Previous Article | Next Article 
Applied and Environmental Microbiology, December 2005, p. 8836-8845, Vol. 71, No. 12
0099-2240/05/$08.00+0 doi:10.1128/AEM.71.12.8836-8845.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Community Analysis of a Mercury Hot Spring Supports Occurrence of Domain-Specific Forms of Mercuric Reductase
Jessica Simbahan,1
Elizabeth Kurth,1
James Schelert,1
Amanda Dillman,1
Etsuko Moriyama,1,2
Stevan Jovanovich,3 and
Paul Blum1*
School of Biological Sciences, University of NebraskaLincoln,1
Plant Science Initiative, University of NebraskaLincoln, Lincoln, Nebraska,2
Silicon Valley Scientific, Fremont, California3
Received 21 July 2005/
Accepted 5 September 2005

ABSTRACT
Mercury is a redox-active heavy metal that reacts with active
thiols and depletes cellular antioxidants. Active resistance
to the mercuric ion is a widely distributed trait among bacteria
and results from the action of mercuric reductase (MerA). Protein
phylogenetic analysis of MerA in bacteria indicated the occurrence
of a second distinctive form of MerA among the archaea, which
lacked an N-terminal metal recruitment domain and a C-terminal
active tyrosine. To assess the distribution of the forms of
MerA in an interacting community comprising members of both
prokaryotic domains, studies were conducted at a naturally occurring
mercury-rich geothermal environment. Geochemical analyses of
Coso Hot Springs indicated that mercury ore (cinnabar) was present
at concentrations of parts per thousand. Under high-temperature
and acid conditions, cinnabar may be oxidized to the toxic form
Hg
2+, necessitating mercury resistance in resident prokaryotes.
Culture-independent analysis combined with culture-based methods
indicated the presence of thermophilic crenarchaeal and gram-positive
bacterial taxa. Fluorescence in situ hybridization analysis
provided quantitative data for community composition. DNA sequence
analysis of archaeal and bacterial
merA sequences derived from
cultured pool isolates and from community DNA supported the
hypothesis that both forms of MerA were present. Competition
experiments were performed to assess the role of archaeal
merA in biological fitness. An essential role for this protein was
evident during growth in a mercury-contaminated environment.
Despite environmental selection for mercury resistance and the
proximity of community members, MerA retains the two distinct
prokaryotic forms and avoids genetic homogenization.

INTRODUCTION
The separation of prokaryotes into bacterial and archaeal domains
(or superkingdoms) has gained considerable support from the
ongoing input of genome sequencing efforts and their identification
of proteins separately categorized in this organizational structure.
The exchange of genes between domains, however, means that this
finding is not absolute because it can result in genomes having
mixed compositions. Lateral gene transfer (LGT) has been reported
within the archaeal domain (
22) and between the bacterial and
archaeal domains (
4,
12,
13,
23). In addition, some authors
have noted that there is preferential gene transfer of housekeeping
genes, also called operational genes, rather than genes concerned
with information processing (
16).
LGT also plays a role in the evolution of mercury resistance encoded in the mer operon, which makes it suitable for analysis of evolutionary processes. Recent studies of microbes residing at marine hydrothermal vents support such efforts (38). The mer genes have been well studied in bacteria and usually are plasmid encoded and therefore mobile (5). This may explain why some bacteria possess mer genes even if they do not live in environments rich in mercury. However, mer genes appear to be absent in anaerobic organisms, which perhaps reflects a reduced need to detoxify this heavy metal in a reducing environment. The heart of the mer active resistance mechanism is the homodimer mercuric reductase (MerA), which reduces Hg2+ to Hg0 using a flavin adenine dinucleotide cofactor and electrons from NADPH (5). The catalytic site of MerA is comprised of a conserved pyridine nucleotide-disulfide oxidoreductase domain (PFAM 0007) with two active cysteines (C207 and C212) (33). Unlike other members of this large family, MerA has two additional, unique regions that are critical for metal reduction. These regions are a short C-terminal extension having two additional active cysteines (C628 and C629) and an extended N terminus that promotes metal recruitment. In addition, two conserved tyrosines (Y48 and Y605) facilitate catalysis (28).
Recent studies have revealed the occurrence of mercury resistance in members of the archaeal domain (32). Using functional genomics methods, direct evidence was obtained for the presence of archaeal homologs of MerA and its regulator, MerR, in the hyperthermophile Sulfolobus solfataricus. Curiously, the level of resistance afforded by these proteins was 20- to 40-fold below that of Mer+ bacteria. Toxicology studies addressing the mechanism of mercuric ion action toward archaea have provided an explanation for this observation. Mercury acts in vivo and in vitro as a transcriptional poison that inactivates archaeal generalized transcription factor B, thereby blocking transcription initiation (14).
The acidic hot spring environment supports a variety of biogeochemical and metabolic processes. High temperatures, low pHs, and the presence of elevated amounts of metal sulfides select for unique organisms that survive under these harsh conditions. Few studies using culture-independent approaches have examined the microbial ecology of acidic thermal springs, and none have been conducted at sites where there are also high heavy metal concentrations. Most studies on interdomain LGT have depended entirely on sequences from public databases, while mixed-domain communities residing in a single niche have rarely been examined. The discovery of a naturally occurring mercury-rich acidic hot spring provided a unique opportunity to study whether interdomain LGT of the mercury resistance gene, merA, occurred between archaea and bacteria residing in a natural environment.

MATERIALS AND METHODS
Environmental samples.
Coso Hot Springs pool 3-4 is located at latitude 36
o02'45.883"N
and longitude 117
o46'12.929"W at an altitude of 3,630 ft. One-liter
portions of pool water were recovered from this site and set
aside for about 3 min to allow the heavy sediment to settle.
