Previous Article | Next Article 
Applied and Environmental Microbiology, July 2005, p. 3866-3871, Vol. 71, No. 7
0099-2240/05/$08.00+0 doi:10.1128/AEM.71.7.3866-3871.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
An Internal Reference Technique for Accurately Quantifying Specific mRNAs by Real-Time PCR with Application to the tceA Reductive Dehalogenase Gene
David R. Johnson,
Patrick K. H. Lee,
Victor F. Holmes, and
Lisa Alvarez-Cohen*
Department of Civil and Environmental Engineering, University of California, Berkeley, California
Received 18 September 2004/
Accepted 4 February 2005

ABSTRACT
The accuracy of mRNA quantification by reverse transcription
(RT) in conjunction with real-time PCR (qPCR) is limited by
mRNA losses during sample preparation (cell lysis, RNA isolation,
and DNA removal) and by inefficiencies in reverse transcription.
To control for these losses and inefficiencies, a technique
was developed that utilizes an exogenous internal reference
mRNA (
ref mRNA) along with mRNA absolute standard curves. The
technique was applied to quantify mRNA of the trichloroethene
(TCE) reductive dehalogenase-encoding
tceA gene in an anaerobic
TCE-to-ethene dechlorinating microbial enrichment. Compared
to RT-qPCR protocols that utilize DNA absolute standard curves,
application of the new technique increased measured quantities
of
tceA mRNA by threefold, demonstrating a substantial improvement
in quantification. The technique was also effective for quantifying
the loss of mRNA during specific steps of the sample processing
protocol. Analysis revealed that the efficiency of the RNA isolation
(56%) step was significantly less than that of the cell lysis
(84%), DNA removal (93%), and RT (88%) steps. The technique
was applied to compare the effects of cellular exposure to different
chlorinated ethenes on
tceA expression. Results show that exposure
to TCE or
cis-1,2-dichloroethene resulted in 25-fold-higher
quantities of
tceA mRNA than exposure to vinyl chloride or chlorinated
ethene starvation.

INTRODUCTION
The application of reverse transcription (RT) in conjunction
with real-time PCR (qPCR) is rapidly becoming the preferred
approach for quantifying specific mRNAs from environmentally
relevant microbial samples (
2,
3,
6-
13,
22,
31,
36,
38,
39,
41) (for technical reviews of RT-qPCR, see references
4,
5,
15, and
32). RT-qPCR is distinguished from alternative RNA quantification
methods, such as Northern blotting, in situ hybridization, RNase
protection assays, RT-PCR, and microarray analyses, by its ability
to rapidly analyze large numbers of samples while maintaining
high degrees of both sensitivity and specificity (
4,
15). The
accuracy of RT-qPCR measurements, however, is limited by mRNA
losses during sample preparation and by inefficiencies in reverse
transcription (
4,
5,
15). Loss of mRNA during sample preparation
may result from the incomplete lysis of cells, enzymatic and
abiotic degradation, incomplete volume transfers and phase separations,
and, when mRNA is isolated using glass fiber binding columns,
incomplete adsorption to filters. Inefficient reverse transcription
may result from inhibition of the reverse transcriptase by residual
alcohol, phenol, and salts.
To control for some or all of these losses and inefficiencies, mRNA quantities are frequently normalized to a reference measurement. One common approach is to normalize mRNA quantities to the mass of total RNA analyzed (4). This approach has two principal drawbacks. First, total RNA is composed of mRNA, rRNA, tRNA, and small noncoding RNAs. Since the stabilities of these RNAs may significantly differ, normalizing to the mass of total RNA cannot specifically control for the degradation and loss of mRNA (5). Second, to accurately compare mRNA quantities from different samples, the mass of total RNA per cell must not significantly differ between the samples of interest. The mass of total RNA per cell, however, can change dramatically throughout cellular growth cycles and with different environmental conditions (17, 26).
As an alternative, mRNA quantities can be normalized to the quantity of mRNA of an endogenous housekeeping gene (4, 5). Assuming that target and housekeeping mRNAs behave similarly, the processing and amplification of both mRNAs in parallel can control for mRNA losses during sample preparation, including enzymatic and abiotic degradation, and for inefficiencies in reverse transcription. Accurate comparison of mRNA quantities between different samples, however, requires the expression levels of the selected housekeeping genes to remain relatively stable. As with the mass of total RNA, dramatic changes in the expression levels of housekeeping genes have been observed in both eukaryotic (35, 42, 43) and prokaryotic (36) cells.
