This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Talhinhas, P.
Right arrow Articles by Oliveira, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Talhinhas, P.
Right arrow Articles by Oliveira, H.
Agricola
Right arrow Articles by Talhinhas, P.
Right arrow Articles by Oliveira, H.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, June 2005, p. 2987-2998, Vol. 71, No. 6
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.6.2987-2998.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Molecular and Phenotypic Analyses Reveal Association of Diverse Colletotrichum acutatum Groups and a Low Level of C. gloeosporioides with Olive Anthracnose

Pedro Talhinhas,1* S. Sreenivasaprasad,2 João Neves-Martins,1 and Helena Oliveira1

Instituto Superior de Agronomia, Universidade Técnica de Lisboa, Tapada da Ajuda, 1349-017 Lisbon, Portugal,1 Warwick HRI, University of Warwick, Wellesbourne CV35 9EF, United Kingdom2

Received 29 October 2004/ Accepted 22 December 2004


arrow
ABSTRACT
 
Anthracnose (Colletotrichum spp.) is an important disease causing major yield losses and poor oil quality in olives. The objectives were to determine the diversity and distribution pattern of Colletotrichum spp. populations prevalent in olives and their relatedness to anthracnose pathogens in other hosts, assess their pathogenic variability and host preference, and develop diagnostic tools. A total of 128 Colletotrichum spp. isolates representing all olive-growing areas in Portugal and a few isolates from other countries were characterized by molecular and phenotypic assays and compared with reference isolates. Arbitrarily primed PCR data, internal transcribed spacer of rRNA gene and ß-tubulin 2 nucleotide sequences, colony characteristics, and benomyl sensitivity showed Colletotrichum acutatum to be dominant (>97%) with limited occurrence of Colletotrichum gloeosporioides (<3%). Among C. acutatum populations, five molecular groups, A2 to A6, were identified. A2 was widely prevalent (89%), coinciding with a high incidence of anthracnose and environmental conditions suitable to disease spread. A4 was dominant in a particular region, while other C. acutatum groups and C. gloeosporioides were sporadic in their occurrence, mostly related to marginal areas of olive cultivation. C. gloeosporioides, isolated from olive fruits with symptoms indistinguishable from those of C. acutatum, showed same virulence rating as the most virulent C. acutatum isolate from group A2. C. acutatum and C. gloeosporioides isolates tested in infected strawberry fruits and strawberry and lupin plants revealed their cross-infection potential. Diagnostic tools were developed from ß-tubulin 2 sequences to enable rapid and reliable pathogen detection and differentiation of C. acutatum groups.


arrow
INTRODUCTION
 
Several species belonging to the genus Colletotrichum cause important diseases in a wide range of crops including cereals, legumes, vegetables, and fruit crops. Olive (Olea europaea subsp. europaea) is an important crop in the Mediterranean basin, and olive anthracnose is becoming an increasingly important disease in this region. The disease is very common in Portugal, causing up to 100% losses, particularly in the widely cultivated variety Galega, but the disease is also spreading in other Mediterranean countries such as Spain (22), Italy (3), and Serbia and Montenegro (38). Symptoms typically occur on fruits at maturation under wet autumn conditions, as dark sunken lesions with abundant production of orange masses of conidia. Symptoms on stems and leaves are only rarely observed. The disease causes premature fruit drop, poor oil quality (high acidity), and damaged fruits unacceptable for canning. The olive anthracnose pathogen was originally described as Gloeosporium olivarum Alm. but was later transferred to Colletotrichum gloeosporioides (Penzig) Penzig & Saccardo (37). More recently, based on a limited collection of isolates, both Colletotrichum acutatum Simmonds ex Simmonds and C. gloeosporioides were reported to be associated with the disease (21). However, very little information is available on the relative importance of each of these species and their diversity and distribution. In anthracnose pathosystems, a number of examples are known where more than one Colletotrichum species is associated with the same host, and a single Colletotrichum species is able to infect a range of hosts (10). For example, C. acutatum is associated with the postbloom fruit drop and anthracnose of different types of citrus, while C. gloeosporioides is a postharvest pathogen of citrus but also occurs commonly as a saprophyte (4). So it is critical to be able to accurately diagnose the pathogen and understand its epidemiology to develop effective disease management. Moreover, differential sensitivity of these mixed Colletotrichum populations to fungicides such as benomyl can pose problems in disease control, as well as lead to shifts in pathogen populations (11). Molecular markers in conjunction with phenotypic analyses have been successfully applied to address these issues in various anthracnose pathosystems (2, 7, 34).

The objectives of this work were (i) genotypic and phenotypic characterization of Colletotrichum spp. isolates associated with olive anthracnose to identify the key pathogen(s), (ii) to determine the extent of diversity and distribution of the pathogen(s), as well as their relatedness to Colletotrichum spp. populations from other hosts, (iii) to assess the pathogenic variability and cross-infection potential of these groups, and (iv) to develop tools for pathogen detection, as well as diagnosis of subspecific molecular groups, to facilitate improved disease management.


arrow
MATERIALS AND METHODS
 
Fungal isolates.
A total of 128 Colletotrichum spp. isolates were established from olive anthracnose samples collected during autumns (October to December) of 2001, 2002, and 2003 from different olive production areas in Portugal (Fig. 1 and Table 1). In a number of cases, more than one isolate was obtained from each location/sample, to assess the presence of mixed populations and to monitor any shifts in pathogen distribution related to disease incidence/severity. These isolates are identified in Table 1 under the column "Location" by the letter A (analysis for mixed populations) or letters B to H (pathogen and disease monitoring of locations and surrounding sites in different years). Other olive anthracnose isolates analyzed were CBS193.32, collected in Italy in 1932, and M3 and M4, collected in Serbia and Montenegro in 2003, which were all supplied as C. gloeosporioides. Previously characterized (31, 34) C. acutatum isolates PD88/673 (isolated from Anemone sp.); JG05 (Ceanothus sp.); PD85/694 (Chrysanthemum sp.); CMG12 (Cinnamomum zeylanicum); PD89/582 (Cyclamen sp.); TN47 (Eriobotrya japonica); C2897, CR20, NI90, and CA397 (Fragariax ananassa); CA473 (Liriodendron tulipifera); HO01, JR03, HY09, and PT30 (Lupinus albus); CA318 (Magnolia sp.), CA302a (Nandina domestica); PD443 (Phlox sp.); CA455 (Photinia sp.); CA287 (Statice sp.); CR46 (Vitis vinifera); and C. gloeosporioides isolates CR21 (Citrus limon), CR45 (Citrus sp.), and CG315 (Fragariax ananassa) were used as references for comparative purposes. All isolates used in this study were monoconidial cultures and are stored as agar plugs in water at room temperature at the authors' laboratories. Nucleotide sequences (for the internal transcribed spacer of the rRNA gene [rRNA gene-ITS]) of a few other isolates retrieved from databases were also used as references in DNA sequence analysis and are referred to in the appropriate results section.



