This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scaramozzino, F.
Right arrow Articles by Albertini, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scaramozzino, F.
Right arrow Articles by Albertini, A. M.
Agricola
Right arrow Articles by Scaramozzino, F.
Right arrow Articles by Albertini, A. M.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, December 2005, p. 8937-8940, Vol. 71, No. 12
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.12.8937-8940.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

SHORT REPORT

Improvement of Catalytic Properties of Escherichia coli Penicillin G Acylase Immobilized on Glyoxyl Agarose by Addition of a Six-Amino-Acid Tag

Francesca Scaramozzino,1,§ Ilona Estruch,2 Paola Rossolillo,1 Marco Terreni,2 and Alessandra M. Albertini1*

Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia, Via Ferrata 1, 27100 Pavia, Italy,1 Laboratorio di Farmaceutica e Biocatalisi, Dipartimento di Chimica Farmaceutica, Università degli Studi di Pavia, Via Taramelli 12, 27100 Pavia, Italy2

Received 10 January 2005/ Accepted 31 July 2005


arrow
ABSTRACT
 
A tag of three lysines alternating with three glycines was added to the C-terminal end of the ß chain of penicillin G acylase (PGA). This modification improved the immobilization efficiency of PGA on glyoxyl agarose and the catalytic properties of the PGA derivative, although it impaired the posttranslational steps of overexpressed protein maturation.


arrow
INTRODUCTION
 
Penicillin G acylase (PGA) is used as a catalyst for the enzymatic semisyntheses of several penicillins and cephalosporins (11, 15-17, 21). An immobilized derivative of PGA is usually employed to ensure suitable enzyme stability and consequently enzyme recovery and reuse (7, 10). Depending on the immobilization support and procedure, different catalytic properties can be obtained in the synthesis of ß-lactam antibiotics by kinetically controlled N acylation (20). Immobilization procedures usually involve the free amino groups of the enzyme. Immobilization on supports activated with aldehyde groups (glyoxyl supports) proceeds via interaction with the region of the protein surface that is richest in lysines or that bears the most reactive ones. Lysine residues are present near the active site of PGA (13). If interactions between the enzyme and the solid support occur through those lysine residues, PGA-catalytic properties may be affected by the consequently limited accessibility of the active site.

Here we propose a new strategy to facilitate access of the substrate to the active site of PGA by addition of a tag consisting of three lysines alternating with three glycines at the end of the ß chain. This strategy is aimed at favoring immobilization on glyoxyl agarose at the tag side, far from the active site. A similar strategy was successful in the case of a subtilisin derivative in which the enzyme activity actually improved after the introduction of a cysteine on the enzyme surface, far from the active site (14). The rationale for adding lysine residues to PGA is that increasing the lysine content on a lysine-rich region of PGA surface has been shown to increase the number of bonds between protein and glyoxyl agarose and to induce a preferential orientation towards the support surface (1).


arrow
Cloning and PCR mutagenesis.
 
The Escherichia coli pac gene was amplified by PCR using 5' CACCAATGAAAAATAGAAATCGTATGA 3' as the forward primer and 5' AAAGTAACCAGCCCTCCAACAT 3' as the reverse primer and cloned into the pET101/D-TOPO expression vector to obtain the pETPAC construct. The mutant 3G3Kpac was obtained by PCR, with the same forward primer and the reverse primer 5' TTACTACTTACCCTTGCCCTTACCTCTCTGAACGTGCAACACTT 3'. The mutated XbaI-HindIII 3G3Kpac fragment was subcloned into the pET28a vector (Novagen) to obtain the pET28-3G3KPAC construct.


arrow
Expression and purification of PGA and 3G3KPGA.
 
Wild-type PGA overexpression was performed by growing a 4-liter aerated Luria-Bertani BL21(DE3) culture (0.5-bar air pressure, 150-rpm stirring) at 28°C. The temperature was lowered to 22°C after induction at an optical density at 600 nm of 0.6 with 0.5 mM IPTG (isopropyl-ß-D-thiogalactopyranoside). Expressing cells were collected after 1 day from induction. The periplasmic extract (3) was purified on a Q-Sepharose column (Pharmacia), with a 0-to-75 mM NaCl gradient in 50 mM Tris HCl (pH 8.5) (average yield was 18 mg of purified protein per 30 g of wet cells). pET28-3G3KPAC was expressed in BL21 Star(DE3) cells as described previously, except that the temperature for the induction of expression was lowered to 20°C, due to the increased sensitivity and lower yield of processing and maturation (2, 4, 8, 13, 18, 19) of the modified enzyme (data not shown). The periplasmic extract was precipitated with 75% (NH4)2SO4 and the pellet, resuspended in 1 M (NH4)2SO4 and 50 mM potassium phosphate (pH 7), was purified on a phenyl Sepharose column with a gradient of 0 to 30% ethylene glycol in 50 mM potassium phosphate (pH 7). The average yield was 26 mg of purified protein per 30 g of wet cells.


arrow
Enzymatic activity.
 