Samples from each 1-liter water collection were used for cultivation
and subjected to fluorescence in situ hybridization (FISH) analysis
and community DNA extraction. Chemical analysis of the pool
water was conducted at the Water Sciences Laboratory (University
of Nebraska-Lincoln, Lincoln, NE), the Soil and Plant Analytical
Laboratory (University of Nebraska-Lincoln, Lincoln, NE), the
Nebraska Health and Human Services Regulation and Licensure-Laboratory
Services (Lincoln, NE), the Hygienic Laboratory (University
of Iowa, Iowa City, IA), and Galbraith Laboratories (Knoxville,
TN).
Strain isolation and cultivation.
Pure bacterial and archaeal isolates were collected and prepared as described previously (35) with 0.3 µM mercuric chloride in the medium. The liquid medium consisted of the basal salts of Allen (1), as modified by Brock et al. (7), supplemented with 0.2% (wt/vol) tryptone. Growth was monitored at a wavelength of 540 nm using a Cary 50 Bio UV-visible spectrophotometer (Varian). The solid medium was prepared from the liquid medium by adding 0.6% (wt/vol) gelrite gellan gum (Kelco) and 8.0 mM magnesium chloride. Archaea were recovered from samples of pool water that were directly inoculated into liquid medium and incubated at 80°C with shaking or from enrichment cultures prepared by adding 0.1% (wt/vol) tryptone to pool water samples. Bacteria were recovered in a similar manner, but cultures were incubated at 55°C with shaking. All isolates were purified by streak plating for single colonies at least three times to ensure clonality. Frozen cultures were prepared using centrifugal pellets containing 1010 cells resuspended in basal salts (1) amended with 7% (vol/vol) dimethyl sulfoxide and then flash frozen and stored at 80°C. Competition experiments to assess the role of MerA in biological fitness in a mercury-contaminated environment were conducted by repeated subculturing accompanied by examination of the culture composition by enumeration. A mixed culture containing equal numbers of cells of PBL2002 (merA+ lacS::IS1217) (32) and PBL2020 (merA::lacS lacS::IS1217) (32) at a starting density of 107 cells/ml was grown to the mid-exponential phase and then subcultured in fresh medium. A mixed-culture control was repeatedly subcultured without mercury challenge. The mixed culture was exposed to mercury by using 0.5 µM mercuric chloride initially after the two strains were combined and then when the mixed culture was subcultured in fresh medium. Samples were removed periodically, and replicates were plated on a solid medium. After incubation, the plates were developed with X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) as described previously (32), and the white and blue colonies were counted.
FISH analysis.
Clarified pool water (120 ml) was passed through 0.45-µm filters, and planktonic organisms were recovered from the filters by resuspension. Cells were recovered after centrifugation at 10,000 x g for 10 min. The cell pellet was resuspended in phosphate-buffered saline containing 4% (vol/vol) paraformaldehyde, amended with 1 part of 100% ethanol, and stored at 20°C. Paraformaldehyde-fixed cells were placed on gelatin-coated slides and stained with fluorochrome-coupled oligonucleotide probes as described previously (9). The probes used were ARCH915 (GTGCTCCCCCGCCAATTCCT) (36), EUB338 (GCTGCCTCCCGTAGGAGT) (3), and EURY498 (TTCCCGGCCCGTTC) (8). Total cell counts were obtained by counterstaining the sample slides with 4',6'-diamidino-2-phenylindole (DAPI) as described previously (25). Fluorescence emission from the labeled probes was visualized by epifluorescence microscopy as described previously (25). Ten random images per sample slide were collected. The percentage of cells detected with each probe was normalized to the total number of cells detected with DAPI.
Community DNA isolation and characterization.
Community DNA was isolated from cells obtained from pool water neutralized using calcium carbonate. Archaeal DNA was recovered as previously described (32). Bacterial community DNA was extracted from cells recovered by centrifugation of the pool water sample at 3,000 x g for 10 min at 4°C. The cell pellet was resuspended in Tris-EDTA buffer (pH 7.0) and incubated with lysozyme (20 mg/ml) and mutanolysin (2.2 mg/ml) for 1 h. Pronase was added (3.3 mg/ml), and the cells were incubated further for 30 min at 37°C. The cell solution was divided into four equal parts (approximately 500 µl each) and processed as described by the manufacturer using an Ultra Clean soil DNA isolation kit (Mo Bio Laboratories, Inc.). DNA was eluted in 50 ml (final volume) of distilled water.
16S rRNA gene clone libraries.
The 16S rRNA gene was amplified from environmental DNA samples using primers ARCH21F (TTCCGGTTGATCCC/TGCCGGA) (11) and UNIV1392R (ACGGGCGGTGTGTG/AC) (24) for the archaeal clone library. BAC11F (AGAGTTTGATCCTGGCTCAG) (24) and BAC1492R (GGTTACCTTGTTACGACTT) (24) were used for the bacterial clone library. The PCR conditions used have been described previously (35). Amplified DNA was cloned either into SmaI-cut pBluescript IIKS (Stratagene) or into the TOPO-TA pCR4 vector (Invitrogen, Carlsbad, CA), and this was followed by transformation and selection in Escherichia coli. Gene inserts of 16S rRNA genes of randomly picked clones from each of the archaeal and bacterial libraries were partially sequenced (approximately 500 bp), and a subset was subjected to full-length sequence analysis. Full-length sequences were completed for all gene amplification products using custom-designed internal sequencing primers. Sample sequencing was done on both the sense and antisense DNA strands. Gene contigs were created from sequenced gene fragments using the Wisconsin Package, version 10.2 (Genetics Computer Group, Madison, WI) or ContigExpress, a component of the Vector NTI Suite 8.0 software (InforMax Inc.). Operational taxonomic units (OTUs) were defined as clones that exhibited 97% or greater sequence similarity.