View larger version (71K):
[in this window]
[in a new window]
  		FIG. 1. Map of Portugal depicting percentage of olive areas per municipality, main olive-growing areas (Alentejo, Ribatejo, Beira Baixa, and Trás-os-Montes) and origin of Colletotrichum spp. isolates. For isolates collected from different locations within a municipality, a line points to the headquarters of the municipality. Numbers in boldface type represent isolates that do not belong to C. acutatum group A2, which are PT111, VM206, and PR220, C. gloeosporioides; PT170 and PT249, C. acutatum group A3; PT169, PT171, PT231, PT232, PT247, PT248, and PT254, C. acutatum group A4; PT227, C. acutatum group A5; and PT250, C. acutatum group A6. Isolate details are given in Table 1.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Main collection data for Colletotrichum spp. isolates from olive anthracnose samples used in this study, their identification, subspecific molecular grouping, and colony characteristics

Assessment of morphological and cultural characteristics.
For each isolate, the length and width of 30 conidia were measured, the length/width ratio was determined, and the shape was recorded. This was done with conidia obtained from cultures grown on potato dextrose agar (PDA; Difco, Detroit, MI), as well as Spezieller Nährstoffarmer Agar SNA (25). Data were analyzed using analysis of variance and the Tukey honest significant difference test with Statistica software (StatSoft, Tulsa, OK). The colony radius (three replicates; four measurements per replicate with statistical analysis as above) and characteristics (texture, density, color (29), zonation, transparency aspect, nature of the growing margin, presence of conidial masses, and color of the reverse side) were recorded from cultures grown for 5 days at 25°C under darkness on PDA plates. Benomyl sensitivity of the isolates was assessed by comparing colony radius on PDA and PDA amended with 2 mg · dm–3 benomyl (Benlate; Dupont, Wilmington, Delaware).

Pathogenicity assays.
Pathogenicity tests were performed with a representative set of isolates using fruits of 11 different olive cultivars and ‘Camarosa’ strawberry. Fruits were surface disinfected by immersion for 30 s in 1% NaClO, followed by rinsing in sterile distilled water and inoculation by deposition of a 20-µl droplet of a conidial suspension of 105 conidia · cm–3 containing 1% gelatin on the fruit surface. The inoculated fruits, along with appropriate controls, were incubated in 100% relative humidity at room temperature (ca. 21°C), and symptoms were recorded after 7 days for strawberries and 11 days for olives. Lupin (Lupinus albus ‘Rio Maior’) and strawberry (Fragaria x ananassa ‘Camarosa’) plants were inoculated by spraying the conidial suspension, and symptoms were recorded after 11 days. Preparation of conidial suspension and postinoculation conditions were as described above.

Molecular analyses.
For DNA extraction, fungal isolates were grown in petri dishes containing yeast extract (0.2% [wt/vol]) and glucose (1.0% [wt/vol]) liquid medium (both from Difco) for 4 days at 25°C. DNA was extracted from freeze-dried mycelium using the DNeasy Plant kit (QIAGEN, Hilden, Germany), according to the manufacturer's instructions. Arbitrarily primed PCR (AP-PCR) profiles were generated for each isolate using seven different primers (CAC5, CAG5, GAC5, GACG4, GCA5, TCC5, and MR [5' GAGGGTGGCGGTTCT3']) and the composite data for each isolate were analyzed as previously described (34). Amplification and nucleotide sequencing of the rRNA gene-ITS region and a variable region of the ß-tubulin 2 (tub2) gene were done as previously described (34).

PCR based detection of pathogens and diagnosis of molecular groups within C. acutatum.
PCR primers TBCA (5' CGGAGGCCTGGTTGGGTGAG 3') specific for C. acutatum and TBCG (5' CGGAAGCCTGGGTAGGAGCG 3') specific for C. gloesoporoides were designed from the tub2 sequences generated. Each of these primers was used in conjunction with the conserved primer TB5 (34) for diagnostic PCR of C. acutatum and C. gloesoporoides isolates or infected olive samples. Similarly, primers CaInt2 specific for C. acutatum (32) and CgInt specific for C. gloeosporioides (23) were each used in conjunction with the conserved primer ITS4 (39) for diagnostic PCR based on the rRNA gene-ITS region. Each PCR (25 µl) contained 25 ng DNA, 1 µM each primer, and 12.5 µl of ReadyMix RedTaq (Sigma-Aldrich, Gillingham, United Kingdom). Amplifications were performed with a thermal cycler (Proteus II; Helena Biosciences, Sunderland, United Kingdom) programmed for 1 cycle of 5 min at 95°C; 25 cycles, each of 1 min at 94°C, 1 min at 62°C, and 1 min at 72°C; and ending with 1 cycle of 7 min at 72°C. PCR products (each, 10 µl) were visualized by electrophoresis on 2% (wt/vol) agarose gels (Invitrogen, Paisley, United Kingdom). For the diagnosis of molecular groups within C. acutatum based on unique restriction fragment profiles, the tub2 fragment amplified with primers TB5 and TBCA (specific for C. acutatum) and TB5 and TB6 (conserved) (34) were restriction digested using enzymes StyI, NlaIII, RsaI (New England Biolabs, Hitchin, United Kingdom), and SacI (Roche Diagnostics, Mannheim, Germany). All restriction reactions were performed with ca. 500 ng DNA for 2 h at 37°C using 4 U of enzyme, following manufacturers' instructions. Restriction fragments were separated by electrophoresis on 3% agarose gels.

