Previous Article | Next Article ![]()
Applied and Environmental Microbiology, June 2005, p. 2888-2893, Vol. 71, No. 6
0099-2240/05/$08.00+0 doi:10.1128/AEM.71.6.2888-2893.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Carole Lartigue,1,
Joachim Frey,2
Henri Wróblewski,3
François Thiaucourt,4
Alain Blanchard,1 and
Pascal Sirand-Pugnet1*
UMR Génomique Développement Pouvoir Pathogène, INRA, Université Victor Segalen Bordeaux 2, BP 81, 33883 Villenave d'Ornon Cedex, France,1 Institute of Veterinary Bacteriology, University of Berne, Laenggasstrasse 122, CH-3012 Berne, Switzerland,2 UMR CNRS 6026, Université de Rennes I, Campus de Beaulieu, 35042 Rennes Cedex, France,3 CIRAD-EMVT, Santé Animale, TA30/G, Campus International de Baillarguet, 34398 Montpellier Cedex 5, France4
Received 27 September 2004/ Accepted 21 December 2004
|
|
|---|
|
|
|---|
The aim of this study was to evaluate the usefulness of these vectors as genetic tools. Because of its relatively fast growth and its ability to replicate a wide spectrum of oriC plasmids, M. capricolum subsp. capricolum was chosen in this work. Two types of applications were investigated. First, the M. capricolum subsp. capricolum oriC plasmid was used as a genetic vector for expressing heterologous proteins, which is indeed required for functional genomics as it allows the complementation of mutants or the study of gene regulation via a reporter gene. Second, targeted gene inactivation was attempted with M. capricolum subsp. capricolum. Production of mutants by gene disruption is a crucial step in the understanding of protein function and involvement in complex processes such as pathogenesis. In mollicutes, the inactivation of target genes through homologous recombination has been described for Acholeplasma laidlawii (12), Mycoplasma gallisepticum (5), and Mycoplasma genitalium (7, 8). In these cases, the plasmid vector used could not replicate in the host, and drug-resistant transformants could only be obtained via an integration of the plasmid into the chromosome. In S. citri (9, 16, 21) and M. pulmonis (6), for which no gene inactivation could ever be obtained with nonreplicating plasmids, oriC plasmids have been successfully used to drive homologous recombination events. To develop tools for genetic investigations in M. capricolum subsp. capricolum, oriC plasmids were evaluated as genetic vectors for gene targeting experiments.
|
|
|---|
(mrr-hsdRMS-mcrBC)
80dlacZ
M15
lacX74 deoR recA1 endA1 araD139
(ara leu)7697 galU galKl rpsL nupG] (Stratagene) was used. E. coli cells were grown in LB broth at 37°C. ß-Galactosidase activity was detected by plating mycoplasmas on solid medium spread with 200 µl of 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-Gal) at a concentration of 4 mg/ml.
Plasmid construction.
The pMCO3 plasmid contains the chromosomal oriC region of M. capricolum subsp. capricolum and the selection marker tet(M) under the control of the spiralin promoter (20). The lacZ gene from E. coli was first amplified by PCR from the pßgal-Basic (BD Biosciences Clontech) using the primers lacZF (5' AGGCAGATCTATGGACACCAGCAAGGAGCTG 3') and lacZR (5' TCGAAGATCTTGGGGTGTTGTAACAATATCG 3'). The amplification product (3,206 bp) was cleaved by BglII at the sites included in the primer sequence (underlined nucleotides) and cloned at the BglII site located downstream of the spiralin promoter of pSRT2 (21) to generate the pWZ1 plasmid (W. Maccheroni and J. Renaudin, unpublished data). An expression cassette containing the lacZ gene under control of the spiralin promoter was then amplified using the primers PS4237E1 (5' GGAGAATTCGCGCAATTTATTTGG 3'; the EcoRI site is underlined) and LacZ1 (5' TCGAGAATTCTGGGGTGTTGTAACAATATC 3'). The amplification product was cloned at the EcoRI site of the pMCO3 to generate pPSlacZ. The S. citri spiralin gene, under control of its own promoter, was amplified from S. citri genomic DNA using PS1 (5' GCGATATCCGATCGGCAATTTATTTGGAAAATC 3') and PS2 (5' GCGATATCCGATCGAGTTGATATTCTAAGATTG 3') as primers and cloned in the PCR cloning vector TOPO 2.1 (Invitrogen). The insert was isolated after cleavage by EcoRI and cloned at the EcoRI site of pMCO3 to obtain pSPI. An internal fragment of the lppA gene was amplified from M. capricolum subsp. capricolum genomic DNA using the oligonucleotides MCLA1 (5' GATCGAATTCGGGCCCCCATAAAACCTGAAGATTC 3'; the EcoRI site is underlined) and MCLA2 (5' GATCGAATTCCCGCGGGTAATTCTAGTATGGAAAGG 3'). After cleavage by EcoRI, the amplification product was cloned into the EcoRI sites of pMCO3 and pSD4 to generate the pMCO6 and the pSD6 constructs, respectively.
