Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dal, S. Articles by Gerischer, U. Search for Related Content PubMed PubMed Citation Articles by Dal, S. Articles by Gerischer, U. Agricola Articles by Dal, S. Articles by Gerischer, U.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, February 2005, p. 1025-1034, Vol. 71, No. 2
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.2.1025-1034.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Transcriptional Organization of Genes for Protocatechuate and Quinate Degradation from Acinetobacter sp. Strain ADP1

Süreyya Dal,¹ Gaby Trautwein,^1, and Ulrike Gerischer^1*

Microbiology and Biotechnology, University of Ulm, Ulm, Germany¹

Received 17 June 2004/ Accepted 12 September 2004

Top Abstract Introduction Materials and Methods Results Discussion References

 
Quinate and protocatechuate are both abundant plant products and can serve, along with a large number of other aromatic or hydroaromatic compounds, as growth substrates for Acinetobacter sp. strain ADP1. The respective genes are part of the chromosomal dca-pca-qui-pob-hca cluster encoding these pathways. The adjacent pca and qui gene clusters, which encode enzymes for protocatechuate breakdown via the ß-ketoadipate pathway and for the conversion of quinate or shikimate to protocatechuate, respectively, have the same direction of transcription and are both expressed inducibly in response to protocatechuate. The pca genes are governed by the transcriptional activator-repressor PcaU. The mechanism governing qui gene expression was previously unknown. Here we report data suggesting the existence of a large 14-kb primary transcript covering the pca and qui genes. The area between the pca and qui genes contains no promoter activity, whereas a weak, constitutive promoter was identified upstream of quiA (quiAp). The 5' end of the quiA transcript was mapped. Northern blot analysis allowed the identification of a 12-kb transcript spanning pcaI to quiX. An analysis of the pca and qui gene transcripts in a strain missing the structural gene promoter pcaIp led to the identification of two pcaIp-independent transcripts (4 and 2.4 kb). The 2.4-kb transcript makes up about 25% of the total transcript abundance of quiA, and thus the majority of transcription of the last gene of the area is also driven by pcaIp. This report strongly supports the organization of the pca and qui genes as a pca-qui operon and, furthermore, suggests that PcaU is the regulator governing its expression.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The utilization of aromatic carbon sources by Acinetobacter occurs through the ß-ketoadipate pathway (20). This branched pathway uses two central starting compounds (protocatechuate and catechol) to funnel a large number of different aromatic or hydroaromatic monomers into the catabolic reaction sequence. One such compound is quinate, an abundant plant product (21). A set of three reactions leads to the formation of protocatechuate from either quinate or shikimate (Fig. 1) (36, 38). The genes for these three enzymes (qui genes) (Fig. 2) have been characterized along with a gene that probably encodes a porin (10, 11). Together with the adjacent pca genes (Fig. 2) encoding all of the enzymes for protocatechuate conversion into succinyl-coenzyme A (CoA) and acetyl-CoA, they are part of the dca-pca-qui-pob-hca chromosomal cluster of genes and have coding capacity for the catabolic conversion of several plant products (dicarboxylic acids, protocatechuate, quinate, p-hydroxybenzoate, and hydroxycinnamates), all of which, with the exception of the dicarboxylic acids, are channeled into the ß-ketoadipate pathway (25, 30, 35). All 13 genes of the pca and qui gene cluster are transcribed in the same direction, with the exception of the regulator gene pcaU (15). The regulation of protocatechuate degradation as well as quinate utilization was studied thoroughly decades ago, and the induction of both enzyme sets by protocatechuate has been shown (6, 39). More recently, the transcriptional regulator PcaU has been described as a bifunctional activator-repressor for the pca genes, causing the induction of gene expression in the presence of protocatechuate and lowering the basal level of expression in the absence of an added aromatic carbon source. The promoter pcaIp, located upstream of the first structural gene, pcaI, was described previously with regard to its location as well as its regulation (37). The dca-pca-qui-pob-hca chromosomal region did not contain a gene that could be assigned a regulatory function for the expression of the qui genes. Since the regulatory pattern of qui gene expression resembles that of pca gene expression, it was reasonable to assume a function of PcaU for both gene clusters. In addition, the adjacent location of both clusters, with the same direction of transcription for all genes, would allow the expression of both clusters to originate from the promoter pcaIp, located upstream of the first pca structural gene. Another possibility was self-transcription initiation of the qui genes dependent either on PcaU or on an unidentified regulator protein with dependence on protocatechuate. This possibility was supported by a hypothetical rho-independent terminator structure downstream of pcaG, the last pca gene, and a comparatively extended intergenic region between pcaG and quiB (117 bp). An indication for an additional promoter upstream of quiA stemmed from an investigation of the qui genes (11). A mutant of Acinetobacter sp. strain ADP1 with a transcriptional terminator interrupting the quiX gene was still able to grow with the substrate quinate. Up to now, the mechanism leading to qui gene expression has not been studied.

View larger version (21K): [in this window] [in a new window]

FIG. 1. Catabolic reactions catalyzed by the pca and qui gene products (arrows with filled arrowheads). The biosynthetic reactions of the pathway leading to the formation of the aromatic amino acids are shown with arrows with empty arrowheads. QuiA, quinate/shikimate dehydrogenase; QuiB, dehydroquinate dehydratase; QuiC, dehydroshikimate dehydratase.

View larger version (17K): [in this window] [in a new window]

FIG. 2. pca-qui gene region of Acinetobacter sp. strain ADP1. Black bars underneath the scheme represent hybridization probes. The results of the Northern blot experiments are summarized in the lower part of the figure. Arrows represent the largest transcripts detected with the probes indicated. Dotted lines show the possible locations of transcripts if they are ambiguous. The locations of the transcripts in this figure were determined (i) by the limits of the gene cluster (pcaI through quiA) and (ii) by the need to overlap the hybridization probes. Transcripts detected in both strain ADP1 and strain ADPU1 (pcaIp) are shown with thick, dotted lines, and the respective sizes are circled.

Here we describe an investigation of the pca and qui transcripts in the wild type as well as in a strain missing the promoter pcaIp. We show that this promoter is mainly responsible for the expression of both gene clusters. The data indicate that the pca and qui genes form a large transcriptional unit. In addition, we describe a second promoter upstream of quiA, quiAp, that drives the low and constitutive expression of quiA.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Bacterial strains, plasmids, and growth conditions.
The bacterial strains used for this investigation are listed in Table 1. Strains of Acinetobacter sp. were grown with good aeration on mineral medium at 30°C as previously described (37). The carbon sources used were succinate (10 mM), pyruvate (20 mM), p-hydroxybenzoate (5 mM), and quinate (5 mM) (the concentrations refer to final concentrations in the medium). Protocatechuate was added as an inducer at a final concentration of 2 mM. For Northern blot experiments, cells were precultivated in pyruvate medium and used to inoculate 60 ml of the same medium. The inducer was added during the early exponential growth phase.