Nucleotide sequence accession numbers.
Nucleotide sequences generated were deposited in the EMBL database, and the accession numbers are shown in Table 1, footnote a. Nucleotide sequence analyses data were deposited in TreeBase with reference number SN2087.


arrow
RESULTS
 
AP-PCR analysis.
Of the 131 Colletotrichum spp. isolates analyzed from olive anthracnose using AP-PCR markers (6.4 bands per isolate and per primer and an average of 21.1 distinct bands for all isolates per primer), 128 isolates grouped with various C. acutatum reference isolates, while 3 isolates grouped with the C. gloeosporioides reference isolates. Although considerable diversity was recorded among the 128 C. acutatum isolates, most of these clustered with previously characterized reference C. acutatum isolates and represented molecular groups A2 to A5; none clustered with group A1 (Table 1 and Fig. 2 and 3). For example, 114 isolates collected from different parts of Portugal clustered with reference isolates CA397 and PD85/694, representing group A2. These 114 isolates, represented by isolates PT135 and PT201 (Fig. 2 and 3), showed high degree of relatedness among them with over 91% Dice similarity coefficient but exhibited only 60 to 80% similarity to the reference isolates CA397 and PD85/694. Isolates PT170 and PT249 (from Torres Vedras) clustered with reference isolates CR46 (grapevine) and CA473 (tulip tree), representing group A3. Isolates PT169, PT171, PT231, PT232, PT247, PT248, and PT254 (from Rio Maior, Lisbon, and different locations in the Trás-os-Montes region) as well as CBS193.32 (collected in Italy in 1932) and M3 and M4 (from Serbia and Montenegro), clustered together with reference isolates TN47 (medlar) and NI90 (strawberry), representing group A4. Isolate PT169 (Fig. 2 and 3) represented isolates PT171, PT232, PT248, and PT254, and CBS193.32 represented isolates M3, M4, PT231, and PT247. Isolate PT227 (from Vila Real de Santo António) was the single olive isolate grouping with PD443, representing group A5. Isolate PT250 (from Mirandela), which was distinct from all other olive anthracnose C. acutatum isolates, as well as the various reference C. acutatum isolates, was assigned to A6. Within the C. gloeosporioides cluster, isolate PT111 (from Vila Velha de Ródão) represented isolates VM206 and PR220 (from Faro and Tondela, respectively) (Fig. 2 and 3), with no differences found among the three. All the groups referred to are supported by bootstrap values of >80%.



View larger version (66K):
[in this window]
[in a new window]
  		FIG. 2. Arbitrarily primed PCR profiles obtained with primer MR for a representative set of Colletotrichum spp. isolates from olive along with reference C. acutatum and C. gloeosporioides isolates. PT30 (A1), PD85/694 and CA397 (A2), CR46 and CA473 (A3), TN47 and NI90 (A4), and PD443 (A5) are reference isolates for C. acutatum molecular groups shown. CR21 and CG315 are reference isolates for C. gloeosporioides. VI is a molecular marker (Type VI; Roche Diagnostics, Mannheim, Germany). Full details of the isolates and the C. acutatum molecular groups to which all the analyzed isolates belong are shown in Table 1.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 3. Dendrogram showing the diversity and relationships among the olive anthracnose Colletotrichum spp. isolates based on cluster analysis (UPGMA) of a similarity matrix (Dice) generated from arbitrarily primed PCR profile data with seven different primers. A total of 2,000 bootstraps were used. Cophenetic correlation coefficient r = 0.95787. Isolates PT135 and PT201 represent 114 olive anthracnose isolates clustering in group A2. Details of the previously characterized reference isolates (34) used for C. acutatum molecular groups A1 to A5 and C. gloeosporioides reference isolates are described in the legend to Fig. 2. Full details of the isolates and the C. acutatum molecular groups to which all the analyzed isolates belong are shown in Table 1.

Nucleotide sequence analysis.
Nucleotide sequences of the rRNA gene-ITS region and a variable region of the tub2 gene determined for a set of 19 to 20 representative isolates selected according to the molecular groups revealed by AP-PCR and analyzed along with a number of reference isolates showed comparable tree topologies (Fig. 4 and 5). Both the rRNA gene-ITS and the tub2 datasets analyzed according to the Kimura-2P coefficient and unweighted-pair group method with arithmetic average (UPGMA) clustering clearly revealed that olive Colletotrichum isolates PT111, VM206, and PR220 clustered together with C. gloeosporioides reference isolates, while the remaining isolates clustered together with C. acutatum reference isolates with 100% bootstrap values in each case (Fig. 4 and 5). Diversity between the C. acutatum and C. gloeosporioides isolates ranged from 9.5 to 11.0% with ITS and 17.7 to 23.4% with tub2. The olive C. acutatum isolates PT108, PT135, PT166, and PT201 clustered in group A2. The ITS sequence of these isolates was identical and showed only 0.2% difference from AF081292, representing Spanish olive anthracnose isolates (21). Overall diversity within group A2 was higher, with 0.6% for ITS and 2.58% for tub2. Isolates PT170 and PT249 clustered into A3 and isolates CBS193.32, M3, M4, PT169, PT231, PT232, PT247, PT248, and PT254 grouped into A4. Isolate PT227 grouped in A5 together with ITS sequences AF411700 and AF411701, representing, respectively, the species holotype and paratype (36), and isolate PT250 clustered in group A6 together with ITS sequence AF411704 (C. acutatum on Rhododendron sp.) (36). No olive Colletotrichum spp. isolates clustered together with group A1 (Fig. 4 and 5). Among the C. acutatum isolates, minimum intergroup divergence was 0.8% for ITS (between A5 and A2 or A3) and 3.0% for tub2 (between A1 and A2). Maximum intergroup divergence was 4.47% for ITS (between A1 and A3 or A4) and 4.89% for tub2 (between A3 and A4).



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 4. UPGMA consensus dendrogram depicting relationships among Colletotrichum spp. isolates from olive with C. acutatum and C. gloeosporioides reference isolates based on rRNA gene-ITS sequences. Sequences AF081292, AF411700, AF411701, and AF411704 were retrieved from nucleotide sequences databases. A total of 2,000 bootstrap data sets and Kimura-2P model distance matrices were used. Bootstrap values are only shown for key nodes. Full details of the isolates are shown in Table 1. C. acutatum and C. gloeosporioides isolates from hosts other than olive have been used as reference isolates, and these isolates have been previously characterized using various molecular markers (31, 34). A1 to A6, C. acutatum molecular groups.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 5. UPGMA consensus dendrogram depicting relationships among Colletotrichum spp. isolates from olive, along with C. acutatum and C. gloeosporioides reference isolates, based on the nucleotide sequences of a variable region of the ß-tubulin 2 gene. A total of 2,000 bootstrap data sets and Kimura-2P model distance matrices were used; bootstrap values are only shown for key nodes; full details of the isolates are shown in Table 1. C. acutatum and C. gloeosporioides isolates from hosts other than olive have been used as reference isolates, and these isolates have been previously characterized with various molecular markers (34). A1 to A6, C. acutatum molecular groups.