Transformation of M. capricolum subsp. capricolum.
Polyethylene glycol-mediated transformation of M. capricolum subsp. capricolum was performed as described previously (11). Ten micrograms of plasmid DNA was used for each transformation. After being plated on selective solid medium containing 5 µg/ml of tetracycline, the cultures were kept at 37°C and examined for colony development from the third day of incubation. Transformants were then picked up and subcultured in Hayflick broth medium supplemented with 20 µg of tetracycline/ml. Cloning of M. capricolum subsp. capricolum transformed with pSPI or pPSlacZ was achieved by three cycles of picking colonies obtained after plating cultures submitted to filtration using 0.45-µm-pore-size filters to eliminate lumps of cells (30).
DNA isolation and Southern blot hybridization.
Mycoplasma genomic DNA was prepared from 10-ml cultures using the Wizard genomic DNA purification kit (Promega). For Southern blot hybridization, 1.5 µg of genomic DNA or 15 ng of plasmid DNA was digested by the appropriate restriction enzyme and submitted to electrophoresis in a 0.8% agarose gel. After alkali transfer of the DNA fragments to a positively charged nylon membrane (Nytran Super Charge; Schleicher and Schuell), hybridization was performed in the presence of 20 ng/ml of digoxigenin-labeled DNA probes. Detection of hybridized probes was achieved using Fab fragments of anti-digoxigenin antibodies coupled to alkaline phosphatase and the fluorescent substrate 2-hydroxy-3-naphthoic acid-2'-phenylanilide phosphate (Roche Molecular Biochemicals). Chemifluorescence was detected by using a high-resolution camera (Fluor-S; Bio-Rad) and Quantity One, a dedicated software for image acquirement (Bio-Rad).
Protein extraction.
Exponentially growing mycoplasma cells were collected by centrifugation (9,500 x g for 15 min; 4°C). The pellet was dispersed in 1x phosphate-buffered saline (PBS 1x) (13.7 mM NaCl, 0.27 mM KCl, 0.15 mM KH2PO4, 0.8 mM Na2HPO4, 12 H2O [pH 7.4]) and washed three times in the same buffer. Cells were then dispersed in lysis solution (PBS 1x, 0.5% sodium dodecyl sulfate [SDS], and 1 mM Pefabloc [Roche Applied Science]) in the volume required to concentrate the sample 100 times. Lysis was facilitated and viscosity was reduced by a 15-s sonication using a microprobe (Vibra cell; Branson). The sample was then heated at 60°C for 10 min and centrifuged to sediment cellular debris (18,000 x g for 5 min; room temperature). The protein concentration of the supernatant was measured by the bicinchoninic acid method (31) with bovine serum albumin as a standard. To isolate a membrane protein-enriched fraction, mycoplasma cells were submitted to an extraction with Triton X-114 (adapted from a previously published procedure) (4). Briefly, after centrifugation of mycoplasma cultures, the cells were washed three times in PBS 1x and resuspended in 100 µl of Triton X-114 diluted with 900 µl of Tris/NaCl buffer (10 mM Tris-HCl [pH 7.4], 154 mM NaCl). After a 15-s sonication, the sample was mixed by rotary agitation at 4°C for 40 min. The separation of the detergent and aqueous phases was obtained by incubation of the mixture for 10 min at 37°C and centrifugation (14,000 x g for 5 min; room temperature). The aqueous and detergent phases were washed three times with 10% Triton X-114 and with Tris/NaCl buffer, respectively. The aqueous phase was stored at 20°C. Nine volumes of methanol was added to the detergent phase, and the sample was then incubated overnight at 80°C to precipitate the proteins. After centrifugation (14,000 x g for 10 min; 4°C), the pellet of proteins was washed once in 70% ethanol and then resuspended in 100 µl of PBS 1x, 0.5% SDS, and 1 mM Pefabloc (Roche Applied Science).