View this table: [in this window] [in a new window]

TABLE 1. Bacterial strains and plasmids used for this study

Genetic modification of Acinetobacter by natural transformation.
For transformations, Acinetobacter strains were grown in 5 ml of mineral medium with succinate overnight. After the addition of 10 µl of 1 M succinate and additional growth for 30 min, 50 µl of the culture was transferred onto a polycarbonate filter (Costar Nuclepore, Cambridge, Mass.) placed on a nonselective plate together with 1 µg of linearized plasmid DNA or a purified DNA fragment. After incubating for 5 to 6 h at 37°C, the cells were washed off the filter and spread on a nonselective or selective plate.

Introduction of plasmids into Acinetobacter.
Plasmids were introduced into Acinetobacter by conjugation from Escherichia coli S17-1 by a procedure similar to that described above for transformation. Overnight cultures of donor and recipient were washed with mineral medium without a carbon source, mixed at a ratio of 1:4, and placed on the membrane. After conjugation, selection pressure was applied for resistance to appropriate antibiotics on a plate with mineral medium for Acinetobacter, which did not allow the growth of E. coli (33).

Strain and plasmid construction.
For the construction of strain ADPU1, plasmid pAC25 was made by deleting a 220-bp SwaI-Eco47III fragment from plasmid pZR18, which contained the structural pca gene promoter pcaIp (Fig. 3). The insert was separated from the vector by digestion with BamHI and HindIII and was used to transform Acinetobacter sp. strain ADP1. The transformation mix was plated on a nonselective plate (succinate mineral medium), and colonies were picked on p-hydroxybenzoate mineral medium. Lack of growth on this medium indicated candidates for the respective strain (1 in 400), and the correct establishment of the 220-bp deletion was confirmed by (i) transformation with plasmid pZR18 to reestablish the wild-type phenotype (growth on p-hydroxybenzoate mineral medium) and (ii) PCR of the total DNA of the new strain by the use of primers AC7/4 (GAATAGATCAGTGATGTTTGGG) and AC7/U2 (TTTACCTTCTGCGAGTAAAGTG). Transferring the pcaH19 mutation from strain ADP6417 and the recA100::Tn5 mutation from plasmid pZR106 into strain ADP1 created strain ADPU7 as follows. A PCR with oligonucleotides primer9735 (ACGTGACCAGTTTGGTCGAC) and primer10979 (CATCAACAACGCACCACTTAG) amplified the chromosomal region containing pcaH19, and the resulting fragment was used to transform strain ADP1. The colonies from a nonselective plate were screened for the loss of the capability to grow on p-hydroxybenzoate. Strain ADPU2 was verified by (i) transformation back to the wild-type phenotype with a PCR fragment made from the wild type and (ii) PCR with the primers specified above for the creation of strain ADPU2. Subsequently, the recA gene of this strain was disrupted by transforming it with the EcoRI insert of plasmid pZR106, which contained a Tn5 insertion in the recA gene. Selection for kanamycin resistance allowed the identification of strain ADPU7. The inactivation of recA was necessary to allow the stable establishment of plasmids containing homologous DNAs. Strain ADPU18 was created from strain ADP500 by applying positive selection for the loss of protocatechuate 3,4-dioxygenase as described earlier (14). Mutants were screened for large deletions of the pca-qui-pob region as described previously. To confirm the deletion, we analyzed strain ADPU18 by Southern blot hybridization with (i) the 2,797-bp insert of plasmid pZR17 containing pcaU and (ii) a 1,523-bp XhoI-SacI fragment from plasmid pZR404 containing pobA. Neither of the two probes resulted in the detection of fragments in the DNA of the newly created strain ADPU18, whereas a control with chromosomal DNA from the wild type led to the detection of the expected fragments. Thus, strain ADPU18 contains a deletion of the complete pca-qui-pob area. The endpoints of the deletion have not been defined.

View larger version (14K): [in this window] [in a new window]

FIG. 3. Construction of Acinetobacter sp. strain ADPU1 with a deletion of promoter pcaIp. The small horizontal arrows indicate the three sequence repetitions of the PcaU binding site.

Plasmid pAC24 was made by cloning a 1,562-bp EcoRI-PstI fragment from pZR504, containing the intergenic region between pcaG and quiB, into the shuttle vector pRK415. A lacZ-Km^r reporter cassette from pKOK6 was cloned with PstI downstream of this region (Fig. 4). For the construction of plasmid pAC25, plasmid pZR18 was cleaved with SwaI and Eco47III. Religation of the large fragment led to the creation of plasmid pAC25, with a 220-bp deletion containing pcaIp. Plasmid pAC27 was constructed by cloning a 2,318-bp EcoRI-PstI fragment from pZR504, containing the quiX-quiA intergenic region, into the shuttle vector pRK415. A lacZ-Km^r reporter cassette from pKOK6 was cloned with PstI downstream of this region (Fig. 4). Plasmid pAC43 contained the same intergenic region on a smaller, 841-bp NsiI-HindIII fragment (Fig. 4). For its construction, a 994-bp NsiI fragment was cloned into the PstI site of pRK415. A lacZ-Gm^r cassette from pAB2001 was inserted downstream of the intergenic region by the use of HindIII, thus shortening the Acinetobacter DNA to 841 bp. The reporter cassette from plasmid pAB2001 generally revealed much lower ß-galactosidase activity than the cassette from plasmid pKOK6 (by a factor of 10 to 100, depending on the location of the fusion on a plasmid or on the chromosome). It was used because of its extended multiple cloning sites.

View larger version (17K): [in this window] [in a new window]

FIG. 4. Reporter gene constructs to screen for promoter activity in the pcaG-quiB region and the quiX-quiA region.

Northern blot analysis.
Cells for RNA isolation were withdrawn from the culture, harvested, and frozen in liquid nitrogen within a maximum time of 60 s to minimize changes of the transcript appearance after sample withdrawal. Total RNAs were isolated by the hot phenol method as described previously (13). Depending on the optical density of the sample, 1.5 to 20 µg of RNA was isolated per ml of cell suspension. RNAs (10 µg of each) were denatured by adding 0.25 volume of 5x loading buffer (8 mM EDTA, 7.2% [vol/vol] formaldehyde [37%], 20% [vol/vol] glycerol, 30.8% [vol/vol] formamide, 80 mM 3-[N-morpholino]propanesulfonic acid [MOPS; pH 7.0], 20 mM sodium acetate, 0.16% [vol/vol] saturated aqueous bromophenol blue solution) and were separated according to size in a 1.2% formaldehyde gel (1.2% [wt/vol] agarose, 20 mM MOPS [pH 7.0], 5 mM sodium acetate, 1 mM EDTA, 1.8% [vol/vol] formaldehyde [37%], 0.1 µg of ethidium bromide/ml). The running buffer had the same composition except for the agarose and the ethidium bromide. The size standard used was a 0.24- to 9.5-kb RNA ladder (Life Technologies, Karlsruhe, Germany). The RNAs were blotted onto nylon membranes (Hybond N⁺; Amersham Biosciences, Freiburg, Germany) according to the manufacturer's instructions.