Cultural and morphological characteristics.
Measurements of the mycelial growth on PDA (Table 1) distinguished two types of isolates. The first type (C. acutatum) contained 128 of the 131 tested Colletotrichum spp. isolates from olive, including CBS 193.32 from Italy, M3 and M4 from Serbia and Montenegro isolates, and C. acutatum reference isolates, with a radial growth of 18.0 to 45.0 mm. The second type (C. gloeosporioides) included olive Colletotrichum isolates PT111, VM206, and PR220 and C. gloeosporioides reference isolates, with radial growth of 52.0 to 62.0 mm (significantly higher than that of C. acutatum isolates). These two types of isolates could also be distinguished based on mycelial growth on PDA containing 2 mg · dm–3 benomyl, where the C. gloeosporioides isolates exhibited 100% inhibition of mycelial growth, and C. acutatum isolates showed only partial (27 to 67%) inhibition. Within the olive C. acutatum isolates, colony characteristics differentiated a number of groups that, in most cases, corresponded to the groups recorded by molecular characterization: the vast majority of isolates showed white to beige colonies with greyish specks; occasionally, the lower surface was olive green (isolates VM207, PT213, and PT235) or yellow (isolate PT210), corresponding to C. acutatum group A2 (Table 1); 10 isolates had beige to grey colonies, but the center of the colony was covered with abundant orange masses of conidia, corresponding to group A4; colonies of A3 isolates (PT170 and PT249) were light pink to carmine/flesh-colored; colony of the A5 isolate (PT227) was strong purple to red; the A6 isolate (PT250) had a grey colony (data not shown).

Conidia size and shape assessment revealed high variability within each isolate and little statistically significant difference among different isolates. Conidial length was 7.7 to 12.7 µm and width was 2.8 to 4.5 µm for conidia originating from colonies grown on PDA, while length and width of conidia from SNA colonies were, respectively, 12.4 to 15.0 µm and 3.2 to 4.5 µm. No clear grouping of the Colletotrichum spp. isolates from olive was observed, apart from isolates PT111, VM206, and PR220, which along with the C. gloeosporioides reference isolates had mainly round-ended conidia from SNA cultures; isolate PT227 produced 100% acute-ended conidia on both PDA and SNA. Both the dimensions and shape of conidia recorded from SNA cultures were more uniform than from those from PDA cultures (data not shown). As an example, the average standard deviation for conidial length for a selected set of isolates was 1.74 µm on PDA and 0.96 µm on SNA.

Pathogenicity and disease incidence.
A selection of olive C. acutatum and C. gloeosporioides isolates generally representing the molecular and phenotypic diversity observed above were tested for their pathogenicity on olive and other hosts. On olive fruits, abundant sporulation and frequently intense production of mycelium were observed with all isolates tested, including the reference isolates CR20 and CR21. Based on the reactions with fruits from 11 different olive cultivars, some differences in virulence were recorded among olive Colletotrichum spp. isolates. For example, among C. acutatum, isolate PT135 from group A2 was more virulent (1.753 ± 0.783 on a symptom scale of 0 to 3; values are averages ± standard deviation of symptom rating obtained in sets of 10 fruits from 11 different cultivars) than isolates PT170 from group A3 (1.154 ± 0.718) and PT169 from group A4 (1.274 ± 0.643). C. gloeosporioides isolate PT111 showed a virulence rating of 1.874 ± 0.430.

Further, olive C. acutatum isolates PT107, PT109, PT110, PT115, PT130, PT135, PT140, PT212 (group A2), PT170 and PT249 (group A3), PT169 and PT231 (group A4), PT227 (group A5), and CR20, as well as olive C. gloeosporioides isolates PT111 and VM206 and CR21 inoculated on strawberry fruits, produced sunken necrotic lesions with orange masses of conidia and/or abundant aerial grey-whitish mycelia. No significant difference in virulence was recorded among the different isolates tested. Similarly, when strawberry and lupin plants were inoculated with the same set of isolates, no major differences in virulence were recorded and necrotic lesions on petioles, stems/runners, cotyledons, and leaves were produced by all isolates, and the pathogen was reisolated from diseased tissues (data not shown).

Olive anthracnose incidence was higher during the autumns of 2001 (disease recorded in 20 of 25 groves surveyed) and 2002 (23 of 34 groves) compared to 2003 (34 of 110 groves). However, among the rest of the groves surveyed in 2003, at least 15 samples developed symptoms upon incubation under high humidity in the laboratory (only 31% of groves had symptoms, but inoculum was present in at least 45% of the groves) enabling pathogen isolation. The proportion of groves exhibiting anthracnose symptoms varied considerably across Portugal during the autumn of 2003; in general, disease incidence was much lower in Trás-os-Montes (9%) than in the rest of the country (42%). Anthracnose incidence also varied during the maturation season, ranging from 31% (including groves where the pathogen was present but symptoms were not visible) in late October to 93% in late November, excluding the Trás-os-Montes area where the incidence of disease in general was lower. The majority of the isolates from these surveys belonged to C. acutatum group A2, while most others belonged to C. acutatum groups A3 to A6; only three isolates belonged to C. gloeosporioides (Table 1 and Fig. 1). Further, in a particular location (Alter do Chão) during spring 2003, 4-year-old olive plants of cultivar Maçanilha exhibited elongated cankers on branches from which isolates PT186 and PT187 belonging to C. acutatum group A2 were isolated (Table 1).

Pathogen detection and diagnosis of C. acutatum molecular groups by PCR.
Based on the nucleotide sequence data generated for the variable region of tub2 gene (a ca. 550-bp fragment, including three different introns), PCR primers specific for C. acutatum (TBCA) and C. gloeosporioides (TBCG) were designed. Species-specific PCR tests using the tub2 primers for C. acutatum (TB5 and TBCA) and C. gloeosporioides (TB5 and TBCG) identified 128 of the 131 Colletotrichum spp. isolates from olive as C. acutatum, along with reference isolates CMG12, PT30, PD85/694, CA397, CA473, NI90, and PD443. Isolates PT111, VM206, and PR220 were identified as C. gloeosporioides, along with reference isolates CR21 and CG315 (Fig. 6). Comparative analysis of these samples with the previously established rRNA gene-ITS based specific PCR for C. acutatum and C. gloeosporioides fully confirmed these results (Fig. 6). A clear PCR product was obtained when C. acutatum-specific primers (either for tub2 or ITS) were used with DNA extracted directly from olive fruits showing anthracnose symptoms (the DNA extraction was carried out according to the protocol by Pasqualone et al.) (27). On the contrary, DNA extracted from healthy fruits or healthy leaves yielded no pathogen-specific PCR fragment, either with C. acutatum- or with C. gloeosporioides-specific primers. These DNA samples were clearly PCR amplifiable as tested with conserved primers, and the nucleotide sequence for rRNA gene-ITS region of olive cultivar Cobrançosa was consequently obtained and deposited in EMBL (accession no. AJ585193).