Phylogenetic analysis.
Cloned PCR-amplified 16S rRNA gene sequences were analyzed for the presence of chimeric artifacts using CHECK CHIMERA from the Ribosomal Database Project (10). Gene and protein sequence alignments were prepared using the CLUSTAL W (37) function included in BIOEDIT, version 5.0.9. Phylogenetic trees were constructed and molecular evolutionary analyses were performed using the neighbor-joining method in MEGA, version 2.1 (20), as described previously (32).
Genomic DNA cloning and sequence analysis.
Genomic DNA was sheared by sonication for 1 to 3 s at 40 W. DNA ranging from 0.8 to 2.0 kb long was gel purified using a QIAEX II gel extraction kit (QIAGEN Inc., Valencia, CA), and ends were repaired in a mixture containing 30 U Klenow fragment (Invitrogen), 6 U T4 DNA polymerase (Promega), 1x React 2 buffer (Invitrogen), and each deoxynucleoside triphosphate at a concentration of 200 mM. The mixture was incubated for 40 min at 25°C, heat inactivated for 15 min at 70°C, chilled, and frozen at 20°C for subsequent use. The DNA was cleaned using a QIAGEN PCR purification kit (QIAGEN Inc., Valencia, CA) and then ligated into SmaI-cut pUC19 previously treated with shrimp alkaline phosphatase (Fermentas). For ligation we used a PTC-200 thermocycler (MJ Research) under the following conditions: 24.5°C for 90 min, 70°C for 15 min, and then holding at 4°C. Ligated plasmid DNA was transformed into E. coli DH5a electrocompetent cells using a Gene Pulser II (Bio-Rad) at 25 mF, 200
, and 1.8 kV. Transformants were plated on LB medium plates containing ampicillin (100 mg/ml) and X-Gal (50 mg/ml) and incubated for 15 to 17 h at 37°C. Transformants with an insert that was the proper size were then inoculated into 96-well microtiter plates containing 150 µl of LB medium with 7.5% (vol/vol) glycerol and 100 µg/ml of ampicillin. The plates were incubated at 37°C for 17 h and then frozen at 20°C until they were needed. After plasmid isolation, a template was prepared by cycle sequencing using the Nanoprep system (SVSci Inc.). DNA was sequenced by capillary analytical electrophoresis with 96-channel MegaBACE 1000 sequencers. Raw sequencing files were analyzed using PHRED, and reads with PHRED scores of 20 or greater were pursued. Contigs were assembled from individual sequences using Contig Express, a component of the Vector NTI Suite 9.0.0 software (InforMax Inc.). Annotation was performed by comparison to the public database using BLAST (2).
merA gene profiling.
For community DNA analysis we used archaeal merA gene primers designed from an alignment of the merA genes sequenced from pool 3-4 S. solfatarcicus isolates. The forward primer was CsarchmerA-F (CCTTGGCTATTATAGGCGGAAGG), and the reverse primer was CsarchmerA-R (CTGGACACCTAAAATRTTCC). Bacterial merA gene primers were designed from the Alicyclobacillus vulcanalis merA gene sequence. The forward primer was CsbactmerA-F (GTAGAAGTGAACGGAAACCG), and the reverse primer was CsbactmerA-R (GCCATGGTTAAATACGGMGC). The merA sequences were amplified as previously described (32). Amplicons were gel purified, ligated into pCR4, and cloned using a TOPO-TA cloning kit by following the manufacturer's protocol (Invitrogen, Carlsbad, CA).
Nucleotide sequence accession numbers. Newly determined accession numbers are reported in the figure legends.

RESULTS
Protein phylogeny of mercuric reductase.
Distance matrix analysis of prokaryotic mercuric reductases
(MerA) revealed two discrete MerA clades for the bacterial and
archaeal domains (Fig.
1). These clades were further distinguished
by the degree of divergence (length of the horizontal line)
between individual member sequences and between clades. In the
bacterial clade, proteobacterial representatives exhibited little
sequence divergence. In contrast, greater sequence divergence
was apparent in bacterial firmicutes compared to high-G+C-content
organisms and in both crenarchaeal and euryarchaeal divisions
of the archaeal clade. All archaeal MerA proteins lacked the
N-terminal extension found in most bacterial MerA proteins.
In addition, archaeal MerA proteins uniformly lacked the C-terminal
active tyrosine (Y605). It is noteworthy that with few exceptions,
bacterial
merA is located in transmissible elements, notably
plasmids, while in archaea this gene is located in the chromosome.
While these data argued against the occurrence of interdomain
merA transmission, the available sequences were derived from
organisms that do not inhabit common niches. To more directly
investigate the distribution of the two forms of MerA and the
potential for interdomain transmission, studies were conducted
with members of a single microbial community inhabiting a rare
naturally occurring mercury-rich environment.
Mercury hot springs.
Coso Hot Springs is located in a former mercury mining region
of southeastern California at the western edge of the Mohave
Desert. It is inside the boundaries of the United States China
Lake Naval Air Weapons Station. Coso Hot Springs geothermal
pool 3-4 is nearly 5 ft in diameter and has an average temperature
of 78°C and a pH of 1.7. The most distinguishing characteristic
of the pool is its blood red color resulting from penetration
by thermal plumes of deposits of cinnabar (mercuric sulfide).