The probes used for hybridization were DNA restriction fragments prepared as follows. A 552-bp NcoI-MluI fragment from plasmid pZR18 (pcaU), a 640-bp Eco47III fragment from plasmid pZR9 (pcaI), a 397-bp NsiI fragment from plasmid pZR2 (pcaC and -H), a 1,522-bp NsiI fragment from plasmid pZR504 (quiC and -X), and a 442-bp HpaI fragment from plasmid pZR504 (quiA) were isolated by horizontal agarose gel electrophoresis followed by gel extraction by the use of Nucleo Trap (Machery-Nagel, Düren, Germany). The fragments were used as templates to prepare radioactive probes with a random primer DNA labeling system (Life Technologies). Separation from unincorporated nucleotides was done by the use of MicroSpin G-25 columns (Amersham Biosciences). Hybridization was performed as described earlier (13). To ensure that equal amounts of total RNA were used in each lane, we rehybridized each membrane to a 16S rRNA probe after the signal of the first hybridization had decayed for at least 5 months. The probe (731 bp) was generated by whole-cell PCR with cells of Acinetobacter sp. strain ADP1 by the use of primers 16SrRNA2 (AGCTGACGACAGCCATGC) and 16SrRNA1 (GTCTGAGAGGATGATCCG). Quantification of the resulting 16S rRNA band revealed a good agreement of the relative abundance of this stable RNA with the amount of total RNA applied to the lanes, based on determinations of the absorbance at 260 nm (the deviation was not higher than 10%). For signal detection, a Fujix BAS 1000 bioimager (Fuji Photo Film Co., Ltd., Tokyo, Japan) was used. Quantitative analysis was done with MacBAS software (Fuji Photo Film Co., Ltd.).

Reverse transcriptase PCR.
Total RNAs were isolated as described above. Reverse transcriptase reactions were performed with Ready-To-Go RT-PCR beads (Amersham Biosciences) according to the manufacturer's instructions. The primers were primer9735 (ACGTGACCAGTTTGGTCGAC) and primer10979 (CATCAACAACGCACCACTTAG) for the pcaG-quiB intergenic region (resulting in a 1,244-bp fragment including the last 472 bp of pcaH and the first 9 bp of quiA) and quiX-14542 (CTATCAATGGTCTCCAG) and quiA-15580 (TTTCCAGAGTCTGCATC) for the quiX-quiA intergenic region (resulting in a 1,038-bp fragment including the last 121 bp of quiX and the first 713 bp of quiA). Controls for the absence of DNA in the RNA preparations were always included by performing a PCR with the RNA.

Primer extension analysis.
A primer extension procedure that was described earlier was applied, with the modification that the primer (quiA-14844 [GTGAGACTTTTCTTGAGGG]) contained a fluorescent label (IRD800) and was purchased from MWG Biotech (Ebersberg, Germany). The sequencing reaction serving as a size standard was produced with the same oligonucleotide and the template pZR504 by use of a SequiTherm EXEL II LC DNA sequencing kit (Epicentre, Madison, Wis.). An automated sequencer (LI-COR 4000L; MWG Biotech) was used for gel separation and data collection.

Determination of ß-galactosidase activity.
The protocol described by Miller was used for determinations of ß-galactosidase activity (27). Cells were permeabilized with chloroform and sodium dodecyl sulfate. The standard deviation for replicate assays from the same sample was no more than 2%. The standard deviations between different cultures (same strain and same conditions) were up to 15%.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Transcriptional readthrough between the pca and the qui genes and between quiX and quiA.
The 117-bp area between pcaG and quiB (Fig. 2) likely represents the border between two operons if the pca genes and the qui genes are separate transcriptional units. This possibility is supported by a potential rho-independent terminator sequence (stem-loop positions 10 to 50 after the stop codon followed by four thymidine base pairs). The quiA gene is preceded by an intergenic region of 205 bp (Fig. 2). It was shown earlier to be expressed independently, at least in part (11). To analyze if there is transcriptional readthrough between pcaG and quiB and between quiX and quiA, we applied reverse transcriptase PCR to these two areas. RNAs were isolated from Acinetobacter sp. strain ADP1 after growth on pyruvate, a carbon source that does not induce the expression of the pca or qui genes, as well as after induction of the pca and qui genes with 2 mM protocatechuate. Reverse transcriptase PCR was applied by using two primer pairs covering the pcaG-quiB and quiX-quiA intergenic regions (see Materials and Methods). Under either condition, we detected a PCR product of the expected size (data not shown). This result shows that there is transcriptional readthrough in both areas covered by the choice of primers for reverse transcriptase PCRs. We cannot determine from our results whether a part of the transcriptional activity is terminated or whether the initiation of transcription takes place in these areas. In addition, transcription was detectable under both inducing and noninducing conditions; thus, there is transcription covering both areas even in the absence of induction. Due to the high sensitivity of the experiment, this would be expected considering the relatively high basal level of transcription at the structural gene promoter pcaIp upstream of the pca genes (37), provided that this promoter directs transcription of the complete pca-qui area.