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 6. Agarose gel electrophoresis of PCR products obtained with DNA of some of the Colletotrichum spp. isolates from olive and with DNA extracted from infected olive fruits using ß-tubulin 2 primers and rRNA gene-ITS primers specific for C. acutatum and C. gloeosporioides. (Top left) C. acutatum-specific products generated with ß-tubulin 2 primers TB5 and TBCA from fungal cultures and infected olive fruit; (bottom left) C. gloeosporioides-specific products generated with ß-tubulin 2 primers TB5 and TBCG from fungal cultures; (top right) C. acutatum-specific products generated with rRNA gene-ITS primers CaInt2 and ITS4 (32) from corresponding samples on left; (bottom right) C. gloeosporioides-specific products generated with rRNA gene-ITS primers CgInt and ITS4 (23) from corresponding samples on left. DNA from healthy olive fruits and olive leaves and water were used as controls. M, molecular marker (100-bp Low; Invitrogen, Paisley, United Kingdom); CG, C. gloeosporioides; A1 to A6, C. acutatum molecular groups.

For the diagnosis of molecular groups within C. acutatum, tub2 nucleotide sequences were analyzed with MapDraw 5.03 (DNAstar Inc., Madison, WI), and a set of restriction enzymes was selected, enabling the production of unique profiles for each of the C. acutatum molecular groups A1 to A6. These enzymes were applicable to the 328- to 330-bp C. acutatum-specific fragment obtained with primers TB5 and TBCA, as well as to the 549- to 551-bp fragment obtained with the conserved primers TB5 and TB6 (34). A maximum of three separate restriction reactions was required to identify the various groups as follows. (i) Digestion of either TB5 and TBCA or TB5 and TB6 amplified fragments of tub2 with StyI produced unique profiles for isolates of C. acutatum groups A2, A3, and A5 (Fig. 7), but A1, A4, and A6 were indistinguishable. (ii) The use of NlaIII allowed the identification of A1. (iii) Digestion with SacI distinguished A6, identifying the rest of the isolates as A4 (Fig. 7). Nevertheless, to test whether a C. acutatum isolate belonged to a particular group, identification based on a single enzyme digestion is achievable using StyI for groups A2, A3, and A5 or SacI for A6. Two separate restriction digestions with StyI and NlaIII were required for group A1; similarly, RsaI and NlaIII digestions were required for A4.



View larger version (82K):
[in this window]
[in a new window]
  		FIG. 7. Restriction profiles of ß-tubulin 2 fragments amplified by conserved primers TB5 and TB6 as well as Colletotrichum acutatum-specific primers TB5 and TBCA obtained with enzymes StyI, NlaIII, SacI, and RsaI enabling the distinction of C. acutatum groups A1 to A6 (groups distinguishable with each enzyme are shown next to enzyme name). Isolates representing each group were selected to cover the genetic diversity determined within these groups based on nucleotide sequence analyses (Fig. 4 and 5). PCR product directly amplified from an infected olive sample and digested with various enzymes is also included (inf. olive). M, molecular marker (100-bp Low; Invitrogen, Paisley, United Kingdom). A limited number of isolates yielded atypical profiles with some enzymes that were not used for distinguishing the corresponding groups (for example, isolate PD85/694 identified as A2 with StyI yielded an A1-like profile with NlaIII; isolate CA473 identified as A3 with StyI yielded a non-A3 profile with SacI for the TB5 and TB6 fragment) and did not affect the group identifications.


arrow
DISCUSSION
 
Molecular and phenotypic characterization of 131 Colletotrichum spp. isolates associated with olive anthracnose and comparative analysis with a range of reference C. acutatum and C. gloeosporioides isolates identified 128 isolates as C. acutatum and only 3 isolates as C. gloeosporioides. AP-PCR markers and rRNA gene-ITS and tub2 nucleotide sequence data strongly supported these results. Cultural characteristics such as colony radial growth and (particularly) benomyl sensitivity also revealed two distinct types of isolates corresponding to C. acutatum and C. gloeosporioides, as has been observed with previous investigations of various hosts (1, 19, 34). On the contrary, conidial morphology was less informative than in previous studies (6, 33), although conidia were also assessed from SNA medium, recognized as producing less conidial variability (25). However, application of species-specific PCR using the tub2-based primers developed for C. acutatum and C. gloeosporioides in the current study, as well as the previously available primers based on rRNA gene-ITS (23, 32), provided rapid and reliable diagnosis of isolates belonging to C. acutatum and C. gloeosporioides from olives. Conflicting reports exist in the literature on the causal agent(s) of olive anthracnose in different geographic locations (3, 5, 17, 20, 21, 24), and the current study has clearly established C. acutatum as the dominant pathogen (>97%) with very limited occurrence of C. gloeosporioides (<3%). This is the first report on the existence of diverse molecular groups among C. acutatum populations associated with olive anthracnose. AP-PCR markers, as well as the ITS and tub2 nucleotide sequences, consistently divided the C. acutatum populations into five molecular groups, which mostly correlated with various morphological groups based on different colony characteristics. Interestingly, at least three of these groups correspond to previously described C. acutatum groups A2, A3, and A4 from other hosts (34), while A5 and A6 are newly described groups. On the other hand, no olive anthracnose isolates clustered into C. acutatum group A1, which comprises the vast majority of isolates causing lupin anthracnose (34). Thus in all, C. acutatum populations associated with a wide range of hosts appear to fit into at least six molecular groups, which could be related to various C. acutatum sensu lato groups described based on morphology and randomly amplified polymorphic DNA analyses (16) and mitochondrial DNA-restriction fragment length polymorphism and sequence variations in introns of two different genes (13).