In this study, a third normalization approach is developed that utilizes an exogenous internal reference mRNA (ref mRNA). The ref mRNA is an in vitro-transcribed mRNA described as "exogenous" because it is not found in the sample of interest, "internal" because it is added to culture samples prior to sample processing, and "reference" because the initial amount is known. After sample processing, the recovered quantities of ref and target mRNAs are independently measured by multiplex real-time PCR using independent standard curves and the absolute standard curve method (19, 27). The sample-specific fractional recovery of ref mRNA is then used as a normalization factor to control for the loss of mRNA during the cell lysis, RNA isolation, and DNA removal steps. The primary advantage of this approach is that measurements are independent of cell state, growth stage, and gene expression level, consequently allowing for accurate comparison of mRNA quantities across different experimental conditions. One limitation of this approach, however, is that it cannot control for mRNA losses resulting from the incomplete lysis of cells. Therefore, the cell lysis procedure must be carefully optimized for the specific organism of interest.
The ref mRNA technique developed here was applied to quantify mRNA of the trichloroethene (TCE) reductive dehalogenase-encoding tceA gene in an anaerobic TCE-to-ethene dechlorinating microbial enrichment. Although ref mRNA techniques have been applied to mammalian (1, 18, 34) and plant (25) cells, to our knowledge this is the first application to prokaryotic cells or to complex microbial communities.

MATERIALS AND METHODS
Microbial culture.
The anaerobic TCE-to-ethene dechlorinating microbial enrichment,
designated ANAS, and procedures for culture maintenance have
been previously described (
29). Briefly, cells were grown in
a continuously stirred semibatch reactor at 25 to 28°C.
The total reactor volume was 1.5 liters, and the liquid volume
was 400 ml. To prevent oxygen intrusion, the reactor was pressurized
to 1.8 atm with N
2/CO
2 (90:10). The reactor was periodically
amended with a total of 111 µmol TCE (approximate aqueous
concentration of 0.1 mM) and with sodium lactate to an aqueous
concentration of 25 mM. After complete dechlorination of all
the TCE to ethene, which typically required 7 days, the reactor
was purged with N
2 and 60 to 100 ml of culture was withdrawn
and replaced with an equal volume of fresh anaerobic medium.
For chlorinated ethene exposure experiments, 100 ml of culture was transferred to a 160-ml anaerobic bottle and maintained in the absence of chlorinated ethenes for 72 h. Thereafter, 25-ml aliquots were transferred to four parallel 70-ml anaerobic bottles. The subcultures were purged with N2/CO2 (90:10) for 15 min and amended with sodium lactate to an aqueous concentration of 4 mM. Three of the subcultures were further amended with 6 µmol of TCE, cis-1,2-dichloroethene (cDCE) (added as chlorinated ethene-saturated water), or vinyl chloride (VC) (added as a pure gas). The fourth subculture was starved of chlorinated ethenes to serve as a control. Subcultures were incubated at 30°C for 8 h with shaking while chlorinated ethene concentrations were monitored by gas chromatography. Cells for mRNA and protein analyses were collected from 1-ml culture samples by centrifugation (5 min at 10,000 x g) in RNase-free 2-ml screw-cap microcentrifuge tubes. The supernatants were discarded, and the cell pellets were stored at 80°C until further processing.
Cell lysis and RNA isolation (acid phenol method).
Cells were lysed and RNA was isolated using a modified method of Siering and Ghiorse (33). Frozen cell pellets were resuspended in 250 µl lysis buffer (50 mM sodium acetate, 10 mM EDTA; pH 5.1), 100 µl 10% sodium dodecyl sulfate, 1.0 ml pH 4.3 buffer-equilibrated phenol (Sigma Chemical Company, St. Louis, MO), and 2 µl of 108 transcripts µl1 luciferase control RNA (Promega, Madison, WI). Cells were lysed by amending samples with 1 g 100-µm-diameter zirconia-silica beads (Biospec Products, Bartlesville, OK), heating them to 65°C for 2 min, bead beating them with a Mini Bead Beater (Biospec Products) for 2 min, incubating them for 10 min at 65°C, and bead beating them for an additional 2 min. Cellular debris was collected by centrifugation (5 min at 15,000 x g), and the aqueous lysate was transferred to a new RNase-free microcentrifuge tube.