Promoter search upstream of quiB and of quiA.
The two intergenic regions, pcaG-quiB and quiX-quiA, that were investigated for transcriptional readthrough as described above were analyzed for promoter activity. For this analysis, the respective fragments were cloned upstream of promoterless lacZ cassettes encoding ß-galactosidase, with the shuttle plasmid pRK415 as a vector (Fig. 4). After the introduction of the plasmids into Acinetobacter sp. strain ADP197, the determination of ß-galactosidase activity allowed the identification of promoter activity on the cloned DNAs (Table 2). The area covering the pcaG-quiB intergenic region had no detectable reporter gene activity. In contrast, a 2,318-bp fragment containing quiX and quiA displayed significant ß-galactosidase activity under inducing (growth in the presence of p-hydroxybenzoate and quinate) as well as noninducing (growth in the presence of succinate) conditions, indicating the presence of promoter activity on this fragment. The activity was slightly higher (1.6-fold) than the activity of the structural gene promoter pcaIp under noninducing conditions measured in the same system (plasmid pAC17) (Table 2). To decrease the size of the analyzed fragment, we cloned an 814-bp fragment, resulting in a 3.5-fold higher ß-galactosidase activity than the pcaIp-directed activity without induction (plasmid pAC43) (data not shown). Thus, we found that the region upstream of quiB does not contain any promoter activity, whereas in the area upstream of quiA (narrowed down to an 814-bp region), there is a moderate promoter activity which does not respond to protocatechuate (the inducer of pcaIp), as shown by the use of quinate as a carbon source (which is metabolized via protocatechuate). Furthermore, the introduction of pAC27 into a strain of Acinetobacter with a dysfunctional protocatechuate 3,4-dioxygenase (strain ADPU7) revealed similar ß-galactosidase activities. A promoter dependent on protocatechuate was highly induced under these conditions, as observed for pcaIp (unpublished results), due to the accumulation of protocatechuate in this strain in the absence of an aromatic growth substrate. This internal inducer accumulation has been explained by an overlap of quinate catabolism and the biosynthetic pathway for the aromatic amino acids (Fig. 1) (40). Dehydroshikimate, an intermediate of both pathways, is converted into protocatechuate by the action of QuiC. This is obvious only in the absence of protocatechuate dioxygenase, which in the wild type channels the intermediate into the catabolic pathway (6). Finally, an analysis of pAC27 in strain ADPU331, which contains a dysfunctional PcaU protein (the transcriptional regulator of the pca genes), revealed an activity similar to that in ADP197 (data not shown). The promoter activity upstream of quiA is therefore independent of protocatechuate as well as of PcaU and is probably constitutive.

View this table: [in this window] [in a new window]

TABLE 2. ß-Galactosidase activity directed by fragments of the pca-qui gene region

5' end of quiA transcript.
Based on the finding of promoter activity in the quiX-quiA region, we expected the presence of a transcriptional start site upstream of quiA. We performed primer extension analysis with a primer directed against the area directly upstream of the quiA coding sequence (quiA-14844; positions 25 to 7 upstream of the quiA start codon). A signal was detected that corresponded to a 5' mRNA end located 43 bases upstream of the beginning of the quiA gene (Fig. 5). The primer extension signal was present in total RNAs from cells grown on quinate as well as in RNAs from cells grown on succinate, reflecting the independence of this transcript from the carbon source, as observed earlier for promoter activity (see above). A potential promoter sequence was identified upstream of this position which had partial identity to the E. coli consensus promoter sequence (29) (Fig. 5). In addition, two pairs of inverted sequence repetitions are located in the 205-bp intergenic region between quiX and quiA. Their functions can only be discussed hypothetically (see Discussion).

View larger version (38K): [in this window] [in a new window]

FIG. 5. Primer extension analysis upstream of quiA. Results are shown for an experiment performed with primer quiA-14844 and 10 µg of total RNA from Acinetobacter sp. strain ADP1 grown on quinate (lanes 1 and 2) or succinate (lane 3); the sequence ladder was created by using the same primer. The position of the 5' end of the transcript is labeled +1 in the sequence, which was converted to the complementary strand (A). (B) Area upstream of quiA. Two palindromic sequence repetitions upstream of the determined 5' end of the quiA transcript are indicated by horizontal arrows. A potential promoter sequence is indicated and compared with the consensus E. coli promoter sequence.

Transcripts within the pca-qui gene cluster.
Northern blot analyses with a pcaI probe and two qui gene probes (quiX and quiA) were used to determine the sizes of the largest detectable transcripts formed within the pca-qui gene area. The RNAs used for these Northern blot analyses were prepared from cells of Acinetobacter sp. strain ADP1 growing on mineral medium with 20 mM pyruvate. Each membrane contained a lane with RNAs from strain ADPU18 grown on pyruvate and protocatechuate as a control for the specificity of the signals. No signal was observed in these lanes with either probe, except for the quiX probe, which caused faint bands in the area of the rRNA (data not shown). Pyruvate was chosen because it is known to be a neutral carbon source with respect to carbon catabolite repression of the pca genes (7). Samples for RNA isolation were withdrawn throughout cell growth. After the first sample was taken, the aromatic substrate protocatechuate was added (final concentration, 2 mM), leading to induction of the pca and qui genes (37, 39). This carbon source combination was chosen rather than protocatechuate alone because the data were going to be compared to data from strain ADPU1, which does not grow on protocatechuate alone, as described below. Five samples from each culture were hybridized with each probe. Each pca or qui probe was hybridized to a freshly made membrane. Faint signals were obtained before the addition of protocatechuate, whereas strong signals were present 15 min after the addition of protocatechuate, reflecting the induction of expression by protocatechuate. One hundred thirty-five minutes after the addition of protocatechuate, the signal was almost completely gone, indicating that the bacteria had metabolized the aromatic substrate. As a consequence of the missing inducer, transcription had stopped and the existing transcripts had been degraded (shown for the quiX probe in Fig. 6). Similar results were obtained with the other probes. The samples with the strongest signal patterns for each growth curve (which were always the samples from 15 min after the protocatechuate addition) are shown in Fig. 7A. Probing with the 5'-proximal gene of the cluster, pcaI, resulted in the detection of a wide range of transcripts, likely due to ongoing synthesis and processing or degradation. Distinct bands of large sizes (7, 9, 10, and 12 kb) were visible, indicating the presence of a full-length transcript from the structural gene promoter upstream of pcaI, pcaIp, at least through quiX (Fig. 2). It cannot be excluded that the primary transcript is longer (includes the quiA gene) and is subsequently processed. The quiX and quiA probes detect transcripts of various lengths up to 9 kb. The fact that these probes did not detect the 12-kb transcript visible with the pcaI probe was most likely due to the experimental challenge of detecting large bacterial transcripts, which has also been described by other authors (3). The strongest signal obtained with the quiA probe was a 2.4-kb signal which, in contrast to signals of a similar size detected by the other probes, persisted after the deletion of the structural gene promoter pcaIp, as described below. It was located in the area where the 23S rRNA migrates, but since there was no signal from the RNA of a pca qui pob control strain, we consider this signal specific. Its appearance was different from the dark surrounding of the rRNA encountered in cases in which RNA molecules targeted by the probe were pushed away from the far more abundant rRNA (compare with Fig. 7, lane 1, probed with pcaI). It corresponded closely to the size of the quiA gene (2,397 bp). In summary, it can be concluded from these experiments that there is uninterrupted transcription of the pcaIJFBDKCHG and quiBCX genes that is detectable with one of the probes. Smaller transcripts may be primary transcripts or processing products.

View larger version (87K): [in this window] [in a new window]

FIG. 6. Transcripts from Acinetobacter sp. strain ADP1 detected with a quiX DNA probe by Northern blot analysis of total RNA (10 µg per lane). (A) Growth curve of culture in mineral medium with 20 mM pyruvate. The arrow indicates the addition of the inducer (2 mM protocatechuate). (B) Results of hybridization. Lane numbers correspond to sample numbers, and transcript sizes are given in kilobases. Arrows with empty arrowheads indicate the positions of the 16S and 23S rRNA.