The vast majority of C. acutatum olive anthracnose isolates displaying >91% similarity belonged to group A2 (89%), which included isolates collected from major olive-producing areas of Alentejo (100% of isolates were A2), Ribatejo (94% were A2), and Beira Baixa (97% were A2) in Portugal. Groups A3, A4, A5, and A6 comprised the remaining 11% C. acutatum isolates and were mostly restricted in their occurrence, except A4, which is predominant in the Trás-os-Montes region (where 5 out of 8 isolates were A4, while only 2 out of 120 isolates from the rest of Portugal were A4). This represents a different scenario than with C. acutatum populations from other hosts. For example, two distinct clonal subpopulations were found on almonds in California (8), a clonal group and a variable group were found on strawberries in Europe and America (7), and one homogenous group mainly represented a global collection from lupins (34). Further, preliminary comparative analysis of the olive anthracnose isolates from Portugal with the limited information available elsewhere (3, 21, 38) suggests that C. acutatum groups A2 and A4 are likely to be the key pathogens in other countries.

Within Portugal, C. acutatum isolates PT170 and PT249 (A3) from Torres Vedras, PT227 (A5) from Vila Real de Santo António, and PT247 (A4) from Lisbon, as well as C. gloeosporioides isolates VM206 from Faro and PR220 from Tondela, were obtained from areas where olive cultivation is less important/marginal. These could represent cross-infection events or recently adapted pathogens, with Colletotrichum pathogens from other hosts causing anthracnose symptoms on olive, as has been observed by Freeman et al. (12) among C. acutatum populations from anemone and strawberry. Interestingly, during the autumns of 2001 and 2002, when meteorological conditions were particularly favorable and anthracnose incidence was high (68 to 80% of groves had symptoms), C. acutatum group A2 was vastly dominant (95% of isolates obtained). In the autumn of 2003, with less favorable conditions and lower incidence (31% of groves had symptoms), the proportion of isolates not belonging to C. acutatum group A2 was much higher (21%). A different scenario occurs in Trás-os-Montes, where olive anthracnose used to be very rare (R. Sismeiro, personal communication). The 9% incidence recorded in 2003 surveys reflects recent spread of the disease, and the main pathogen found was C. acutatum group A4, along with isolates from A2 and A6. Group A4 included previously characterized C. acutatum isolates from medlar, strawberry, and Ceanothus sp., while group A3 included isolates from grapevine and several ornamentals. Interestingly, C. acutatum isolates belonging to groups A3 and A4 have recently been isolated from grapevine and medlar, which are common in Portugal, the latter more frequently as a backyard fruit tree. Moreover, C. acutatum isolates belonging to different molecular groups showed differences in their virulence in olive, with A2 the dominant group tending to be more virulent than those from groups A3 and A4. Isolates clustering in C. acutatum group A2 are frequently isolated from strawberry (a common horticultural crop) and various ornamentals. A6 included some of the recently described C. acutatum isolates from Rhododendron spp. (36) and isolates from papaya, Phlox sp., and Statice sp. grouped in A5. This group included the C. acutatum holotype and paratype from papaya based on ITS sequences, from dry herbarium specimens obtained by Vinnere et al. (36). However, the fact that the type specimens are included in A5 may not necessarily mean that this group represents the early form of C. acutatum, as CBS193.32, originally identified from olives in 1932, is clearly shown in this study to be C. acutatum. This contradicts the view that C. acutatum, a taxon described by Simmonds in 1965 (30), spread recently due to the extensive use of fungicides such as benomyl to which C. acutatum is moderately resistant (1, 14). Moreover, the acute-ended nature of conidia was one of the major criteria for the definition of C. acutatum, but it appears that only certain isolates clustering directly with the type specimen in C. acutatum group A5 (for example, isolate PT227) possessed 100% acute-ended conidia with grown on both PDA and SNA media. In general, considerable variation in conidial morphology was observed with the vast majority of C. acutatum isolates analyzed. This causes difficulties in reliably diagnosing the isolates where colony characteristics and molecular traits were compatible with C. acutatum, but conidia were not acute ended (34).

Cooccurrence of C. acutatum and C. gloeosporioides on a very limited scale was previously reported from Spain (21). In this study, despite analyzing more than one isolate from the same fruit from 17 different locations (41 isolates), these two pathogens were not observed together. C. gloeosporioides represents <3.0% of the total number of olive anthracnose isolates studied currently, which is comparable to the 3.7% level recorded in Spain (22). However, the symptoms on olive fruits from which C. gloeosporioides was isolated were indistinguishable from those caused by C. acutatum; equally importantly, the C. gloeosporioides isolate tested was at least as virulent as the most virulent C. acutatum isolates on mature detached olive fruits. C. gloeosporioides is well recognized as a maturation or postharvest pathogen in a wide range of fruit crops such as coffee (35), citrus (40), and several tropical or subtropical fruits such as avocado, guava, papaya, mango, and passion fruit (28). Thus, the role and relative importance of C. gloeosporioides in olive anthracnose and cooccurrence with C. acutatum need to be addressed. Further, isolates PT169 and PT171 belonging to C. acutatum group A4 were initially identified from two different locations. Of these, more A4 isolates were obtained subsequently at Trás-os-Montes where PT169 was found, whereas no anthracnose was recorded at the location where PT171 was found, and isolates from surrounding sites belonged to C. acutatum A2. Further monitoring is essential to determine whether any of the smaller C. acutatum groups will become more widespread. Significantly, isolates PT186 and PT187 belonging to C. acutatum A2 were also found on branches of young olive plants in the Alentejo region, suggesting that the elongated cankers on the branches were caused by the fruit anthracnose pathogen. Necrosis of olive leaves and shoots caused by anthracnose pathogens C. acutatum and C. gloeosporioides either naturally or under controlled conditions has previously been reported, and infected leaves and shoots were suggested as the major inoculum sources for fruit anthracnose in autumn (5, 20). Our observations indicate that overwintering infected fruit mummies could also serve as inoculum sources. Thus, the olive anthracnose pathogen epidemiology needs to be further investigated, as C. acutatum has also been reported to exhibit epiphytic, endophytic, and nonpathogenic lifestyles on other crops (9, 18).

In this context, the C. acutatum- and C. gloeosporioides-specific primers TBCA and TBCG, respectively, developed in this work together with the conserved primer TB5 (34) amplified the tub2 gene fragment specific for these pathogens with all samples tested reliably. This included isolates belonging to all six C. acutatum molecular groups. These primers, based on the single-copy tub2 gene (26), constitute an alternative to the use of ITS-based specific primers (23, 32), as there is some concern over the potential for existence of divergent ITS copies within monosporic fungal cultures (15). Combined use of diagnostic PCR and restriction digestion of the amplicon allows the rapid and reliable diagnosis of C. acutatum molecular groups, for example, using TB5 and TBCA. Amplicons with conserved primers TB5 and TB6 are also useful as they are larger, yielding better resolution of the digested products. The proposed set of enzymes was chosen taking into consideration the maximum nucleotide sequence variation occurring within each C. acutatum group: for example, isolates PD85/694 and CA397 in A2 and CA473 and PT170 in A3. A protocol for DNA extraction from olive fruits (27), stems, and leaves was tested, enabling the extraction of PCR-amplifiable DNA and successful direct detection of Colletotrichum spp. and group identification using these primers. The C. acutatum- and C. gloeosporioides-specific primers based on tub2, which is known as a housekeeping gene, are also likely to be useful for RT-PCR-based quantification of viable pathogen propagules in asymptomatic and early infections.