Protein electrophoresis and immunoblotting.
Proteins were separated by electrophoresis as previously described (19) in 10% or 12% polyacrylamide gels. For staining with Coomassie brilliant blue (R250; Bio-Rad), 60 µg of total cell protein was loaded into each well. For spiralin immunodetection, 0.01 µg and 1.5 µg of total protein from S. citri and M. capricolum subsp. capricolum/pSPI were loaded, respectively. For both aqueous and Triton X-114 phases from M. capricolum subsp. capricolum, 0.15 µg of protein were loaded. Proteins were electroblotted onto a nitrocellulose membrane at 10 V for 1.5 h in a semidry transfer unit (Amersham Biosciences) using a Tris-glycine transfer buffer (25 mM Tris-HCl, 192 mM glycine, 10% methanol, 0.1% SDS, pH 8.3) (34). After saturation in TBS buffer (25 mM Tris-HCl, 125 mM NaCl, pH 8.0) supplemented with 5% defatted dry milk and 0.1% Tween 20, the membrane was incubated for 1 h at room temperature with the primary antibodies. Spiralin was detected using a polyclonal, monospecific serum (diluted 1:1,000) obtained after immunization of two rabbits with purified spiralin (3). The lipoprotein LppA was revealed with a polyclonal mouse antiserum (diluted 1:500) specifically directed against M. capricolum subsp. capricolum LppA (23). After being washed three times in saturating buffer, the membrane was incubated with the alkaline phosphatase-conjugated secondary antibody (diluted 1:2,000). Depending on the primary antibodies used, secondary antibodies were either goat anti-rabbit or goat anti-mouse immunoglobulin G (Bio-Rad). Alkaline phosphatase was revealed using Nitro Blue Tetrazolium/5-bromo-4-chloro-3-indolylphosphate (Sigma) as a substrate.
|
|
|---|
![]() View larger version (23K): [in a new window] |
FIG. 1. Structure of the pMCO3-derived plasmids used in this study. Various inserts were cloned at the EcoRI site of plasmid pMCO3. PS, spiralin gene promoter; lacZ, coding region of E. coli ß-galactosidase-encoding gene; lppA, internal region of the lppA gene from M. capricolum subsp. capricolum (1,238 nucleotides [nt]). Truncated regions of the gene (165 nt upstream and 190 nt downstream) are represented by dashed open boxes. Plasmid pSPI contains the spiralin gene under control of its own promoter. Genes are not drawn to scale; plasmid sizes are indicated in brackets.
|
![]() View larger version (36K): [in a new window] |
FIG. 2. Expression of the spiralin gene in M. capricolum subsp. capricolum. Total proteins (lane 1, S. citri; lane 2, M. capricolum subsp. capricolum, lane 3, M. capricolum subsp. capricolum/pSPI) and proteins separated by Triton X-114 extraction from M. capricolum subsp. capricolum (lane 4, aqueous phase; lane 5, Triton X-114 phase) and M. capricolum subsp. capricolum/pSPI (lane 6, aqueous phase; lane 7, Triton X-114 phase) were separated by SDS-polyacrylamide gel electrophoresis. (A) Coomassie brilliant blue staining. (B) Immunodetection of the spiralin using a monospecific polyclonal anti-spiralin serum. The position of the spiralin is indicated by black arrows. Molecular masses are indicated in kilodaltons.
|
Targeted gene inactivation in M. capricolum subsp. capricolum. (i) Homologous oriC plasmid as a disruption vector.
