Christensen, B. C. Clark, L. Crumpter, D. J. DesMarais, C. d'Uston, T. Economou, J. Farmer, W. Farrand, W. Folkner, M. Golombek, S. Gorevan, J. A. Grant, R. Greeley, J. Grotzinger, L. Haskin, K. E. Herkenhoff, S. Hviid, J. Johnson, G. Klingelhofer, A. H. Knoll, G. Landis, M. Lemmon, R. Li, M. B. Madsen, M. C. Malin, S. M. McLennan, H. Y. McSween, D. W. Ming, J. Moersch, R. V. Morris, T. Parker, J. W. Rice, L. Richter, R. Rieder, M. Sims, M. Smith, P. Smith, L. A. Soderblom, R. Sutlivan, H. Wanke, T. Wdowiak, M. Wolff, and A. Yen. 2004. The Opportunity Rover's Athena science investigation at Meridiani Planum, Mars. Science 306:1698-1703.[Abstract/Free Full Text]
    70. 69
  70. Suzuki, T., Y. Muroga, M. Takahama, and Y. Nishimura. 1999. Roseivivax halodurans gen. nov., sp. nov., and Roseivivax halotolerans sp. nov., aerobic bacteriochlorophyll-containing bacteria isolated from a saline lake. Int. J. Syst. Bacteriol. 49:629-634.[Abstract/Free Full Text]
    71. 70
  71. Takai, K., and K. Horikoshi. 1999. Genetic diversity of Archaea in deep sea hydrothermal vent environments. Genetics 152:1285-1297.[Abstract/Free Full Text]
    72. 71
  72. Teske, A., K. U. Hinrichs, V. Edgcomb, G. A. de Vera, D. Kysela, S. P. Sylva, M. L. Sogin, and H. W. Jannasch. 2002. Microbial diversity of hydrothermal sediments in the Guaymas Basin: evidence for anaerobic methanotrophic communities. Appl. Environ. Microbiol. 68:1994-2007.[Abstract/Free Full Text]
    73. 72
  73. van der Wielen, P. W. J. J., H. Bolhuis, S. Borin, D. Daffonchio, C. Corselli, L. Giuliano, G. D'Auria, G. J. de Lange, A. Huebner, S. P. Varnavas, J. Thomson, C. Tamburini, D. Marty, T. J. McGenity, K. N. Timmis, and BioDeep Scientific Party. 2005. The enigma of prokaryotic life in deep hypersaline anoxic basins. Science 307:121-123.[Abstract/Free Full Text]
    74. 73
  74. Vetriani, C., H. W. Jannasch, B. J. MacGregor, D. A. Stahl, and A. L. Reysenbach. 1999. Population structure and phylogenetic characterization of marine benthic Archaea in deep-sea sediments. Appl. Environ. Microbiol. 65:4375-4384.[Abstract/Free Full Text]
    75. 74
  75. Ward, D. M., C. M. Santegoeds, S. C. Nold, and N. B. Ramsing. 1997. Biodiversity within hot spring microbial communities: molecular monitoring of enrichment cultures. Antonie Leeuwenhoek 71:143-150.
    76. 75
  76. Waterbury, J. B. 1991. The cyanobacteria: isolation, purification, and identification, p. 2058-2078. In A. Balows, H. G. Trüper, M. Dworkin, W. Harder, and K.-H. Schleifer (ed.), The prokaryotes, 2nd ed., vol. 2. Springer-Verlag, New York, N.Y.
    77. 76
  77. Zeikus, J. G., P. W. Hegge, T. E. Thompson, T. J. Phelps, and T. A. Langworthy. 1983. Isolation and description of Haloanaerobium praevalens gen. nov. and sp. nov., an obligately anaerobic halophilic common to Great Salt Lake sediments. Curr. Microbiol. 9:225-234.

Applied and Environmental Microbiology, November 2005, p. 7352-7365, Vol. 71, No. 11
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.11.7352-7365.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Robertson, C. E., Spear, J. R., Harris, J. K., Pace, N. R. (2009). Diversity and Stratification of Archaea in a Hypersaline Microbial Mat. Appl. Environ. Microbiol. 75: 1801-1810 [Abstract] [Full Text]  
  • Sahl, J. W., Pace, N. R., Spear, J. R. (2008). Comparative Molecular Analysis of Endoevaporitic Microbial Communities. Appl. Environ. Microbiol. 74: 6444-6446 [Abstract] [Full Text]  
  • Waldron, P. J., Petsch, S. T., Martini, A. M., Nusslein, K. (2007). Salinity Constraints on Subsurface Archaeal Diversity and Methanogenesis in Sedimentary Rock Rich in Organic Matter. Appl. Environ. Microbiol. 73: 4171-4179 [Abstract] [Full Text]  
  • Bachar, A., Omoregie, E., de Wit, R., Jonkers, H. M. (2007). Diversity and Function of Chloroflexus-Like Bacteria in a Hypersaline Microbial Mat: Phylogenetic Characterization and Impact on Aerobic Respiration. Appl. Environ. Microbiol. 73: 3975-3983 [Abstract] [Full Text]  
  • Bardavid, R. E., Mana, L., Oren, A. (2007). Haloplanus natans gen. nov., sp. nov., an extremely halophilic, gas-vacuolate archaeon isolated from Dead Sea-Red Sea water mixtures in experimental outdoor ponds. Int. J. Syst. Evol. Microbiol. 57: 780-783 [Abstract] [Full Text]  
  • Perreault, N. N., Andersen, D. T., Pollard, W. H., Greer, C. W., Whyte, L. G. (2007). Characterization of the Prokaryotic Diversity in Cold Saline Perennial Springs of the Canadian High Arctic. Appl. Environ. Microbiol. 73: 1532-1543 [Abstract] [Full Text]  
  • Cavalier-Smith, T. (2006). Cell evolution and Earth history: stasis and revolution. Phil Trans R Soc B 361: 969-1006 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sørensen, K. B.
Right arrow Articles by Oren, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sørensen, K. B.
Right arrow Articles by Oren, A.
Agricola
Right arrow Articles by Sørensen, K. B.
Right arrow Articles by Oren, A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»