RNA was isolated by being extracted twice with 1 volume of pH 4.3 buffer-equilibrated phenol:chloroform:isoamyl alcohol (125:24:1) and once with 1 volume of chloroform:isoamyl alcohol (24:1) (Sigma Chemical Company). Isolated RNA was precipitated overnight at 20°C with 0.5 volume of 7.5 M ammonium acetate, 2 volumes of absolute ethanol, and 2 µl of 10 µg µl1 glycogen (Fermentas, Hanover, MD). The precipitate was collected by centrifugation, washed once with 80% ethanol, and resuspended in 40 µl of diethyl pyrocarbonate-treated deionized water (ISC BioExpress, Kaysville, UT).
Alternative cell lysis and RNA isolation methods.
In addition to the acid phenol method described above, cells were lysed and RNA was isolated using two different commercial kits, the UltraClean Microbial RNA kit (Mo Bio Laboratories, Carlsbad, CA) and the RiboPure Bacteria kit (Ambion, Austin, TX). For both kits, total RNA was isolated from 1-ml ANAS culture samples according to the manufacturers' instructions.
DNA removal.
Contaminating DNA was removed by DNase I treatment using the DNA-free kit (Ambion). To stringently remove contaminating DNA, two serial 50-µl DNase I treatment reactions were performed: the first reaction mixture contained 4 U DNase I, and the second contained 2 U DNase I. Treated RNA was stored at 80°C prior to further use.
qPCR standards.
DNA standards for tceA were synthesized by cloning a 3.6-kb region containing the entire tceA open reading frame into the pCR 2.1-TOPO plasmid (Invitrogen, Carlsbad, CA). Recombinant plasmid DNA was purified from a 100-ml Escherichia coli culture using a standard alkali lysis ethanol precipitation protocol (30). Mass of DNA per volume was quantified using the PicoGreen double-stranded DNA quantitation kit (Molecular Probes, Eugene, OR) according to the manufacturer's instructions. Copy number of tceA DNA per volume was calculated using a recombinant plasmid size of 7.5 kb and an average molecular mass of 660 Da nucleotide pair1. When single-stranded cDNA samples produced by RT were quantified, the theoretical copy number of the tceA double-stranded DNA standard was multiplied by two.
Standards for tceA mRNA were synthesized by linearizing tceA-containing plasmid DNA with XmnI restriction endonuclease (New England Biolabs, Beverly, MA), followed by in vitro transcription using T7 RNA polymerase (Roche Diagnostics, Indianapolis, IN). Plasmid template was removed by DNase I treatment using the DNA-free kit (Ambion) according to the manufacturer's instructions. Effective plasmid digestion and synthesis of transcripts of the expected size were confirmed by DNA and RNA analyses on a 2100 Bioanalyzer (Agilent, Palo Alto, CA). The standard for ref mRNA was purchased from Promega (luciferase control RNA [1 mg ml1]). Masses of both tceA and ref mRNA per volume were quantified with the RiboGreen RNA quantification kit (Molecular Probes) according to the manufacturer's instructions. Copy numbers of tceA and ref mRNA per volume were calculated using transcript sizes of 1.6 kb and 1.8 kb, respectively, and an average molecular mass of 330 Da nucleotide1.
Primers and probes.
TaqMan primer-probe sets were purchased from PE Applied Biosystems, Foster City, CA. One set was designed to target all the tceA gene sequences currently deposited in the NCBI GenBank database (www.ncbi.nlm.nih.gov) (accession numbers AF228507, AY165309, AY165310, AY165311, and AY165312) (tceA forward primer ATCCAGATTATGACCCTGGTGAA, tceA reverse primer GCGGCATATATTAGGGCATCTT, tceA probe 6-carboxyfluorescein-TGGGCTATGGCGACCGCAGG-6-carboxytetramethylrhodamine). A second primer-probe set was designed to target ref mRNA (luciferase, accession number X65316) (ref forward primer TACAACACCCCAACATCTTCGA, ref reverse primer GGAAGTTCACCGGCGTCAT, ref probe VIC-CGGGCGTGGCAGGTCTTCCC-6-carboxytetramethylrhodamine). The tceA and ref reverse primers were used for both reverse transcription and qPCR amplification.