To evaluate oriC plasmids as tools for targeted gene inactivation in M. capricolum subsp. capricolum, an internal fragment of the lppA gene (1,241 bp) was cloned at the EcoRI site of plasmid pMCO3, which contains the replication origin from M. capricolum subsp. capricolum. LppA (57 kDa) is a major surface lipoprotein that is found with minor variations in other members of the mycoides cluster (15, 23, 24). The recombinant plasmid pMCO6 (Fig. 1) and the control plasmid pMCO3 were used to transform M. capricolum subsp. capricolum. After plating and 3 days of incubation, tetracycline-resistant transformants were obtained with an equivalent efficiency for both plasmids (2 x 106 transformants CFU1 µg1). Ten pMCO6-transformants were subcultured for 15 passages in tetracycline-containing broth medium. Southern blot analysis of the clones using an lppA probe revealed that no integration event occurred in any of the clones even after 15 passages (data not shown): plasmid pMCO6 remained as a free molecule, suggesting that the integration events at the lppA locus were rather rare.
(ii) Heterologous oriC plasmid as a disruption vector.
To help in selection of recombinant cells among transformants, the internal fragment of the lppA gene was cloned into plasmid pSD4 that harbors the replication origin from S. citri to generate pSD6. The heterologous pSD4 oriC plasmid was previously shown to transform M. capricolum subsp. capricolum but with a low efficiency, suggesting a reduced fitness (20). Three transformations of M. capricolum subsp. capricolum with 20 µg of pSD6 were performed, and only three tetracycline resistant clones were obtained. After 15 passages in selective medium, the genomic DNAs of these clones were extracted, ScaI digested, and analyzed by Southern blot hybridization with an lppA probe (Fig. 3A). Only the 10-kbp chromosomal copy of lppA was detected for clone 1 (Fig. 4), suggesting that this clone either underwent a deletion of lppA on the plasmid or that it was a spontaneous tetracycline-resistant colony. In clone 2, the lppA probe revealed two bands (2.6 kbp and 12 kbp), indicating that an integration event had occurred into the target gene, lppA. A third clone showed a hybridization pattern as clone 2 but contained a third 5.8-kbp fragment hybridizing, indicating the presence of free plasmid. To determine more precisely the integration process of pSD6 in clone 2 (Mcap
lppAcl2), the total genomic DNA of this clone was extracted at passages 2, 4, 6, 8, 10, 12, and 14 and analyzed as described above (Fig. 3B). The presence of 2.6-kbp and 12.0-kbp bands from the second passage indicated that plasmid integration into the target gene had started to occur early, at least in some cells. From passage 6, the bands corresponding to the wild-type chromosomal lppA gene (10 kbp) and to the free plasmid (5.8 kbp) were not detected anymore, suggesting that the cells harboring an integrated plasmid in their genome had been positively selected. To verify the inactivation of the lppA gene in Mcap
lppAcl2, total proteins were extracted and probed with a monospecific polyclonal anti-LppA serum (Fig. 3C). A single band corresponding to the predicted 57-kDa LppA was detected for the untransformed control but not for the mutant Mcap
lppAcl2, suggesting the lack of LppA. Interestingly, although truncated lppA mRNAs were evidenced by reverse transcription-PCR in agreement with the integration scheme (data not shown), no truncated form of the protein could be immunodetected, suggesting that it was degraded. Colony-blotting experiments with the same serum confirmed the lack of LppA on the cell surface of the mutant (data not shown). This result shows that targeted gene inactivation was obtained with M. capricolum subsp. capricolum by using a heterologous oriC plasmid.
![]() View larger version (28K): [in a new window] |
FIG. 3. lppA gene inactivation in M. capricolum subsp. capricolum using the heterologous oriC plasmid pSD6. (A) Southern blot hybridization between ScaI-digested DNAs extracted from M. capricolum subsp. capricolum (lane Mcc) and from three tetracycline-resistant clones (lanes 1, 2, and 3) obtained after transformation of M. capricolum subsp. capricolum with pSD6. The lppA fragment was used as a probe. Lane pl, plasmid pSD6. (B) Southern blot hybridization of ScaI-digested DNAs extracted from clone 2 at passage 2, 4, 6, 8, 10, 12, and 14. Lane pl, pSD6 plasmid DNA; Mcc, genomic DNA from M. capricolum subsp. capricolum. Sizes are indicated in kilobase pairs. (C) Immunodetection of the lipoprotein LppA in the mutant Mcap lppAcl2. Total proteins (lane 1, M. capricolum subsp. capricolum; lane 2, Mcap lppAcl2) were separated by SDS-polyacrylamide gel electrophoresis. The lipoprotein LppA was revealed with a monospecific polyclonal anti-LppA serum. M, molecular mass marker (in kilodaltons). The position of LppA is indicated by an arrow.