The total mercury levels in the pool water varied from 2.23
mg/liter during the dry season to 0.127 mg/liter during the
wet season (Table
1). The mercury levels in pool 3-4 sediment
were 0.8 g/kg (dry weight). High concentrations of total iron
(3.03%, wt/vol) and total sulfur (1.08%, wt/vol) present as
pyrite (FeS
2) were also evident. As the solubility of mercuric
sulfide is very low, it is likely that the mercuric ion was
the biologically active form of the metal in this environment.
Community analysis.
Cultured isolates from pool 3-4 were obtained over a period
of 5 years. Five archaeal isolates obtained during this time
were characterized, and their 16S rRNA gene sequences and those
of
S. solfataricus strains 98/2 and P2 were found to exhibit
99 to 100% identity. Based on these levels of identity, one
of the isolates was designated
S.solfataricus strain Coso3-4.
S. solfataricus strain 98/2 is a laboratory wild-type strain
recovered from Yellowstone National Park in the United States
(
30,
31), while
S. solfataricus strain P2 was the subject of
a genome sequencing project (
34) and was isolated originally
from Piscarelli Hot Springs near Naples, Italy. Another bacterial
isolate, the
A. vulcanalis type strain, which was also recovered
from Coso Hot Springs pool 3-4, exhibited the highest level
of identity to
Alicyclobacillus acidocaldarius (97.8%) and was
identified as a new species of the bacterial genus
Alicyclobacillus (
35).
FISH analysis was conducted with multiple pool 3-4 water samples to obtain a quantitative estimate of the domain composition of the microbial community. Hybridization with the archaeon-specific ARCH915-fluorescein probe showed that archaea comprised 70% ± 3% of the pool 3-4 community (Fig. 2). Simultaneous hybridization with the bacterium-specific BAC338-Cy3 probe showed that Bacteria constituted 16% ± 2% of the microbial community. The additional nearly 14% of the community that was evident when DAPI was used could not be identified. No cells hybridizing with the euryarchaeote-specific probe EURY514 were evident. Similar results were obtained using water samples obtained at different times (March 2000 and 2002).
To further characterize the pool 3-4 community composition,
16S rRNA gene clone libraries were prepared using domain-specific
primers. Two libraries were constructed from archaeal community
DNA samples taken at two different times (March 2000 and 2002).
A preliminary survey of the diversity of the 16S rRNA gene clone
libraries was conducted by performing a DNA sequence analysis
of 500 nucleotides of 63 pooled clones. The results of a BLAST
analysis identified a subset that was then subjected to full-length
DNA sequence analysis based on the representation of distinct
taxa. A distance matrix analysis produced a consensus tree comprising
the resulting sequences from both clone libraries combined with
16S rRNA gene sequences derived from pool 3-4 cultured archaeal
isolates (Fig.
3). Sequences related to 16S rRNAs from both
aerobic and anaerobic crenarchaeotes were evident. Overall,
the 16S rRNA gene sequences in the clone libraries exhibited
between 80 and 99% identity with each other. Clones in the first
library belonged to an OTU represented by
Stygiolobus azoricus,
and these 23 clones exhibited between 98.3 and 99.6% identity.
The designations of these clones on the tree begin with C1 or
C3. The second clone library (clones whose designations end
with CON) revealed the presence of additional OTUs related to
Metallosphaera and
Sulfolobus. Within the
Sulfolobus-like OTU,
three clusters were evident, and these clusters were designated
clusters I, II, and III. Surprisingly, all cultured isolates
from the pool, Coso3-1, Coso3-7, Coso503-1, CosoL6, and Coso3-4,
were assigned only to
Sulfolobus-like cluster I. The clone library
also revealed the presence of one clone, 14CON, which exhibited
99% identity to a soil clone from Yellowstone National Park.
Eukaryotic and euryarchaotal rRNA gene sequences were not evident
in these libraries, which is consistent with their absence as
determined by FISH.
In order to extract bacterial DNA from the pool, a bead beating
protocol of a commercially available soil extraction kit was
modified by adding several enzymatic treatments of the sample.
A bacterial clone library was constructed from pool 3-4 water
samples taken during October 2003. Seventeen unique clones exhibited
between 90 and 99% identity with each other, and their sequences
were very similar to those of
Sulfobacillus spp. (98% identity)
and acidic thermophilic bacteria isolated from Yellowstone National
Park (98% identity). The sequence of none of the clones matched
the 16S rRNA gene sequence of
A. vulcanalis cultured previously
from this pool (
35). Distance matrix analysis of 16S rRNA gene
sequences of both cultured and uncultured bacteria from pool
3-4 also produced a consensus tree (Fig.
4). This tree showed
all clones that formed a cluster with
Sulfobacillus sp. strain
MPH6, an isolate from an acidic mine (
21), as well as
Sulfobacillus sp. strain YTH2 (
17) and isolate Y004 (
18), both of which were
retrieved from Yellowstone National Park, and bacterium K1,
an isolate most closely related to
Sulfobacillus thermosulfidooxidans (
19).
merA from pool 3-4.
Since
merA sequences from acidophilic thermophilic gram-positive
bacteria were unavailable for primer design, efforts to amplify
bacterial
mer genes from bacterial community DNA were conducted
using degenerate primers based on
Bacillus merA sequences. These
efforts were unsuccessful; therefore,
merA from
A. vulcanalis was isolated and used for primer design. To recover
A. vulcanalis merA, a shotgun genomic clone library prepared from
A. vulcanalis DNA was screened by DNA sequence analysis. An
A. vulcanalis merA clone was identified among 0.4 Mb and 700 clones of sequenced
DNA. This clone contained 75% of a full-length bacterial
merA sequence, including 1,317 nucleotides (encoding 439 amino acids).