This work has clearly demonstrated that diverse C. acutatum groups and a low level of C. gloeosporioides isolates are associated with olive anthracnose in Portugal. Further, there appears to be a degree of correlation between high disease incidence along with favorable environmental conditions and the widespread prevalence of C. acutatum group A2, as shown by the low incidence of disease and the frequency of group A4 in Trás-os-Montes and the sporadic occurrence of C. acutatum groups A3, A5, and A6 and C. gloeosporioides in marginal cropping locations in Portugal. Moreover, this work has shown the variation in the virulence of the olive anthracnose pathogen isolates, as well as their cross-infection potential, which has implications for both disease control and the host adaptability of pathogen populations. Further investigations are essential to understand the temporal and spatial dynamics of pathogen populations in relation to olive anthracnose spread and severity, as well as any interchange of pathogens among different hosts such as citrus, strawberry, medlar, almond, and peach in the Mediterranean region and other geographic locations like Australia, South Africa, and Chile. In these locations, there is growing interest in olive cultivation, and anthracnose has already been recorded (for example) in Australia (Barbara Smith, personal communication), China (20), and India (24). The diagnostic tools developed could be utilized in pathogen population analysis and epidemiology so that the knowledge and resources generated can be exploited for more efficient management of host resistance and improved disease control can be achieved.


arrow
ACKNOWLEDGMENTS
 
We are thankful to Jelena Latinovi for kindly supplying isolates M3 and M4 and to Ana Cabral, Cecília Rego, Filomena Caetano, Lídia Farropas, Paula Ferreira, Paula Ramos, and Vania Marques for help in field surveys and isolation, identification, and morphological characterization of cultures.

P.T. was financially supported by the Fundação para a Ciência e a Tecnologia (Portugal), grant BPD/7161/2001.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Instituto Superior de Agronomia, Tapada da Ajuda, 1349-017 Lisbon, Portugal. Phone: 351 213653100. Fax: 351 213635031. E-mail: ptalhinhas{at}isa.utl.pt. Back