Quantification of reverse transcription efficiency.
Serially diluted tceA mRNA standards were reverse transcribed using the RT core reagent kit (PE Applied Biosystems). Each 10-µl reaction volume contained 2 µl of standard mRNA and 0.5 µM of the tceA reverse primer. The reaction mixture was incubated for 30 min at 55°C followed by 5 min at 95°C. Reactions were performed at 55°C to increase the stringency of primer-template binding and therefore improve RT specificity (14, 16).
The reverse-transcribed tceA mRNA standards and serially diluted tceA DNA standards were amplified in parallel on an ABI Prism 7000 Sequence Detection System (Applied Biosystems). Each 25-µl qPCR volume contained 2 µl of tceA DNA standard or reverse-transcribed tceA mRNA standard, 12.5 µl of 2x TaqMan Universal PCR Master Mix (Applied Biosystems), 0.2 µM of tceA probe, and 0.7 µM of each tceA primer (forward and reverse). Thermocycling conditions were as follows: 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. A single fluorescence value (R) was identified that corresponded with exponential amplification in every sample. The threshold cycle [CT(R)] values associated with this fluorescence were then plotted against the initial number of DNA or mRNA copies in each reaction. The efficiency of RT was calculated as the ratio of initial tceA mRNA copies to initial DNA copies for a fixed value of CT(R).
Quantification of tceA mRNA in culture samples.
Multiplex RT-qPCR was applied to independently quantify tceA and ref mRNA in each culture sample. Sample RNA, 10-fold serially diluted tceA mRNA standards, and 10-fold serially diluted ref mRNA standards were reverse transcribed in parallel 10-µl reaction mixtures using the RT core reagent kit (PE Applied Biosystems), 2 µl of sample or standard mRNA, and 0.5 µM of each reverse primer (tceA and ref). RT incubation conditions were identical to those described above. Multiplex qPCR was performed in 25-µl reaction volumes containing 2 µl of RT product, 12.5 µl of 2x TaqMan Universal PCR Master Mix (Applied Biosystems), 0.7 µM of each forward and reverse primer (tceA and ref), and 0.2 µM of each probe (tceA and ref). Thermocycling conditions were identical to those above. The quantities of ref and tceA mRNA were independently measured using the absolute standard curve method (19, 27).
Biomass quantification.
Biomass was quantified as mass of cellular protein. Frozen cell pellets from 1-ml culture samples were resuspended in 100 µl of 48 mM NaOH. The mixture was boiled at 100°C for 20 min followed by centrifugation (10 min at 10,000 x g) to remove cellular debris from the supernatant. Protein mass per volume was quantified from 50 µl of the supernatant using the Coomassie Plus protein assay reagent kit with bovine serum albumin as the standard (Pierce Biotechnology, Rockford, IL).

RESULTS
Analysis and control of RT inefficiencies.
To assess the efficiency of the RT protocol described here,
tceA DNA standards and reverse-transcribed
tceA mRNA standards
were amplified and analyzed in parallel. Both sets of standards
exhibited similar linear slopes over 5 orders of magnitude (DNA,
3.47; 95% confidence interval [CI], 3.06 to 3.87;
mRNA, 3.50; 95% CI, 3.29 to 3.72) (Fig.
1A). In addition, the two sets of standards returned nearly
identical
CT values for a given initial copy number, which is
indicative of a high RT efficiency. The median separation distance
between the
tceA DNA and mRNA standard curves was 0.27
CT, corresponding
to a median RT efficiency of 88% (evaluated at
CT = 26). This
RT efficiency is consistent with RT efficiencies reported elsewhere
(
15).
Optimization of the cell lysis and RNA isolation protocol.