Since a start codon was not evident, the presence of the bacterial
N-terminal extension could not be determined. PCR and specific
primers were used, however, to confirm the presence of this
gene in
A. vulcanalis genomic DNA. The
A. vulcanalis MerA sequence
most closely matched gram-positive bacterial MerA sequences,
particularly those from bacilli and streptococci (Fig.
5). Although
this sequence clustered with
Bacillus MerA sequences, it occupied
a unique and relatively deeply rooting branch, albeit a branch
with indeterminate topology. The most closely related MerA sequences
were those of
Streptococcus agalactiae,
Streptococcus parasanguinis,
Staphylococcus aureus, and
Enterococcus faecium. A multiple-sequence
alignment indicated that 44 noncontiguous positions were conserved
in the MerA homologs of these four organisms but were divergent
in
A. vulcanalis MerA. Since none of the other organisms are
thermophilic, it is probable that these residues contribute
to the thermostability of the
A. vulcanalis protein.
Culture-dependent and culture-independent methods verified the
presence of a mixed-domain microbial community in pool 3-4.
Efforts were therefore made to compare the MerA sequences. A
PCR clone library was prepared using pool 3-4 archaeal community
DNA and primers complementary to conserved internal positions
evident in an alignment of
merA sequences derived from the cultured
S. solfataricus isolates recovered from this environment. A
total of 17 clones derived from two libraries prepared with
different community DNA samples were sequenced. All cloned
merA sequences exhibited 99% DNA sequence identity with each other
over an alignment of 620 bases, and none of the sequences was
identical to sequences derived from any cultured strain of
S. solfataricus. The MerA amino acid sequence of
S. solfataricus strain Coso3-4, one of the culture isolates, most closely matched
the environmental clone amino acid sequences (Fig.
6).
In contrast, attempts to use PCR to amplify bacterial homologs
of
merA from pool 3-4 bacterial community DNA with primers complementary
to
A. vulcanalis merA were unsuccessful. Consequently, to address
diagnostic features located in terminal regions of this protein,
MerA sequences from only cultured isolates were compared (Fig.
7). Conserved catalytically active regions were determined from
an alignment of MerA sequences from
A. vulcanalis,
Bacillus sp. strain RC607, and
S. solfataricus Coso3-4. As observed for
all other archaeal MerA homologs, the
S. solfataricus Coso3-4
protein lacked an essential tyrosine (Y605) present in MerA
from
Bacillus sp. strain RC607 that was also evident in
A. vulcanalis MerA. However, the other tyrosine and all four cysteines found
in bacterial MerA were conserved in archaeal MerA sequences.
The archaeal MerA lacked the N-terminal extension common among
bacterial MerA sequences. These results indicated that MerA
from pool 3-4 cultured isolates exhibited conserved domain-specific
characteristics despite ongoing selection for mercury resistance
in this microbial community.
Contribution of archaeal MerA to fitness in a mercury-contaminated environment.
In previous studies, data from physiologic and genetic experiments
indicated that archaeal MerA contributed to cellular resistance
of
S. solfataricus in pure culture during mercuric ion challenge
(
32). To further substantiate that MerA has a role as a mediator
of mercury resistance, as well as its assignment as a mercuric
reductase, an assessment of its contribution to cell fitness
was conducted. The effect of repeated mercuric chloride challenge
was examined with a mixed culture containing an
S. solfataricus strain encoding a functional copy of
merA (PBL2002) (
32) and
a mutant lacking
merA (PBL2020) (
32) (Fig.
8). The two strains
were readily distinguished by the presence of distinct alleles
of
lacS. The
merA mutant strain, PBL2020, contained a functional
copy of
lacS inserted into
merA (
merA::
lacS), while the strain
with the functional copy of
merA, PBL2002, contained an inactivated
copy of
lacS (
lacS::IS
1217).
lacS encodes a broad-spectrum beta-glycosidase.
In the presence of the lactose analog X-Gal, colonies comprised
of cells containing LacS hydrolyze X-Gal, resulting in blue
pigmentation. In the absence of LacS colonies remain colorless.
Using this approach, the composition of the mixed culture was
assessed by determining the numbers of blue and white colonies
evident after plating on a medium containing X-Gal. In the absence
of mercuric ion challenge and after three cycles of subculturing,
the number of cells of each strain remained nearly constant,
indicating that their levels of fitness remained comparable
(Fig.
8A). In contrast, following mercuric ion challenge the
number of cells of PBL2020 (lacking
merA) decreased rapidly
to undetectable levels (<0.05%), and the mixed culture became
dominated by cells of the strain containing
merA, PBL2002 (Fig.
8B). This pattern remained after repeated cycles of subculturing.
These data demonstrate that archaeal MerA confers increased
fitness on
S. solfataricus in a mercury-contaminated environment.

DISCUSSION
Direct examination of pool 3-4 samples by FISH analysis indicated
that archaea comprise the bulk of the community. Furthermore,
Crenarchaeota and not
Euryarchaeota represented this archaeal
population, as determined both by FISH and by 16S rRNA gene
analysis. Bacteria, on the other hand, constituted only a minor
fraction of the total community. The identity of the remaining
fraction remained unclear. Inefficient probe penetration may
have precluded cell detection; indeed, a survey of the literature
for FISH analysis indicated that this technique has not been
widely used with acidic geothermal samples.
All cultured archaeal isolates exhibited 99% identity with S. solfataricus and could be assigned to a single clade within this taxon. Two additional clades were identified by community DNA analysis but were not cultured. This result showed there was bias in culture-based community analysis. All OTUs detected by culture-independent methods were most closely related to chemolithoautotrophic sulfur-utilizing taxa capable of growing at temperature optima between 60 and 90°C and pH optima around 2 to 3.