Hydrolytic activity of the soluble acylases was determined spectrophotometrically by using 1.5 mM 6-nitro-3-phenylacetamido benzoic acid (NIPAB) in 50 mM phosphate buffer, pH 8.5, at 25°C (9), as well as by 50 mM NaOH automatic titration at pH 8 using 80 mM penicillin G potassium salt (PGK) at 37°C and 10 mM R-mandelic acid methyl ester (MAME) at 25°C, respectively. All the enzymes showed similar activity profiles. When PGK and NIPAB were used as substrates, the specific activity of wild-type PGA was higher than the activities of both the commercial (Recordati) and the tagged enzyme. When MAME was used as the substrate, the activities of the three enzymes were comparable. Interestingly, 3G3KPGA was slightly more active than the commercial enzyme with every substrate (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Specific activities of the soluble enzymes for different substratesa


arrow
Enzyme immobilization.
 
Wild-type and modified PGA were immobilized on aldehyde agarose (glyoxyl agarose) by loading 0.7 to 1 mg of protein per gram of support and subsequently compared with a commercial acylase from E. coli immobilized by the same procedure (5, 12). 3G3KPGA was completely immobilized under standard conditions (pH 10 and 25°C), but the resulting derivative turned out to be inactive due to low stability (Fig. 1). In order to overcome this problem, the pH was lowered from 10 to 9.5 and the temperature from 25°C to 4°C; consequently, about 50% of the initial activity was maintained after 2 h (Fig. 1). The immobilization efficiencies of the enzymes were compared under these conditions by measuring the amount of protein remaining in solution at different times (Fig. 2). Commercial and wild-type PGA showed the same behavior: 30% of the total protein was immobilized after 3 h (Fig. 2 and Table 2), and no changes in specific activity were observed, as reported in Table 2. Remarkably, in the case of 3G3KPGA, the immobilization proceeded much faster, and after 3 h, about 50% of the total protein was immobilized (Fig. 2). As expected considering the low stability of the modified enzyme, about half of the activity corresponding to the amount of 3G3KPGA loaded was maintained after immobilization; the specific activity of 3G3KPGA decreased from 18 to 8.5 U/mg of protein (Tables 1 and 2).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. Stability of the enzymes at different pHs and temperatures. Symbols: x, wild type at pH 10 and 25°C; {blacksquare}, 3G3KPGA at pH 10 and 25°C; •, 3G3KPGA at pH 10 and 4°C; {blacktriangleup}, 3G3KPGA at pH 9.5 and 4°C. All tests were done in the presence of 100 mM phenyl acetic acid.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 2. Immobilization of wild-type PGA (•), commercial PGA ({blacksquare}), and 3G3KPGA ({blacktriangleup}) on agarose activated with aldehyde groups at pH 9.5, 4°C, in the presence of 100 mM phenyl acetic acid. The residual protein remaining in solution at different times was measured by the Bradford assay (6). Five independent immobilization tests gave similar results and produced the five batches of immobilized derivatives used in the assays (Table 2 and Fig. 3).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Immobilization of acylases on agarose beads bearing aldehyde groups on the surface, at pH 9.5 and 4°Ca


arrow
Determination of S/H ratio in the acylation reaction of ß-lactam nuclei.
 
The enzyme derivatives were tested as catalysts in the kinetically controlled N acylation of 7-aminocephalosporanic acid (7-ACA) with MAME (substrates concentration, 5 mM), by evaluating the ratio of initial rates of synthesis (S) and ester hydrolysis (H) (20). S/H is strictly related to the affinity of the enzyme for the ß-lactam nucleus and S/H is strictly related to the affinity of the enzyme for the ß-lactam nucleus and depends on the ability of the catalyst to adsorb the substrate into the active center. In the case of soluble proteins, the tagged enzyme showed a higher S/H ratio (~3) than both the wild-type and the commercial acylases (S/H ratio, ~2). This result, together with the lower stability of the tagged protein than the native protein, suggests that the tag induces a structural change of PGA that involves the active site. After immobilization, the S/H ratio of the tagged enzyme was almost unchanged (~3.5), while those of the wild-type and the commercial PGA decreased (S/H ratio, ~1) (Fig. 3). These results suggest that the active site of the immobilized tagged enzyme may be more accessible to the ß-lactam substrate. Most likely, the orientation of 3G3KPGA towards the support surface is initially influenced by the high reactivity of the tag, even though further interactions can happen with other free amino groups on the enzyme surface. We then followed the reaction between 7-ACA and MAME (both 5 mM) by high-pressure liquid chromatography, until the maximum conversion was achieved (usually in 2 to 3 h); we observed that the immobilized 3G3KPGA yielded a higher conversion of 7-ACA into the acylation products than the wild-type immobilized PGA (17% of maximum conversion versus 12%). The smaller difference of the conversion values observed with the two immobilized enzymes at the end of the reaction, compared to the differences of the S/H ratios calculated at the beginning of the reaction, may be attributed to the hydrolysis of the acylation products that becomes more and more significant as the concentration of the acylations product increases during the reaction course.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 3. S/H ratio in the N-acylation reaction of 7-ACA. The S/H ratio in the PGA-catalyzed N acylation of 7-ACA was evaluated by measuring the initial rates of synthesis (S) and MAME hydrolysis (H). The S/H ratios of wild-type, commercial, and tagged PGA were evaluated using the soluble enzymes and the glyoxyl agarose derivatives. 7-ACA and MAME concentrations were both 5 mM (pH 6.5, 4°C).