View larger version (25K): [in this window] [in a new window]

FIG. 7. Northern blot analysis of the pca-qui gene area. Samples were withdrawn during exponential growth from cultures grown in mineral medium with pyruvate 15 min after the addition of the inducer (2 mM protocatechuate) and were hybridized with the indicated probes. Results are shown for analyses of Acinetobacter sp. strain ADP1 (wild type) (A) and strain ADPU1 (pcaIp) (B) All samples for each strain were taken from the same culture. The appearance of the signal was adjusted (for brightness and contrast) for the best recognition of the bands and does not represent quantitative relationships. Transcript sizes are given in kilobases. Arrows with empty arrowheads indicate the positions of the 16S and 23S rRNA.

Transcription of the pca and qui genes in the absence of the promoter pcaIp.
The promoter pcaIp is located upstream of the first gene of the pca-qui gene cluster and has been characterized as being strongly regulated by the bifunctional activator-repressor protein PcaU in concert with the inducer protocatechuate (15, 37). To analyze the relevance of promoter pcaIp in the expression of the pca and qui genes in terms of quantity as well as quality, we created strain ADPU1, which has a 220-bp deletion that eliminates pcaIp (Fig. 3). Since the mutation also deleted the pcaIp-proximal 10-bp repetition of the PcaU binding site (which consists of three such repeated sequences [31]) and since PcaU is governed by a strong autoregulation, it was unclear if the regulator PcaU could be expressed. Since the potential additional promoters might also be PcaU dependent, we tested strain ADPU1 for pcaU expression by Northern blot hybridization. After growth on 10 mM succinate plus 2 mM p-hydroxybenzoate, the strain showed a level of the pcaU transcript that was comparable to the wild-type level, confirming the functional expression of pcaU (data not shown). Strain ADPU1 was analyzed in Northern blot experiments with probes for pcaC, pcaH, quiX, and quiA in direct comparison with the wild type (same culture conditions, blotting of RNA samples of the wild type and the mutant on the same membrane, and hybridization in the same solution). No signal was detected with the probe for pcaC and pcaH (data not shown). The quiX probe hybridized to a weak 4-kb transcript, which was also detected from wild-type RNAs. None of the other bands detected from wild-type RNAs with the quiX probe were present in RNAs from strain ADPU1. If the 4-kb transcript was a primary transcript, then its promoter must be located in the area between pcaG and quiC. A weak 4-kb transcript was also detected with the quiA probe (in RNAs from the wild type as well as from the mutant). Thus, the 4-kb transcript hybridizing to quiX and quiA may be the same transcript covering quiX and quiA. A strong signal was found with the quiA probe at 2.4 kb, and this band had also been detected from wild-type RNAs. None of the other transcripts hybridizing to the quiA probe from the wild-type RNAs were present for the mutant RNAs.

We compared signal intensities between the wild type and the pcaIp deletion strain. For this comparison, the wild type and the mutant were blotted onto the same membrane and hybridized in the same solution. Subsequent hybridization with a 16S rRNA probe and quantification of the signal ensured that constant levels of RNA were analyzed. The total signal in the lane, corrected for the background, was counted. For each culture, the probe with the highest transcript level was used. When we applied the quiX probe, the mutant had 6% of the wild-type signal. With the quiA probe, the mutant expressed 25% of the wild-type level. Based on this quantitative analysis and on the observation of transcriptional readthrough between quiX and quiA (described above), it can be postulated that the pcaIp promoter is the main promoter for the complete 14-kbp pca-qui gene region. According to this analysis, most of the quiA transcripts (75%) were initiated from this promoter. pcaIp-independent transcriptional activity at two promoters, one of which was the newly described promoter upstream of quiA, contributed significantly to the total transcript abundance covering this area (25%). Considering the fact that the quiA promoter is comparatively weak (1.5% of the activity of fully induced pcaIp), it may reach the high level of 25% due to increased transcript stability.

Transcription of pca and qui genes in the absence of the regulator PcaU.
PcaU governs the expression of the pca genes (15, 37). Deletion of the pcaU gene leads to (i) independence of the inducer protocatechuate and (ii) an increased (threefold) basal level of expression. The effect of PcaU on the expression of the qui genes has not been investigated previously. In contrast, the role of protocatechuate as an inducer of the enzymes for quinate and shikimate catabolism has long been established (39). Since both the pca genes and the qui genes are induced by protocatechuate, it is likely that both are regulated by PcaU. Furthermore, their location on the chromosome would allow their combined transcription and regulation. Evidence for a large primary transcript covering both gene regions was presented above. We next analyzed the consequence of a deletion of the pcaU gene on transcript formation in the pca-qui gene cluster. Therefore, strain ADP331, containing a deletion of two-thirds of the pcaU gene, was used in Northern blot experiments as described above for the wild type. The appearance of transcripts after hybridization with the quiX and quiA probes was the same as that shown for the wild type in Fig. 7, with the difference that the mRNAs were much less abundant and were present at all stages of growth independent of the presence of an inducer (data not shown). With the pcaC and pcaH probe, the transcript was present at a level of 8% that of the induced wild type. This relatively high measurement is consistent with previously described observations, namely, the repressor function of PcaU (37). Using the quiX probe, we obtained slightly increased RNA levels in strain ADP331 (14% of the induced wild-type level). The increase compared to the result obtained with the pcaC and pcaH probe can be explained by the low-level pcaIp-independent transcriptional initiation of pcaG and quiC described above. The use of the quiA probe for strain ADP331 resulted in a transcript level of 25% of the induced wild-type level, which was comparable to the data obtained with the pcaIp-negative strain. This finding supports the presence of a constitutive promoter upstream of quiA.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The nine genes for the conversion of protocatechuate to succinyl-CoA and acetyl-CoA (pca genes) and the adjacent qui genes encoding enzymes for the funneling of the hydroaromatic compounds quinate and shikimate into the protocatechuate branch of the pathway have the potential to form a large operon. In addition to the physical neighborhood of the gene clusters on the chromosome and their affiliation with the same degradative pathway, they are also connected by a common regulatory pattern. The expression of both clusters is (i) induced by protocatechuate and (ii) repressed by catabolite repression (6, 10, 12, 37, 39). The understanding of the pca and qui gene products as a regulatory block was established long before the onset of genetic analysis of the organism by thorough analyses of mutant strains (5, 39). In particular, the highly elevated synthesis of enzymes of the protocatechuate block as well as the quinate block in strains with a dysfunctional protocatechuate 3,4-dioxygenase and, furthermore, the subsequent finding of secondary mutant strains that completely removed the elevated expression prompted the hypothesis of a large operon with one regulator. The results presented here strongly support this hypothesis.