Culture-independent data indicated that bacteria residing in pool 3-4 were most closely related to Sulfobacillus and Alicyclobacillus, two genera of acidophilic thermophilic microorganisms. Members of the genus Alicyclobacillus are frequently recovered from geothermal environments. Sulfobacillus is a genus of iron- and sulfur-oxidizing bacteria, while Alicyclobacillus is heterotrophic (6). The cultured A. vulcanalis isolate was not detected by 16S rRNA gene analysis. Since direct analysis of pool samples by FISH confirmed the presence of Bacteria, it is possible that PCR bias (29), difficulty in extracting DNA from environmental samples and from gram-positive bacteria in particular (15), or just the presence of this bacterium at low levels explains the lack of its detection by this method.
Our efforts to examine the types and distribution of the key mercury resistance gene, merA, in the pool 3-4 community relied on the use of cultured organisms and culture-independent data. Analysis of archaeal merA sequences derived from community DNA provided insight into the degree of divergence exhibited by this gene under conditions under which its function resulted in active selection. The cultured archaea from pool 3-4 exhibited 99% identity to each other and to S.solfataricus strains 98/2 and P2 as determined by 16S rRNA gene analysis. However, the merA sequences of the five archaeal S. solfataricus-like isolates varied widely, and some of them exhibited only 90% identity to each other (27). Interestingly, this observation shows that merA genes from cultured archaeal isolates belonging to a single species can exhibit as much as 10% divergence. In contrast, as reported here, archaeal merA sequences that were PCR amplified from environmental samples were 99% identical to each other despite the fact that considerably more divergent cultured merA sequences were used for primer design. While the predominance of this sequence group could result from PCR amplification bias, it may instead indicate the presence of a predominant strain selected by ongoing mercury exposure. The significance of this variation could be further elucidated by biochemical analysis of individual protein types, which could distinguish between mere drift and altered enzymatic function. The extent of MerA divergence in these samples falls within the range found previously in studies of ammonia-oxidizing bacteria (AOB) (26). In this case, the divergence of the amoA (ammonia monooxygenase) gene was compared with the variation in 16S rRNA genes of AOB. AOB belonging to the same species exhibiting 97% or greater 16S rRNA gene identity exhibited levels of amoA gene sequence similarity of more than 84%.
BLASTp analysis of A vulcanalis MerA with the NCBI database showed that this protein was the bacterial form of the protein and not the archaeal form. An alignment of the MerA sequences of pool 3-4 archaeal and bacterial isolates with known archaeal and bacterial MerA homologs also showed that the A. vulcanalis MerA had conserved catalytically active sites that are present in all other bacterial MerA proteins. However, both cultured and culture-independent archaeal MerA protein sequences lacked the active tyrosine residue (Y605), which is consistent with all other previously identified archaeal MerA proteins. The similar lack of an N-terminal extension on the archaeal MerA that is normally present in bacterial MerA provided further support for the hypothesis that two distinct forms of MerA coexist in a single niche. It is possible that each type of MerA best fulfills the mercury detoxification function and that interdomain transfer does not confer an advantage upon recipient organisms.
While the data presented here suggested that there are two prokaryotic forms of mercuric reductase (one bacterial the other archaeal), it was possible the function of the archaeal form was divergent and that the enzyme either was not a mercuric reductase or perhaps was merely an inefficient form of the enzyme. Previous studies using physiologic and genetic experimental strategies supported the identification of the archaeal MerA protein as a mercuric reductase (32). In the studies described here, this conclusion received further support from competition experiments performed with strains with and without the merA gene that assessed the role of the protein in biological fitness. Cocultivation of S. solfataricus strains with and without merA during repeated cycles of mercury challenge resulted in rapid disappearance of the merA-deficient strain from the mixed culture. This indicates that archaeal MerA is essential for survival and proliferation of S.solfataricus during mercury challenge. Thus, the data obtained in this study indicate that the archaeal mercuric reductase is a new form of the enzyme that provides a significant benefit to S.solfataricus in a mercury-contaminated environment.

ACKNOWLEDGMENTS
This research was supported by funds provided by the National
Science Foundation to P.B.
The assistance of personnel at the China Lake Naval Weapons Facility is gratefully acknowledged.

FOOTNOTES
* Corresponding author. Mailing address: E234 Beadle Center for Genetics, University of Nebraska, Lincoln, NE 68588-0666. Phone: (402) 472-2769. Fax: (402) 472-8722. E-mail:
pblum1{at}unl.edu.