In summary, we have demonstrated that the introduction of a tag of alternating glycines and lysines to the C terminus of the ß chain of PGA improves the efficiency of immobilization on glyoxyl agarose. Although the stability of the soluble tagged enzyme decreases, the flexibility and the high number of lysines in the tag may ensure efficient immobilization under conditions that are unfavorable for the wild-type enzyme. The derivative conserves the excellent catalytic properties of the soluble enzyme in the kinetically controlled N acylation of 7-ACA. These results suggest that the presence of the tag influences the enzyme orientation during immobilization, allowing a better accessibility of the substrate to the active site. However, even if the S/H ratio of the tagged enzyme can be declared superior to the wild-type one, the low stability of 3G3KPGA limits its industrial application. Different immobilization procedures are being evaluated to improve the stability of 3G3KPGA. Further-modified enzymes obtained by the introduction of additional lysines in different areas of the PGA surface are in development for the purpose of industrial applicability.


arrow
ACKNOWLEDGMENTS
 
This work was financially supported by the University of Pavia (FAR 2000 and 2001 to A.M.A and Progetto di Ateneo 2002 and 2003 to M.T.).

We thank Andrea Mattevi for helpful suggestions, Auro Tagliani for stimulating discussions and for providing the clavulanic acid, and Elisabetta Andreoli for expert technical assistance. Furthermore, we thank Recordati S.p.a. (Opera) for providing the commercial PGA.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia, Via Ferrata 1, 27100 Pavia, Italy. Phone: (39) 0382-985549. Fax: (39) 0382-528496. E-mail: albert{at}ipvgen.unipv.it. Back

§ Present address: Department of Molecular, Cellular and Developmental Biology, University of California, Santa Barbara, Calif. Back