Northern blot analysis with a probe for the first of the pca genes, pcaI, revealed the existence of a transcript of approximately 12 kb. This corresponds to a transcript covering the area between the pcaU-pcaI regulatory region and quiX (Fig. 2). A quantitative comparison of the Northern blots of the pcaIp strain and the wild type indicated the presence of a full-length transcript including quiA. This potential pca-qui primary transcript has not been detected, most likely because of the extraordinary length of the transcript (14.4 kb) and its short lifetime. We did not measure transcript half-lives for this study, but it is obvious from our Northern blot experiments that the transcript is degraded quickly after the aromatic carbon source is used up (Fig. 6). Several distinct, smaller transcript bands which cannot be exactly located within the pca-qui area and which are probably processing products became visible with the pcaI probe as well as with the other probes (quiX and quiA), as deduced from the fact that most of these transcript bands were not present when we performed the same analysis with the pcaIp strain. The only exceptions were two transcripts located within the qui genes, namely, a 4-kb transcript found with the quiX and quiA probes and a 2.4-kb transcript detected only with the quiA probe. These two transcripts are present both in the wild type and in the pcaIp strain and must therefore have a promoter other than pcaIp. The weak 4-kb transcript must have a promoter between pcaG and quiC. The 2.4-kb transcript likely represents a transcript of the quiA gene (2,397 bp). This assumption is based on (i) the promoter activity found upstream of quiA, (ii) the observation of a 5' end of a transcript directly upstream of quiA, and (iii) the fact that it was not detected with the quiX probe in strain ADPU1. Considering the comparatively low activity of the quiA promoter, the low identity with the E. coli ⁷⁰ consensus promoter sequence makes sense. Promoters with a low activity generally have a recognition sequence that does not show a high similarity to the consensus sequence. The inverted sequence repetitions found upstream of this transcriptional start site may be stabilizing structures of the 12-kb transcript ending behind quiX (32). The newly described quiA promoter was found to be independent from the carbon source tested and therefore constitutive. This is in agreement with earlier data showing that the regulator of the pca genes, PcaU, does not bind to the DNA area upstream of quiA (unpublished observation).

A determination of the transcript abundance indicated that most of the transcripts formed under inducing conditions with the quiA probe (75%) are initiated at pcaIp. This observation further supports this promoter as the main promoter directing both the expression of the pca genes and that of the qui genes, forming a large 14-kbp primary transcript. At least two additional promoters within the qui genes contribute a small part of the overall transcript. Of these two, the newly identified quiA promoter makes the most contribution. It has a low activity which is in the range of the main promoter pcaIp without induction, but the observed quiA transcript is abundant and amounts to 25% of the total quiA transcript. This may be explained by a longer half-life of the quiA transcript.

Having described this situation, we were faced with the question of determining the need for this additional promoter. It is tempting to speculate that the independent quiA transcript is made to ensure a minimal level of the encoded enzyme, quinate dehydrogenase. The enzyme oxidizes both quinate and shikimate, to 5-dehydroquinate and 5-dehydroshikimate, respectively, by using pyrrolo-quinoline quinone as a cofactor (Fig. 1) (41). It feeds the electrons into the electron transport chain. For Acinetobacter calcoaceticus L.M.D. 79.41, cytochrome b-562 was shown to be the electron acceptor (9). The generated proton motive force allows a considerable contribution to the energy conservation of the cell or can be used for secondary transport processes such as the uptake of the aromatic substrates protocatechuate and p-hydroxybenzoate by PcaK and VanK, members of the major facilitator superfamily (8, 28, 41). Protocatechuate is the product of the sequential reaction of quinate dehydrogenase (QuiA), 5-dehydroquinate dehydratase (QuiB), and 5-dehydroshikimate dehydratase (QuiC). There is strong evidence that these reactions all take place in the periplasm and that the carbon source is then transported into the cell by PcaK and VanK, supported by the energy from quinate oxidation (8). This possibility is supported by the finding of a membrane association of quinate dehydrogenase and a potential leader sequence (39 amino acid residues) in the QuiB N terminus (1, 11). A constitutive level of the enzyme would ensure that these reactions can take place even before the inducer of both gene clusters, protocatechuate, can enter the cell.

Insights into the way that the qui genes are expressed are also relevant because the genes are induced by the product of the encoded pathway (and not by the substrate). Thus, a minimal level of the Qui proteins must be present even under noninducing conditions to allow the formation of the inducer molecule, a situation reminiscent of the induction process of the lac operon in E. coli. The expression of the pca genes has been shown to take place at a comparatively high level under noninducing conditions (37). Having established the transcript structure of the pca-qui operon as one large transcript, it can now be assumed that the basal level of qui gene expression is comparable to that of pca gene expression (assuming that the processing of the primary transcript does not cause strong imbalances in terms of transcript level between the 5'-located genes and the 3'-located genes). This basal level of pca-qui operon expression should be sufficient to allow efficient induction of the operon upon confrontation of the cells with quinate or shikimate. In addition, according to the finding that the Qui proteins are active in the periplasm, the transport of protocatechuate into the cell is required, and this activity is accomplished by PcaK and VanK. The pcaK gene, being part of the pca gene cluster (upstream of the qui genes), is likely to underlie the same expression pattern discussed above. The expression of vank is unknown.

Another aspect comes into play in the context discussed here. It is the old observation that strains of Acinetobacter with a dysfunctional protocatechuate-3,4-dioxygenase (PcaH and -G) show maximal induction of the pca and qui genes (6, 39). The generally accepted explanation for this phenomenon was that dehydroshikimate formed by enzymes of the biosynthetic pathway for the formation of the three aromatic amino acids is partially converted to protocatechuate. In the absence of the dioxygenase, protocatechuate accumulates to levels that are high enough to cause induction. The necessary precondition for this to happen is, again, a certain basal level of expression of the qui genes, which can now be understood as explained above. In addition, this scenario directs attention to a situation in which a catabolic pathway (the quinate degradative reactions) and an essential anabolic pathway (the biosynthetic reactions for the family of aromatic amino acids) potentially compete for a common intermediate (dehydroshikimate). It is unknown how the organism deals with this seemingly serious conflict. Aspergillus nidulans, being confronted with a similar situation, forms a biosynthetic multienzyme complex which channels the anabolic intermediates under physiologically significant conditions (26). In Acinetobacter, the location of the Qui proteins outside of the cytoplasm certainly presents a solution for the organism in terms of the potential pathway conflict described. On the other hand, the observation that a quiB deletion mutant grows (albeit extremely slowly) on quinate indicates that the catabolic and the biosynthetic pathways are not completely separated in this bacterium (11). The cytoplasmic biosynthetic dehydroquinate dehydratase (AroD) must complement the missing QuiB, the catabolic enzyme with identical activity. A complete physical separation also does not agree with the endogenous induction of the pca-qui operon. There are three possible explanations for this new situation: (i) there is a different source of protocatechuate besides the biosynthetic dehydroshikimate pool, (ii) other intermediates besides protocatechuate can cause PcaU-mediated induction, or (iii) the QuiC protein is not completely excreted into the membrane or periplasm but remains in the cytoplasm to some extent. Thus, our insights into the complex network of factors contributing to the control of gene expression of the newly established pca-qui operon have been extended, but the system still awaits experimental investigation for all of its details to be understood.