REFERENCES
1 - Allen, M. B. 1959. Studies with Cyanidium caldarium, an anomalously pigmented chlorophyte. Arch. Mikrobiol. 32:270-277.[CrossRef][Medline]
2 - Altschul, S. F., W. Gish, W., Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
3 - Amann, R., L. Krumholz, and D. A. Stahl. 1990. Fluorescent-oligonucleotide probing of whole cells for determinative, phylogenetic, and environmental studies in microbiology. J. Bacteriol. 172:762-770.[Abstract/Free Full Text]
4 - Aravind, L., R. L. Tatusov, Y. I. Wolf, D. R. Walker, and E. V. Koonin. 1998. Evidence for massive gene exchange between archaeal and bacterial hyperthermophiles. Trends Genet. 14:442-444.[CrossRef][Medline]
5 - Barkay, T., S. M. Miller, and A. O. Summers. 2003. Bacterial mercury resistance from atoms to ecosystems. FEMS Microbiol. Rev. 27:355-384.[CrossRef][Medline]
6 - Bridge, T. A. M., and D. B. Johnson. 1998. Reduction of soluble iron and reductive dissolution of ferric iron-containing minerals by moderately thermophilic iron-oxidizing bacteria. Appl. Environ. Microbiol. 64:2181-2186.[Abstract/Free Full Text]
7 - Brock, T. D., K. M. Brock, R. T. Belly, and R. L. Weiss. 1972. Sulfolobus: a genus of sulfur oxidizing bacteria living at low pH and high temperature. Arch. Mikrobiol. 84:54-68.[CrossRef][Medline]
8 - Burggraf, S., T. Mayer, R. Amann, S. Schadhauser, C. R. Woese, and K. O. Stetter. 1994. Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes. Appl. Environ. Microbiol. 60:3112-3119.[Abstract/Free Full Text]
9 - Chen, H., G. Ponniah, N. Solanen, and P. Blum. 2004. Culture-independent analysis of fecal enterobacteria in environmental samples by single-cell mRNA profiling. Appl. Environ. Microbiol. 70:4432-4439.[Abstract/Free Full Text]
10 - Cole, J. R., B. Chai, T. L. Marsh, R. J. Farris, Q. Wang, S. A. Kulam, S. Chandra, D. M. McGarrell, T. M. Schmidt, G. M. Garrity, and J. M. Tiedje. 2003. The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy. Nucleic Acids Res. 31:442-443.[Abstract/Free Full Text]
11 - DeLong, E. F. 1992. Archaea in coastal marine environments. Proc. Natl. Acad. Sci. USA 89:5685-5689.[Abstract/Free Full Text]
12 - Deppenmeier, U., A. Johann, T. Hartsch, R. Merkl, R. A. Schmitz, R. Martinez-Arias, A. Henne, A. Wiezer, S. Baumer, C. Jacobi, H. Bruggemann, T. Lienard, A. Christmann, M. Bomeke, S. Steckel, A. Bhattacharyya, A. Lykidis, R. Overbeek, H. P. Klenk, R. P. Gunsalus, H. J. Fritz, and G. Gottschalk. 2002. The genome of Methanosarcina mazei: evidence for lateral gene transfer between bacteria and archaea. J. Mol. Microbiol. Biotechnol. 4:453-461.[Medline]
13 - DiRuggiero, J., D. Dunn, D. Maeder, R. Holley-Shanks, J. Chatard, R. Horlacher, F. T. Robb, W. Boos, and R. B. Weiss. 2000. Evidence of recent lateral gene transfer among hyperthermophilic Archaea. Mol. Microbiol. 38:684-693.[CrossRef][Medline]
14 - Dixit, V., E. Bini, M. Drozda, and P. Blum. 2004. Mercury inactivates transcription and the generalized transcription factor TFB in the archaeon Sulfo-lobus solfataricus. Antimicrob. Agents Chemother. 48:1993-1999.[Abstract/Free Full Text]
15 - Head, I. M., J. R. Saunders, and R. W. Pickup. 1998. Microbial evolution, diversity and ecology: a decade of ribosomal RNA analysis of uncultivated microorganisms. Microb. Ecol. 35:1-21.[CrossRef][Medline]
16 - Jain, R., M. C. Rivera, and J. A. Lake. 1999. Horizontal gene transfer among genomes: the complexity hypothesis. Proc. Natl. Acad. Sci. USA 96:3801-3806.[Abstract/Free Full Text]
17 - Johnson, D. B., D. A. Body, T. A. M. Bridge, D., F, Bruhn, and F. F. Roberto. 2001. Biodiversity of acidophilic moderate thermophiles isolated from two sites in Yellowstone National Park, and their roles in dissimilatory oxidoreduction of iron, p. 23-39. In A. L. Reysenbach and A. Voytek (ed.), Thermophiles: biodiversity, ecology and evolution. Kluwer Academic/Plenum Publishers, New York, N.Y.
18 - Johnson, D. B., N. Okibe, and F. F. Roberto. 2003. Novel thermo-acidophilic bacteria isolated from geothermal sites in Yellowstone National Park: physiological and phylogenetic characteristics. Arch. Microbiol. 180:60-68.[CrossRef][Medline]
19 - Karavaiko, G. G., T. P. Tourova, I. A. Tsaplina, and T. I. Bogdanova. 2000. The phylogenetic positions of aerobic moderately thermophilic bacteria oxidizing Fe2+, S(0) and sulfide minerals and affiliated to the genus Sulfobacillus. Mikrobiologiya 69:857-860.
20 - Kumar, S., K. Tamura, I. B. Jakobsen, and M. Nei. 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17:1244-1245.[Abstract/Free Full Text]
21 - Lehman, R. M., F. F. Roberto, D. Earley, D. F. Bruhn, S. E. Brink, S. P. O'Connell, M. E. Delwiche, and F. S. Colwell. 2001. Attached and unattached bacterial communities in a 120-meter corehole in an acidic, crystalline rock aquifer. Appl. Environ. Microbiol. 67:2095-2106.[Abstract/Free Full Text]
22 - Lopez-Garcia, P., C. Brochier, D. Moreira, and F. Rodriguez-Valera. 2004. Comparative analysis of a genome fragment of an uncultivated mesopelagic crenarchaeote reveals multiple horizontal gene transfers. Environ. Microbiol. 6:19-34.[CrossRef][Medline]
23 - Nelson, K. E., R. A. Clayton, S. R. Gill, M. L. Gwinn, R. J. Dodson, D. H. Haft, E. K. Hickey, J. D. Peterson, W. C. Nelson, K. A. Ketchum, L. McDonald, T. R. Utterback, J. A. Malek, K. D. Linher, M. M. Garrett, A. M. Stewart, M. D. Cotton, M. S. Pratt, C. A. Phillips, D. Richardson, J. Heidelberg, G. G. Sutton, R. D. Fleischmann, J. A. Eisen, O. White, S. L. Salzberg, H. O. Smith, J. C. Venter, and C. M. Fraser. 1999. Evidence for lateral gene transfer between Archaea and bacteria from genome sequence of Thermotoga maritima. Nature 399:323-329.[CrossRef][Medline]
24 - Pace, N. R., D. A. Stahl, D. J. Lane, and G. J. Olsen. 1986. The analysis of natural microbial populations by ribosomal RNA sequences. Adv. Microb. Evol. 9:1-55.