The cell lysis and RNA isolation protocol described here (acid
phenol method) was optimized to maximize the lysis efficiency
of the
tceA-containing organism in the ANAS enrichment. Bead
beating for 2 min increased yields of
tceA mRNA by 3.5-fold
over those for lysis without bead beating, while bead beating
for longer than 2 min (maximum of 8 min) did not affect
tceA mRNA quantification. All results presented here used 4 min of
bead beating.
The optimized cell lysis and RNA isolation protocol (acid phenol method) was compared to two commercial RNA isolation methods, the UltraClean Microbial RNA kit (Mo Bio Laboratories), and the RiboPure Bacteria kit (Ambion). Of the three methods, the acid phenol method yielded the most RNA from the ANAS culture. All results presented here used the acid phenol method for cell lysis and RNA isolation.
ref mRNA selection and quantification.
Firefly (Coleoptera) luciferase mRNA was selected as the exogenous internal reference mRNA (ref mRNA) because a primer-probe set could be designed that does not target any bacterial or archaeal genes submitted to the NCBI GenBank database (www.ncbi.nlm.nih.gov). The specificity of the primer-probe set for only ref mRNA was verified by performing RT-qPCR with total RNA from the ANAS culture. After RT and 40 cycles of qPCR, no detectable amplification was observed. To quantify ref mRNA, a set of ref mRNA external standards were developed. As with the tceA mRNA standards, amplification of reverse-transcribed ref mRNA standards exhibited low variability over 5 orders of magnitude (Fig. 1B).
Dynamic range of the ref mRNA protocol.
Because tceA and ref mRNAs are quantified simultaneously by multiplex RT-qPCR, the relative initial quantities of each mRNA may affect quantification through competition for RT-qPCR reagents. To test for possible complications with the protocol described here, a range of ref mRNA quantities (2.5 x 106 to 7.5 x 108 copies) were added to homogenized sets of 1-ml ANAS culture samples (three replicates for each ref mRNA quantity) and the recovered quantities of ref and tceA mRNA were measured by multiplex RT-qPCR. As shown in Fig. 2, a linear relationship was observed between the added and recovered amounts of ref mRNA (slope, 0.94; 95% CI, 0.91 to 0.97). The mean fractional recovery of ref mRNA was 29% (standard deviation, 7.2%), and normalization to the sample-specific fractional recovery of ref mRNA increased tceA quantities by more than threefold. While the quantity of unnormalized tceA mRNA was slightly reduced as the added amount of ref mRNA was increased (slope, 0.06; 95% CI, 0.05 to 0.07), sample-specific normalization to the fractional recovery of ref mRNA (slope, 0.004; 95% CI, 0.02 to 0.02) resulted in more consistent reporting of the uniform tceA mRNA quantity (Fig. 2).
To examine the effective dynamic range of the cell lysis and
RNA isolation protocol (acid phenol method), cells were harvested
from homogenized sets of 1-ml ANAS culture samples that differed
in cellular protein concentration (3.3 to 330 ng cellular protein
ml
1, three replicates for each protein concentration)
and amended with a fixed amount of
ref mRNA (2.5
x 10
8 copies).
The recovered quantities of
ref and
tceA mRNA were then measured
by multiplex RT-qPCR. As shown in Fig.
3, the quantity of
tceA mRNA increased linearly with increasing mass of cellular protein
(slope, 1.0; 95% CI, 0.86 to 1.2) while the fractional recovery
of
ref mRNA was not significantly affected (average, 33%; standard
deviation, 8.3%). Normalization to the sample-specific fractional
recovery of
ref mRNA increased quantities of
tceA mRNA approximately
3.0-fold while the slope of the linear relationship and datum
variability were not substantially affected (unnormalized slope,
1.0; 95% CI, 0.86 to 1.2;
ref mRNA-normalized slope, 1.0; 95%
CI, 0.98 to 1.1).
Loss of mRNA during specific protocol steps.