 
This work was supported by a grant from the Deutsche Forschungsgemeinschaft. S.D. was supported by a grant from the Deutscher Akademischer Austauschdienst.

The excellent technical assistance of Iris Steiner is appreciated.

 
* Corresponding author. Mailing address: Microbiology and Biotechnology, University of Ulm, 89069 Ulm, Germany. Phone: 49-731-5022715. Fax: 49-731-5022719. E-mail: ulrike.gerischer{at}biologie.uni-ulm.de.

Present address: Ratiopharm GmbH, 89079 Ulm, Germany.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Adachi, O., N. Yoshihara, S. Tanasupawat, H. Toyama, and K. Matsushita. 2003. Purification and characterization of membrane-bound quinoprotein quinate dehydrogenase. Biosci. Biotechnol. Biochem. 67:2115-2123.[CrossRef][Medline]
2
2. Averhoff, B., L. Gregg-Jolly, D. Elsemore, and L. N. Ornston. 1992. Genetic analysis of supraoperonic clustering by use of natural transformation in Acinetobacter calcoaceticus. J. Bacteriol. 174:200-204.[Abstract/Free Full Text]
3
3. Bausch, C., M. Ramsey, and T. Conway. 2004. Transcriptional organization and regulation of the L-idonic acid pathway (GntII system) in Escherichia coli. J. Bacteriol. 186:1388-1397.[Abstract/Free Full Text]
4
4. Becker, A., M. Schmidt, W. Jäger, and A. Pühler. 1995. New gentamicin-resistance and lacZ promoter-probe cassettes suitable for insertion mutagenesis and generation of transcriptional fusions. Gene 162:37-39.[CrossRef][Medline]
5
5. Cánovas, J. L., B. F. Johnson, and M. L. Wheelis. 1968. Regulation of the enzymes of the ß-ketoadipate pathway in Moraxella calcoacetica. 3. Effects of 3-hydroxy-4-methylbenzoate on the synthesis of enzymes of the protocatechuate branch. Eur. J. Biochem. 3:305-311.[Medline]
6
6. Cánovas, J. L., M. L. Wheelis, and R. Y. Stanier. 1968. Regulation of the enzymes of the ß-ketoadipate pathway in Moraxella calcoacetica. 2. The role of protocatechuate as inducer. Eur. J. Biochem. 3:293-304.[Medline]
7
7. Dal, S., I. Steiner, and U. Gerischer. 2002. Multiple operons connected with catabolism of aromatic compounds in Acinetobacter sp. strain ADP1 are under carbon catabolite repression. J. Mol. Microbiol. Biotechnol. 4:389-404.[Medline]
8
8. D'Argenio, D. A., A. Segura, W. M. Coco, P. V. Bünz, and L. N. Ornston. 1999. The physiological contribution of Acinetobacter PcaK, a transport system that acts upon protocatechuate, can be masked by the overlapping specificity of VanK. J. Bacteriol. 181:3505-3515.[Abstract/Free Full Text]
9
9. Dokter, P., J. E. van Wielink, M. A. van Kleef, and J. A. Duine. 1988. Cytochrome b-562 from Acinetobacter calcoaceticus L.M.D. 79.41. Its characteristics and role as electron acceptor for quinoprotein glucose dehydrogenase. Biochem. J. 254:131-138.[Medline]
10
10. Elsemore, D. A., and L. N. Ornston. 1994. The pca-pob supraoperonic cluster of Acinetobacter calcoaceticus contains quiA, the structural gene for quinate-shikimate dehydrogenase. J. Bacteriol. 176:7659-7666.[Abstract/Free Full Text]
11
11. Elsemore, D. A., and L. N. Ornston. 1995. Unusual ancestry of dehydratases associated with quinate catabolism in Acinetobacter calcoaceticus. J. Bacteriol. 177:5971-5978.[Abstract/Free Full Text]
12
12. Gerischer, U. 2002. Specific and global regulation of genes associated with the degradation of aromatic compounds in bacteria. J. Mol. Microbiol. Biotechnol. 4:111-121.[CrossRef][Medline]
13
13. Gerischer, U., and P. Dürre. 1992. mRNA analysis of the adc gene region of Clostridium acetobutylicum during the shift to solventogenesis. J. Bacteriol. 174:426-433.[Abstract/Free Full Text]
14
14. Gerischer, U., and L. N. Ornston. 1995. Spontaneous mutations in pcaH and -G, structural genes for protocatechuate 3,4-dioxygenase in Acinetobacter calcoaceticus. J. Bacteriol. 177:1336-1347.[Abstract/Free Full Text]
15
15. Gerischer, U., A. Segura, and L. N. Ornston. 1998. PcaU, a transcriptional activator of genes for protocatechuate utilization in Acinetobacter. J. Bacteriol. 180:1512-1524.[Abstract/Free Full Text]
16
16. Gregg-Jolly, L. A., and L. N. Ornston. 1994. Properties of Acinetobacter calcoaceticus recA and its contribution to intracellular gene conversion. Mol. Microbiol. 12:985-992.[Medline]
17
17. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580.[Medline]
18
18. Hartnett, C., E. L. Neidle, K.-L. Ngai, and L. N. Ornston. 1990. DNA sequences of genes encoding Acinetobacter calcoaceticus protocatechuate 3,4-dioxygenase: evidence indicating shuffling of genes and of DNA sequences within genes during their evolutionary divergence. J. Bacteriol. 172:956-966.[Abstract/Free Full Text]
19
19. Hartnett, G. B. 1993. Ph.D. thesis. Yale University, New Haven, Conn.
20
20. Harwood, C. S., and R. E. Parales. 1996. The ß-ketoadipate pathway and the biology of self-identity. Annu. Rev. Microbiol. 50:553-590.[CrossRef][Medline]
21
21. Hawkins, A. R., H. K. Lamb, J. D. Moore, I. G. Charles, and C. F. Roberts. 1993. The pre-chorismate (shikimate) and quinate pathways in filamentous fungi: theoretical and practical aspects. J. Gen. Microbiol. 139:2891-2899.[Free Full Text]
22
22. Juni, E., and A. Janik. 1969. Transformation of Acinetobacter calco-aceticus (Bacterium anitratum). J. Bacteriol. 98:281-288.[Abstract/Free Full Text]
23
23. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70:191-197.[CrossRef][Medline]
24
24. Kokotek, W., and W. Lotz. 1989. Construction of a lacZ-kanamycin-resistance cassette, useful for site-directed mutagenesis and as a promoter probe. Gene 84:467-471.[CrossRef][Medline]
25
25. Kowalchuk, G. A., G. B. Hartnett, A. Benson, J. E. Houghton, K.-L. Ngai, and L. N. Ornston. 1994. Contrasting patterns of evolutionary divergence within the Acinetobacter calcoaceticus pca operon. Gene 146:23-30.[CrossRef][Medline]
26
26. Lamb, H. K., J. P. van den Hombergh, G. H. Newton, J. D. Moore, C. F. Roberts, and A. R. Hawkins. 1992. Differential flux through the quinate and shikimate pathways. Implications for the channelling hypothesis. Biochem. J. 284:181-187.
27
27. Miller, J. H. 1992. A short course in bacterial genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
28
28. Nichols, N. N., and C. S. Harwood. 1997. PcaK, a high-affinity permease for the aromatic compounds 4-hydroxybenzoate and protocatechuate from Pseudomonas putida. J. Bacteriol. 179:5056-5061.[Abstract/Free Full Text]
29
29. Oliphant, A. R., and K. Struhl. 1988. Defining the consensus sequences of E. coli promoter elements by random selection. Nucleic Acids Res. 16:7673-7683.[Abstract/Free Full Text]
30
30. Parke, D., and L. N. Ornston. 2003. Hydroxycinnamate (hca) catabolic genes from Acinetobacter sp. strain ADP1 are repressed by HcaR and are induced by hydroxycinnamoyl-coenzyme A thioesters. Appl. Environ. Microbiol. 69:5398-5409.[Abstract/Free Full Text]
31
31. Popp, R., T. Kohl, P. Patz, G. Trautwein, and U. Gerischer. 2002. Differential DNA binding of transcriptional regulator PcaU from Acinetobacter sp. strain ADP1. J. Bacteriol. 184:1988-1997.[Abstract/Free Full Text]
32
32. Rauhut, R., and G. Klug. 1999. mRNA degradation in bacteria. FEMS Microbiol. Rev. 23:353-370.[CrossRef][Medline]
33
33. Simon, R., M. O'Connell, M. Labes, and A. Pühler. 1986. Plasmid vectors for the genetic analysis and manipulation of Rhizobia and other gram-negative bacteria. Methods Enzymol. 118:640-659.[Medline]
34
34. Simon, R., M. O’Connell, M. Labes, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Bio/Technology 1983:784-791.
35
35. Smith, M. A., V. B. Weaver, D. M. Young, and L. N. Ornston. 2003. Genes for chlorogenate and hydroxycinnamate catabolism (hca) are linked to functionally related genes in the dca-pca-qui-pob-hca chromosomal cluster of Acinetobacter sp. strain ADP1. Appl. Environ. Microbiol. 69:524-532.[Abstract/Free Full Text]
36
36. Stanier, R. A., and L. N. Ornston. 1973. The ß-ketoadipate pathway. Adv. Microb. Physiol. 9:89-151.[Medline]
37
37. Trautwein, G., and U. Gerischer. 2001. Effects exerted by transcriptional regulator PcaU from Acinetobacter sp. strain ADP1. J. Bacteriol. 183:873-881.[Abstract/Free Full Text]
38
38. Tresguerres, M. E. F., G. De Torrontegui, and J. L. Cánovas. 1970. The metabolism of quinate by Acinetobacter calco-aceticus. Arch. Microbiol. 70:110-118.
39
39. Tresguerres, M. E. F., G. De Torrontegui, W. M. Ingledew, and J. L. Cánovas. 1970. Regulation of the enzymes of the ß-ketoadipate pathway in Moraxella. Control of quinate oxidation by protocatechuate. Eur. J. Biochem. 14:445-450.[Medline]
40
40. Tresguerres, M. E. F., W. M. Ingledew, and J. L. Cánovas. 1972. Potential competition for 5-dehydroshikimate between the aromatic biosynthetic route and the catabolic hydroaromatic pathway. Arch. Mikrobiol. 82:111-119.[CrossRef]
41
41. van Kleef, M. A., and J. A. Duine. 1988. Bacterial NAD(P)-independent quinate dehydrogenase is a quinoprotein. Arch. Microbiol. 150:32-36.[CrossRef][Medline]