25 - Ponniah, G., H. Chen, R. Michielutti, N. Salonen, and P. Blum. 2003. Single-cell protein profiling of wastewater enterobacterial communities predicts disinfection efficiency. Appl. Environ. Microbiol. 69:4227-4235.[Abstract/Free Full Text]
26 - Purkhold, U., A. Pommerening-Roser, S. Juretschko, M. C. Schmid, H. P. Koops, and M. Wagner. 2000. Phylogeny of all recognized species of ammonia oxidizers based on comparative 16S rRNA and amoA sequence analysis: implications for molecular diversity surveys. Appl. Environ. Microbiol. 66:5368-5382.[Abstract/Free Full Text]
27 - Redfield, E. 2003. Divergence patterns and evolutionary dynamics of geographically isolated strains of Sulfolobus solfataricus. M.S. thesis. School of Biological Sciences, University of Nebraska, Lincoln.
28 - Rennex, D., R. T. Cummings, M. Pickett, C. T. Walsh, and M. Bradley. 1993. Role of tyrosine residues in Hg(II) detoxification by mercuric reductase from Bacillus sp. strain RC607. Biochemistry 32:7475-7478.[CrossRef][Medline]
29 - Reysenbach, A. L., L. J. Giver, G. S. Wickham, and N. R. Pace. 1992. Differential amplification of rRNA genes by polymerase chain reaction. Appl. Environ. Microbiol. 58:3417-3418.[Abstract/Free Full Text]
30 - Rolfsmeier, M., and P. Blum. 1995. Purification and characterization of a maltase from the extremely thermophilic crenarchaeote Sulfolobus solfataricus. J. Bacteriol. 177:482-485.[Abstract/Free Full Text]
31 - Rolfsmeier, M., C. Haseltine, E. Bini, A. Clark, and P. Blum. 1998. Molecular characterization of the alpha-glucosidase gene (malA) from the hyperthermophilic archaeon Sulfolobus solfataricus. J. Bacteriol. 180:1287-1295.[Abstract/Free Full Text]
32 - Schelert, J., V. Dixit, V. Hoang, J. Simbahan, M. Drozda, and P. Blum. 2004. Occurrence and characterization of mercury resistance in the hyperthermophilic archaeon Sulfolobus solfataricus by use of gene disruption. J. Bacteriol. 186:427-437.[Abstract/Free Full Text]
33 - Schiering, N., W. Kabsch, M. J. Moore, M. D. Distefano, C. T. Walsh, and E. F. Pai. 1991. Structure of the detoxification catalyst mercuric ion reductase from Bacillus sp. strain RC607. Nature 352:168-172.[CrossRef][Medline]
34 - She, Q., R. K. Singh, F. Confalonieri, Y. Zivanovic, G. Allard, M. J. Awayez, C. C. Chan-Weiher, I. G. Clausen, B. A. Curtis, A. De Moors, G. Erauso, C. Fletcher, P. M. Gordon, I. Heikamp-de Jong, A. C. Jeffries, C. J. Kozera, N. Medina, X. Peng, H. P. Thi-Ngoc, P. Redder, M. E. Schenk, C. Theriault, N. Tolstrup, R. L. Charlebois, W. F. Doolittle, M. Duguet, T. Gaasterland, R. A. Garrett, M. A. Ragan, C. W. Sensen, and J. Van der Oost. 2001. The complete genome of the crenarchaeote Sulfolobus solfataricus P2. Proc. Natl. Acad. Sci. USA 98:7835-7840.[Abstract/Free Full Text]
35 - Simbahan, J., R. Drijber, and P. Blum. 2004. Alicyclobacillus vulcanalis sp. nov., a new thermophilic, acidophilic bacterium isolated from Coso Hot Springs, California, USA. Int. J. Syst. Evol. Microbiol. 54:1703-1707.[Abstract/Free Full Text]
36 - Stahl, D. A., and R. Amann. 1991. Development and application of nucleic acid probes in bacterial systematics, p. 205-248. In E. Stackebrandt and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley and Sons, Chichester, United Kingdom.
37 - Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
38 - Vetriani, C., Y. S. Chew, S. M. Miller, J. Yagi, J. Coombs, R. A. Lutz, and T. Barkay. 2005. Mercury adaptation among bacteria from a deep-sea hydrothermal vent. Appl. Environ. Microbiol. 71:220-226.[Abstract/Free Full Text]
Applied and Environmental Microbiology, December 2005, p. 8836-8845, Vol. 71, No. 12
0099-2240/05/$08.00+0 doi:10.1128/AEM.71.12.8836-8845.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Schelert, J., Drozda, M., Dixit, V., Dillman, A., Blum, P.
(2006). Regulation of Mercury Resistance in the Crenarchaeote Sulfolobus solfataricus.. J. Bacteriol.
188: 7141-7150
[Abstract]
[Full Text]