arrow
REFERENCES
 
    1
  1. Abian, O., V. Grazu, J. Hermoso, R. Gonzalez, J. L. Garcia, R. Fernandez-Lafuente, and J. M. Guisan. 2004. Stabilization of penicillin G acylase from Escherichia coli: site-directed mutagenesis of the protein surface to increase multipoint covalent attachment. Appl. Environ. Microbiol. 70:1249-1251.[Abstract/Free Full Text]
  2. 2
  3. Alkema, W. B. L., A. J. Dijkhuis, E. de Vries, and D. B. Janssen. 2002. The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase. Eur. J. Biochem. 269:2093-2100.[Medline]
  4. 3
  5. Alkema, W. B. L., C. M. H. Hensgens, E. H. Kroezinga, E. de Vries, R. Floris, J. M. van der Laan, B. W. Dijkstra, and D. B. Janssen. 2000. Characterization of the beta-lactam binding site of penicillin acylase of Escherichia coli by structural and site-directed mutagenesis studies. Protein Eng. 13:857-863.[Abstract/Free Full Text]
  6. 4
  7. Alkema, W. B. L., A. K. Prins, E. de Vries, and D. B. Janssen. 2002. Role of alpha Arg(145) and beta Arg(263) in the active site of penicillin acylase of Escherichia coli. Biochem. J. 365:303-309.[CrossRef][Medline]
  8. 5
  9. Alvaro, G., R. Fernandez-Lafuente, R. M. Blanco, and J. M. Guisan. 1990. Immobilization-stabilization of penicillin G acylase from Escherichia coli. Appl. Biochem. Biotechnol. 26:181-195.[Medline]
  10. 6
  11. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline]
  12. 7
  13. Bruggink, A., E. C. Roos, and E. de Vroom. 1998. Penicillin acylase in the industrial production of beta-lactam antibiotics. Organic Process Res. Dev. 2:128-133.[CrossRef]
  14. 8
  15. DeLeon, A., E. Galindo, and O. T. Ramirez. 1996. A postfermentative stage improves penicillin acylase production by a recombinant E. coli. Biotechnol. Lett. 18:927-932.[CrossRef]
  16. 9
  17. Done, S. H., J. A. Brannigan, P. C. E. Moody, and R. E. Hubbard. 1998. Ligand-induced conformational change in penicillin acylase. J. Mol. Biol. 284:463-475.[CrossRef][Medline]
  18. 10
  19. Durckheimer, W., J. Blumbach, R. Lattrell, and K. H. Scheunemann. 1985. Recent developments in the field of beta-lactam antibiotics. Angew. Chem. Int. Ed. English 24:180-202.[CrossRef]
  20. 11
  21. Fuganti, C., C. M. Rosell, R. Rigoni, S. Servi, A. Tagliani, and M. Terreni. 1992. Penicillin acylase mediated synthesis of formyl cefamandole. Biotechnol. Lett. 14:543-546.[CrossRef]
  22. 12
  23. Guisán, J. M., R. M. Blanco, R. Fernández-Lafuente, C. M. Rosell, G. Alvaro, and A. Bastida. 1993. Enzyme stabilization by multipoint covalent attachment to activated pre-existing supports, p. 55-62. In W. J. J. van den Tweel, A. Harder, and R. M. Buitelaar (ed.), Protein stability and stabilization of enzymes. Elsevier Science Publishers, Amsterdam, The Netherlands.
  24. 13
  25. Hewitt, L., V. Kasche, K. Lummer, R. J. Lewis, G. N. Murshudov, C. S. Verma, G. G. Dodson, and K. S. Wilson. 2000. Structure of a slow processing precursor penicillin acylase from Escherichia coli reveals the linker peptide blocking the active-site cleft. J. Mol. Biol. 302:887-898.[CrossRef][Medline]
  26. 14
  27. Huang, W., J. Q. Wang, D. Bhattacharyya, and L. G. Bachas. 1997. Improving the activity of immobilized subtilisin by site-specific attachment to surfaces. Anal. Chem. 69:4601-4607.[Medline]
  28. 15
  29. Jùstiz, H. O., R. Fernàndez-Lafuente, J. M. Guisàn, P. Negri, G. Pagani, M. Pregnolato, and M. Terreni. 1997. One-pot chemoenzymatic synthesis of 3'-functionalized cephalosporines (cefazolin) by three consecutive biotransformations in fully aqueous medium. J. Org. Chem. 62:9099-9106.[CrossRef]
  30. 16
  31. Kasche, V. 1986. Mechanism and yields in enzyme catalyzed equilibrium and kinetically controlled synthesis of beta-lactam antibiotics, peptides and other condensation products. Enzyme Microb. Technol. 8:4-16.
  32. 17
  33. Kostadinov, M., A. Nikolov, N. Tsoneva, and N. Petkov. 1992. New tetrazole-1-acetic acid-esters for enzymatic-synthesis of cefazolin. Appl. Biochem. Biotechnol. 33:177-182.
  34. 18
  35. Radoja, S., O. Francetic, N. Stojicevic, I. Moric, V. Glisin, and M. Konstantinovic. 1999. DNA region responsible for transcriptional regulation of the Escherichia coli penicillin amidase (pac) gene by CRP and PAA. Genet. Anal. 15:235-238.[Medline]
  36. 19
  37. Sriubolmas, N., W. Panbangred, S. Sriurairatana, and V. Meevootisom. 1997. Localization and characterization of inclusion bodies in recombinant Escherichia coli cells overproducing penicillin G acylase. Appl. Microbiol. Biotechnol. 47:373-378.[CrossRef][Medline]
  38. 20
  39. Terreni, M., G. Pagani, D. Ubiali, R. Fernandez-Lafuente, C. Mateo, and J. M. Guisan. 2001. Modulation of penicillin acylase properties via immobilization techniques: one-pot chemoenzymatic synthesis of cephamandole from cephalosporin C. Bioorg. Med. Chem. Lett. 11:2429-2432.[CrossRef][Medline]
  40. 21
  41. Youshko, M. I., G. G. Chilov, T. A. Shcherbakova, and V. K. Svedas. 2002. Quantitative characterization of the nucleophile reactivity in penicillin acylase-catalyzed acyl transfer reactions. Biochim. Biophys. Acta 1599:134-140.[Medline]


Applied and Environmental Microbiology, December 2005, p. 8937-8940, Vol. 71, No. 12
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.12.8937-8940.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scaramozzino, F.
Right arrow Articles by Albertini, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scaramozzino, F.
Right arrow Articles by Albertini, A. M.
Agricola
Right arrow Articles by Scaramozzino, F.
Right arrow Articles by Albertini, A. M.