---

Applied and Environmental Microbiology, February 2005, p. 1025-1034, Vol. 71, No. 2
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.2.1025-1034.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Kasai, D., Fujinami, T., Abe, T., Mase, K., Katayama, Y., Fukuda, M., Masai, E. (2009). Uncovering the Protocatechuate 2,3-Cleavage Pathway Genes. J. Bacteriol. 191: 6758-6768 [Abstract] [Full Text]  
• Teramoto, H., Inui, M., Yukawa, H. (2009). Regulation of Expression of Genes Involved in Quinate and Shikimate Utilization in Corynebacterium glutamicum. Appl. Environ. Microbiol. 75: 3461-3468 [Abstract] [Full Text]  
• Zimmermann, T., Sorg, T., Siehler, S. Y., Gerischer, U. (2009). Role of Acinetobacter baylyi Crc in Catabolite Repression of Enzymes for Aromatic Compound Catabolism. J. Bacteriol. 191: 2834-2842 [Abstract] [Full Text]  
• Jerg, B., Gerischer, U. (2008). Relevance of nucleotides of the PcaU binding site from Acinetobacter baylyi. Microbiology 154: 756-766 [Abstract] [Full Text]  
• Siehler, S. Y., Dal, S., Fischer, R., Patz, P., Gerischer, U. (2007). Multiple-Level Regulation of Genes for Protocatechuate Degradation in Acinetobacter baylyi Includes Cross-Regulation. Appl. Environ. Microbiol. 73: 232-242 [Abstract] [Full Text]  
• Schubbe, S., Wurdemann, C., Peplies, J., Heyen, U., Wawer, C., Glockner, F. O., Schuler, D. (2006). Transcriptional Organization and Regulation of Magnetosome Operons in Magnetospirillum gryphiswaldense. Appl. Environ. Microbiol. 72: 5757-5765 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dal, S. Articles by Gerischer, U. Search for Related Content PubMed PubMed Citation Articles by Dal, S. Articles by Gerischer, U. Agricola Articles by Dal, S. Articles by Gerischer, U.