Previous Article | Next Article ![]()
Applied and Environmental Microbiology, March 2005, p. 1638-1641, Vol. 71, No. 3
0099-2240/05/$08.00+0 doi:10.1128/AEM.71.3.1638-1641.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
| SHORT REPORT |
and
Marcia S. Osburne
Sanofi-Aventis Cambridge Genomics Center, Cambridge, Massachusetts
Received 15 July 2004/ Accepted 15 October 2004
ABSTRACT
Here we describe the rep gene, isolated from an environmental DNA library, which when transformed into Streptomyces species resulted in increased production of secondary metabolites and accelerated sporulation. We show that Streptomyces lividans strains bearing rep are particularly useful as expression hosts for heterologous antibiotic production.
Natural products from environmental microorganisms account for over 30% of all human therapeutics and over 60% of anti-infective and anticancer drugs. These include polyketides, produced by microbes such as Streptomyces, Saccharopolyspora, and Aspergillus species. Although the majority of microorganisms in the environment are still unknown, most are unculturable under standard laboratory conditions. If these uncultured species could be accessed, they could potentially provide a large, untapped pool of novel natural products. In a recent approach, microbial DNA was extracted directly from environmental samples, cloned into suitable vectors, and expressed in surrogate laboratory host strains (2, 7, 8, 10).
Because of their ease of use and ability to express polyketides, Streptomyces species are logical surrogate hosts for soil DNA libraries. Streptomyces lividans is usually preferred for genetic manipulation because it lacks methylation-dependent restriction, allowing efficient transfer of DNA from Escherichia coli cloning strains. However, S. lividans does not produce antibiotics as abundantly as does Streptomyces coelicolor, and its morphological development is delayed (6). It has been shown that overexpression of clpX (3) and mutations in the rpsL gene (11) and in glucose-6-phosphate dehydrogenase genes (1) result in increased endogenous actinorhodin synthesis in S. lividans, although it is not currently known whether these results extend to heterologous antibiotics. Therefore, a need remains for an expression host that combines the absence of methylation-dependent restriction systems with a high level of heterologous secondary metabolite production and that can be used conveniently for assaying soil DNA libraries for anti-infective and other activities. We show here that the rep gene, isolated from a soil environmental DNA library, confers to S. lividans both accelerated sporulation and overproduction of endogenous and heterologous secondary metabolites. Thus, S. lividans bearing this gene constitutes an improved expression host for heterologous DNA libraries.
Phenotypes conferred by cosmid 2A7.
Cosmid 2A7, previously isolated as part of a soil DNA library (2), contains approximately 40.4 kb of soil DNA cloned into the E. coli-Streptomyces shuttle vector pOSI700. When grown in glucose-containing medium (e.g., SMM or R5 [5]), S. lividans TK24 bearing this cosmid sporulated early (after 3 days in SMM versus 8 days for the control strain) and produced an enhanced level of actinorhodin, an endogenous pigment. To ascertain that this phenotype was encoded on the cosmid, 2A7 was retransformed into S. lividans TK24. Transformants again displayed both early sporulation and early, increased antibiotic production in SMM medium (Fig. 1). The 2A7 phenotypes were carbon source dependent; they were not observed when glucose was omitted or replaced by mannitol or glycerol (0.2 and 0.5%, respectively).
|
act
red (deleted for both endogenous antibiotics [8]) bearing cosmid 2A7 also displayed the early sporulation phenotype (Fig. 2A). To test whether 2A7 could increase heterologous antibiotic production, pSGran, an integrative bacterial artificial chromosome containing the granaticin biosynthetic cluster from Streptomyces violeacoruber Tu22 (8), and the corresponding empty BAC vector were conjugated into S. lividans
act
red containing cosmid 2A7. When grown in glucose-containing medium, 2A7 conferred significantly higher levels of granaticin production on both solid medium (Fig. 2C) and in a liquid 96-well format (Fig. 2B). As before, increased sporulation and secondary metabolite production were glucose dependent (not observed when glucose was replaced by glycerol or mannitol) and occurred even in the presence of a high copper concentration (R5 with 2 µM CuCl2), which has been shown to accelerate spore production in S. lividans (4). Thus, 2A7 appears to bypass glucose repression of sporulation and antibiotic biosynthesis in S. lividans (6).