arrow
REFERENCES
 
    1
  1. Adaskaveg, J. E., and R. J. Hartin. 1997. Characterization of Colletotrichum acutatum isolates causing anthracnose of almond and peach in California. Phytopathology 87:979-987.[Medline]
    2. 2
  2. Afanador-Kafuri, L., D. Minz, M. Maymon, and S. Freeman. 2003. Characterization of Colletotrichum isolates from tamarillo, passiflora, and mango in Colombia and identification of a unique species from the genus. Phytopathology 93:579-587.[CrossRef][Medline]
    3. 3
  3. Agosteo, G. E., G. Magnano di San Lio, S. O. Cacciola, and S. Frisullo. 2002. Characterisation of the causal agent of olive anthracnose in southern Italy. Acta Hortic. 586:713-716.
    4. 4
  4. Brown, A. E., S. Sreenivasaprasad, and L. W. Timmer. 1996. Molecular characterization of slow-growing orange and key lime anthracnose strains of Colletotrichum from citrus as C. acutatum. Phytopathology 86:523-527.[CrossRef]
    5. 5
  5. Cacciola, S. O., G. E. Agosteo, A. Pane, and Magnano di San Lio. 1996. Osservazioni sull'epidemiologia dell'antracnosi dell'olivo in Calabria. Inf. Fitopat. 46:27-32.
    6. 6
  6. Denoyes, B., and A. Baudry. 1995. Species identification and pathogenicity study of French Colletotrichum strains isolated from strawberry using morphological and cultural characteristics. Phytopathology 85:53-57.
    7. 7
  7. Denoyes-Rothan, B., G. Guerin, C. Delye, B. Smith, D. Minz, M. Maymon, and S. Freeman. 2003. Genetic diversity and pathogenic variability among isolates of Colletotrichum from strawberry. Phytopathology 93:219-228.[Medline]
    8. 8
  8. Förster, K., and J. E. Adaskaveg. 1999. Identification of subpopulations of Colletotrichum acutatum and epidemiology of almond anthracnose in California. Phytopathology 89:1056-1065.[Medline]
    9. 9
  9. Freeman, S., S. Horowitz, and A. Sharon. 2001. Pathogenic and nonpathogenic lifestyles in Colletotrichum acutatum from strawberry and other plants. Phytopathology 91:986-992.[Medline]
    10. 10
  10. Freeman, S., T. Katan, and E. Shabi. 1998. Characterization of Colletotrichum species responsible for anthracnose diseases of various fruits. Plant Dis. 82:596-605.[CrossRef]
    11. 11
  11. Freeman, S., D. Minz, E. Jurkevitch, M. Maymon, and E. Shabi. 2000. Molecular analyses of Colletotrichum species from almond and other fruits. Phytopathology 90:608-614.[Medline]
    12. 12
  12. Freeman, S., E. Shabi, and T. Katan. 2000. Characterization of Colletotrichum acutatum causing anthracnose of anemone (Anemone coronaria L.). Appl. Environ. Microbiol. 66:5267-5272.[Abstract/Free Full Text]
    13. 13
  13. Guerber, J. C., B. Liu, J. C. Correll, and P. R. Johnston. 2003. Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility. Mycologia 95:872-895.[Abstract/Free Full Text]
    14. 14
  14. Kuramae-Izioka, E. E., C. R. Lopes, N. L. Souza, and M. A. Machado. 1997. Morphological and molecular characterization of Colletotrichum spp. from citrus orchards affected by postbloom fruit drop in Brazil. Eur. J. Plant Pathol. 103:323-329.[CrossRef]
    15. 15
  15. Lanfranco, L., M. Delpero, and P. Bonfante. 1999. Intrasporal variability of ribosomal sequences in the endomycorrhizal fungus Gigaspora margarita. Mol. Ecol. 8:37-45.[CrossRef][Medline]
    16. 16
  16. Lardner, R., P. Johnston, K. Plummer, and M. Pearson. 1999. Morphological and molecular analysis of Colletotrichum acutatum sensu lato. Mycol. Res. 103:275-285.[CrossRef]
    17. 17
  17. Latinovi, J., and Z. Vucini. 2002. Cultural characteristics, pathogenicity, and host range of Colletotrichum gloeosporioides isolated from olive plants in Montenegro. Acta Hortic. 586:753-755.
    18. 18
  18. Li, W., R. C. Yuan, J. K. Burns, L. W. Timmer, and K. R. Chung. 2003. Genes for hormone biosynthesis and regulation are highly expressed in citrus flowers infected with the fungus Colletotrichum acutatum, causal agent of postbloom fruit drop. J. Am. Soc. Hortic. Sci. 128:578-583.
    19. 19
  19. Liyanage, H. D., W. Koller, R. T. McMillan, and H. C. Kistler. 1993. Variation in cutinase from 2 populations of Colletotrichum gloeosporioides from citrus. Phytopathology 83:113-116.
    20. 20
  20. Margarita, L., A. Porta-Puglia, and A. Quacuarelli. 1988. China—Colletotrichum acutatum on olive trees. FAO Plant Prot. Bull. 36:185-186.
    21. 21
  21. Martín, M., and F. García-Figueres. 1999. Colletotrichum acutatum and C. gloeosporioides cause anthracnose on olives. Eur. J. Plant Pathol. 105:733-741.[CrossRef]
    22. 22
  22. Martín, M., F. García-Figueres, and A. Trapero. 2002. Iniciadores específicos para detectar las especies de Colletotrichum causantes de la antracnosis del os olivos. Bol. Sanid. Veg. Plagas 28:43-50.
    23. 23
  23. Mills, P. R., S. Sreenivasaprasad, and A. E. Brown. 1992. Detection and differentiation of Colletotrichum gloeosporioides isolates using PCR. FEMS Microbiol. Lett. 98:137-144.[CrossRef]
    24. 24
  24. Mugnai, L., G. Surico, and A. Ragazzi. 1993. Glomerella cingulata on olive in India: morphological and pathological notes. Bull. OEPP 23:449-455.
    25. 25
  25. Nirenberg, H. 1976. Untersuchungen uber die morphologische and biologische differenzierung in der Fusarium-sektion Liseola. Mitt. Biol. Bundesanst. Land-Forstwirtsch. Berlin-Dahlem. 169:1-117.
    26. 26
  26. Panaccione, D. G., and R. M. Hanau. 1990. Characterization of two divergent ß-tubulin genes from Colletotrichum graminicola. Gene 86:163-170.[CrossRef][Medline]
    27. 27
  27. Pasqualone, A., F. Caponio, and A. Blanco. 2001. Inter-simple sequence repeat DNA markers for identification of drupes from different Olea europaea L. cultivars. Eur. Food Res. Technol. 213:240-243.[CrossRef]
    28. 28
  28. Peres, N. A. R., E. E. Kuramae, M. S. C. Dias, and N. L. de Souza. 2002. Identification and characterization of Colletotrichum spp. affecting fruit after harvest in Brazil. J. Phytopathol. 150:128-134.[CrossRef]
    29. 29
  29. Saccardo, P. A. 1891. Chromotaxia seu nomenclator colorum polyglottus adclitis speciminibus coloratis ad botanicorum et zoologorum. Padua, Italy.
    30. 30
  30. Simmonds, J. H. 1965. A study of the species of Colletotrichum causing ripe fruit rots in Queensland. Queensl. J. Agric. Anim. Sci. 22:437-459.
    31. 31
  31. Sreenivasaprasad, S., A. E. Brown, and P. R. Mills. 1992. DNA sequence variation and interrelationships among Colletotrichum species causing strawberry anthracnose. Physiol. Mol. Plant Pathol. 41:265-281.[CrossRef]
    32. 32
  32. Sreenivasaprasad, S., K. Sharada, A. E. Brown, and P. R. Mills. 1996. PCR-based detection of Colletotrichum acutatum on strawberry. Plant Pathol. 45:650-655.[CrossRef]
    33. 33
  33. Talhinhas, P. 2002. Lupinus genus germplasm characterisation, anthracnose resistance evaluation and study of diversity and taxonomy of the causal agent (Colletotrichum acutatum Simmonds ex Simmonds). Ph.D. thesis. Instituto Superior de Agronomia (Universidade Técnica de Lisboa), Lisbon, Portugal.
    34. 34
  34. Talhinhas, P., S. Sreenivasaprasad, J. Neves-Martins, and H. Oliveira. 2002. Genetic and morphological characterisation of Colletotrichum acutatum causing anthracnose of lupins. Phytopathology 92:986-996.[CrossRef][Medline]
    35. 35
  35. Várzea, V. M. P., C. J. Rodrigues, and B. G. Lewis. 2002. Distinguishing characteristics and vegetative compatibility of Colletotrichum kahawae in comparison with other related species from coffee. Plant Pathol. 51:202-207.
    36. 36
  36. Vinnere, O., J. Fatehi., S. Wright, and B. Gerhardson. 2002. The causal agent of anthracnose of Rhododendron in Sweden and Latvia. Mycol. Res. 106:60-69.[CrossRef]
    37. 37
  37. von Arx, J. A. 1970. A revision of the fungi classified as Gloeosporium. Bibl. Mycol. 24:1-203.
    38. 38
  38. Vucini, Z., and J. Latinovi. 1999. Colletotrichum gloeosporioides, a new olive (Olea europaea L.) parasite in Yugoslavia. Acta Hortic. 474:577-579.
    39. 39
  39. White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322. In M. Innis, D. Gelfand, J. Sninsky, and T. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA.
    40. 40
  40. Zulfiqar, M., R. H. Brlansky, and L. W. Timmer. 1996. Infection of flower and vegetative tissues of citrus by Colletotrichum acutatum and C. gloeosporioides. Mycologia 88:121-128.

Applied and Environmental Microbiology, June 2005, p. 2987-2998, Vol. 71, No. 6
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.6.2987-2998.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Marcelino, J., Giordano, R., Gouli, S., Gouli, V., Parker, B. L., Skinner, M., TeBeest, D., Cesnik, R. (2008). Colletotrichum acutatum var. fioriniae (teleomorph: Glomerella acutata var. fioriniae var. nov.) infection of a scale insect. Mycologia 100: 353-374 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Talhinhas, P.
Right arrow Articles by Oliveira, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Talhinhas, P.
Right arrow Articles by Oliveira, H.
Agricola
Right arrow Articles by Talhinhas, P.
Right arrow Articles by Oliveira, H.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»