|
![]() View larger version (15K): [in a new window] |
FIG. 4. Schematic representation of the pSD6 plasmid integration in the lppA gene by homologous recombination. tet(M), tetracycline resistance gene; oriC, replication origin from S. citri; lppA, 1,241-bp internal lppA fragment; E, EcoRI; S, ScaI. Elements are not drawn to scale. The pSD6 ScaI fragment containing the lppA sequence is 5.8 kbp in size.
|
|
|
|---|
The spiralin gene, encoding a spiroplasma lipoprotein, was chosen to demonstrate the feasibility of expressing and exposing a heterologous protein at the cell surface of a mycoplasma. To our knowledge, although the Spiroplasma phoeniceum spiralin was previously expressed in S. citri (29), there was no example of heterologous lipoprotein expression in a Mycoplasma species. Problems encountered when M. capricolum subsp. capricolum transformation was performed at 37°C suggest that the expression of spiralin is somewhat deleterious for cell viability, at least initially. However, the transformant obtained at 32°C grows at 37°C and forms normally shaped colonies on solid medium. In S. citri, spiralin is a particularly abundant protein (20 to 30% of the mass of the membrane proteins) (37), suggesting that its expression in M. capricolum subsp. capricolum might lead to a transient perturbation of the cell membrane and that this effect could be reduced by lowering the temperature during the transformation. Similar temperature effects have been described in E. coli; lowering the temperature has been used to reduce the toxic effects observed during the expression of fusion proteins artificially addressed to the membrane (32). Although several vaccines are based on attenuated strains of mycoplasma (26, 33), these bacteria have not yet been used to deliver heterologous protective antigens. Such strategy is already applied with other Bacteria species (22), and the expression of a foreign lipoprotein in a species of the mycoides cluster is promising for the use of mycoplasmas as live vaccine. More specifically, the ability of several mycoplasma species to colonize the respiratory tract of animals makes them attractive to stimulate mucosal responses (22).
Gene targeting with oriC plasmids.
In M. capricolum subsp. capricolum, several attempts to inactivate the lppA gene using nonreplicative vectors have been performed without success (not shown). Moreover, no integration in the targeted lppA gene was observed when a plasmid harboring a complete and homologous oriC was used. In contrast, the use of the heterologous oriC plasmid pSD4 from S. citri as a vector led to the desired mutant. It should be noticed that transformation efficiency with the pSD4-derived plasmid was very low, in accordance with previous results (20). Thus, it seems that reducing the fitness of the plasmid lowers its replication capacity and, consequently, favors the selection of the rare recombinant cells. Alternative strategies based on plasmids harboring reduced homologous oriC have also given interesting results with S. citri (21) and with M. pulmonis (6). In these cases, the reduction of sequence homology of the oriC region limits the background integration events at the chromosomal replication origin.
In conclusion, this work shows that oriC plasmids can be used in M. capricolum subsp. capricolum as vectors for the expression of heterologous cytoplasmic and membrane proteins and for targeted gene inactivation. Considering the growing number of available genome sequences of mollicutes and the importance of these bacteria as pathogenic agents, the development of efficient tools for the functional genomics of these bacteria is a real challenge. From that point of view, the demonstration that oriC plasmids can be used as genetic vectors in a mycoplasma from the mycoides cluster constitutes significant progress, which could also be applied to other mycoplasma species.
We thank Géraldine Gourgues for technical assistance, Joël Renaudin for helpful discussions, and Walter Maccheroni and Sybille Duret-Nurbel for constructing the plasmids pWZ1 and pSD4, respectively.
Supplemental material for this article may be found at http://aem.asm.org/. ![]()
C.J. and C.L. contributed equally to the work. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»