|
act
red/2A7 with and without pSGran were prepared and tested for antibacterial activity. Cells were grown in shallow 96-well plates (non-tissue-culture treated) containing 150 µl of a modified R5 liquid medium (5), omitting sucrose and agar, and incubated at 30°C for 5 to 9 days in a sealed plastic bag containing a wet paper towel. Water was then evaporated, and the residue was extracted with 150 µl of 100% methanol. After a 5-min centrifugation at 4,000 rpm (1,500 x g), 100 µl of the methanol extract was removed into a clean 96-well plate, the methanol was evaporated, and dried extracts were stored at 4°C. Antibacterial assays were then carried out in the 96-well plates by resuspending the extracts in 150 µl of Luria-Bertani medium that had been inoculated with a tester strain (Bacillus subtilis BR151/pPL608 or Staphylococcus aureus Smith). After overnight incubation at 35°C, wells containing antibacterial compounds were clear as compared with the turbid control. S. lividans
act
red containing both cosmid 2A7 and pSGran showed a 10- to 100-fold increase in antibacterial activity compared with the same strain in the absence of 2A7 (Fig. 3), demonstrating that 2A7 can increase heterologous polyketide production from single-copy gene clusters to levels that are sufficient for biological screening in small culture volumes. Importantly, S. lividans
act
red containing 2A7 showed no background antibacterial or antifungal activity, and no new compounds were detectable by high-pressure liquid chromatography analysis in extracts of this strain (data not shown). Therefore, the presence of cosmid 2A7 did not itself result in significant levels of new molecules that could interfere with screening efforts.
|
The insert in cosmid 2A7 was GC rich (74%) and showed no identities with existing GenBank sequences. To identify the gene(s) responsible for the 2A7 phenotype, we used transposon GPSApra, a modified form of transposon GPS1, used for genome sequencing (New England Biolabs, Beverly, Mass.), to create insertions in 35 of the 36 predicted ORFs. We transformed each into S. lividans TK24 act+ red+ and found that disruption of a single ORF, rep, resulted in complete loss of glucose-dependent early sporulation, indicating that rep is necessary for this phenotype (data not shown). To test whether rep was sufficient to confer the 2A7 phenotypes, a 1.5-kb fragment of cosmid 2A7 containing the rep ORF and 290 bp of upstream sequence was PCR amplified, using Vent polymerase (New England Biolabs) and primers 2A7.repS.5' (GCAAGCTTGGTGCGTCGCCGGCACGTCGAGCTCGTGCA) and 2A7.rep.3' (GCAAGCTTGTAGACGCCGCAGTCCACGATGACACGG) as recommended by the manufacturer in the presence of 10% dimethyl sulfoxide, with the following conditions: 98°C for 10 min; 30 cycles of 98°C for 1 min, 60°C for 1 min, and 72°C for 2 min; and 72°C for 10 min. The PCR product was cloned into pBlunt-TOPO (Invitrogen), yielding pTOPO.rep, and then rep was reisolated by HindIII digestion and cloned into the HindIII site of pOSI700, yielding pOSI.rep. The phenotype of S. lividans TK24 bearing pOSI.rep and grown on glucose-containing medium (Fig. 4A) showed that the rep gene was sufficient to confer early sporulation and increased antibiotic production. rep was also tested in S. coelicolor to assess its effect in other Streptomyces species. BstXI/EcoRI adapters (Invitrogen) were first ligated to the rep PCR product, using a standard blunt-end ligation procedure. The resulting rep fragment was gel purified and ligated to 20 ng of BstXI-cut pMBD13 vector (10:1, vector to insert molar ratio) at 16°C for 6 h. The resulting plasmid, pMBD.rep, was transformed into E. coli ET12567/pUB307 and conjugated into S. coelicolor M145 by standard procedures (5). S. coelicolor M145 transformants containing pMBD.rep overproduced antibiotics in glucose-containing medium compared to control S. coelicolor strains transformed with the empty vector (Fig. 4B). Therefore, rep can increase antibiotic production in at least one additional Streptomyces species and thus may be of value for other Streptomyces strains of commercial interest.
|
|
The rep gene, derived from an environmental library, was shown both to accelerate sporulation and to enhance production levels of secondary metabolites, specifically endogenous and heterologous antibiotics. Streptomyces strains bearing this sequence can thus be used not only as improved production hosts for endogenous secondary metabolites but also for screening libraries of soil DNA samples for heterologous secondary metabolites, thereby enhancing our ability to detect novel compounds produced in environmental libraries.
Nucleotide sequence accession number.
The sequence of the rep gene has been deposited in GenBank (accession number AY684299).
ACKNOWLEDGMENTS
We thank our colleagues Ian MacNeil and Kara Brown for helpful discussions during the course of this work.
| FOOTNOTES |
|---|
FOOTNOTES
This paper is dedicated to the memory of Steven J. Kolvek, our colleague and friend. ![]()
Present address: ActivBiotics, Inc., Lexington, MA 02420. ![]()
REFERENCES
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM Journals |
|---|