The
ref mRNA technique was applied to quantify the loss of mRNA
during specific protocol steps. Four parallel sets of 1-ml ANAS
culture samples (five replicates for each set) were amended
with 2
x 10
8 copies of
ref mRNA immediately prior to the cell
lysis, RNA isolation, DNA removal, or RT steps, and the recovered
quantities of
tceA and
ref mRNA were measured by multiplex RT-qPCR
(Table
1). As expected, measured quantities of
tceA were consistent
across all sample sets and hence independent of when
ref mRNA
was added to samples. By calculating differences in the mean
fractional recoveries of
ref mRNA when
ref mRNA was added prior
to each step, the contribution of each step towards the overall
loss of mRNA was estimated to be 16% for cell lysis (Table
1,
[B] [A]), 44% for RNA isolation (Table
1, [C]
[B]), and 7% for DNA removal (Table
1, [D] [C]). These
fractional losses of mRNA correspond to mRNA recovery efficiencies
of 84% for the cell lysis step, 56% for the RNA isolation step,
and 93% for the DNA removal step.
Effect of chlorinated ethene exposure.
The
ref mRNA technique was applied to examine the effect of
chlorinated ethene exposure on the quantity of
tceA mRNA in
the ANAS enrichment. Parallel subcultures were exposed to TCE,
cDCE, or VC or starved of chlorinated ethenes. To control for
any variability in cellular density between the subcultures,
tceA mRNA measurements were normalized to the mass of cellular
protein per sample. Without
ref mRNA normalization, the quantities
of
tceA mRNA in the TCE-, cDCE-, and VC-exposed subcultures
were 89-, 57-, and 3-fold greater, respectively, than in the
chlorinated ethene-starved subculture (Fig.
4). Normalization
to the sample-specific fractional recovery of
ref mRNA changed
the results in two ways. First, the quantity of
tceA mRNA increased
more than threefold in all the subcultures. Second, as a result
of differing sample-specific fractional recoveries of
ref mRNA,
the ratio of
tceA mRNA quantities in the VC-exposed and chlorinated
ethene-starved subcultures decreased from 3-fold to 1.4-fold,
which substantially reduced the apparent effect of VC exposure
on the quantity of
tceA mRNA.

DISCUSSION
The primary objective of this work was to develop an RT-qPCR
technique that provides accurate quantification of specific
mRNAs from prokaryotic samples. Limitations to the accuracy
of mRNA quantification result from mRNA losses during sample
processing (cell lysis, RNA isolation, and DNA removal) and
from inefficiencies in RT (
4,
5,
15). Traditional methods for
controlling some or all of these losses, such as normalizing
to the mass of total RNA or to quantities of housekeeping mRNA,
suffer from dependencies on cell state, growth stage, and/or
environmental conditions (
17,
26,
35,
36,
42,
43). The novel
approach developed here overcomes this limitation by normalizing
to an internal reference mRNA (
ref mRNA) that is not present
in the experimental culture. Although
ref mRNA techniques have
been applied to eukaryotic cells (
1,
18,
25,
34), to our knowledge
this work represents the first application to prokaryotic cells.
One limitation of the ref mRNA technique developed here is that it cannot control for the underestimation of mRNA quantities resulting from the incomplete lysis of cells. In this work, this limitation has been addressed by specifically optimizing the cell lysis protocol for the tceA-containing organism in the ANAS enrichment.
The ref mRNA technique coupled with the absolute standard curve method (19, 27) dramatically improved the quantification of tceA mRNA in the ANAS enrichment. Repeated experiments revealed that only 30% of the ref mRNA was recovered after the cell lysis, RNA isolation, and DNA removal steps (Fig. 2 and 3; Table 1). This overall mRNA recovery efficiency is consistent with RNA recovery efficiencies reported for other microbial cells, which range from 20 to 87% (28, 37, 40). Of the 30% of mRNA remaining after RNA isolation and purification, 88% was effectively synthesized to cDNA by RT (Fig. 1). Taking these mRNA losses and process inefficiencies together, the amount of cDNA amplified by qPCR corresponds to only 26% of the original quantity of mRNA [(30% of mRNA remaining after the cell lysis, RNA isolation, and DNA removal steps) x (88% RT efficiency)].
The ref mRNA technique proved to be a valuable tool for assessing the performance of different RNA processing steps. The mRNA recovery efficiency of the RNA isolation step (56%) was significantly less than that of the cell lysis (84%) and DNA removal (93%) steps. The RNA isolation step as employed here involves three aqueous-organic phase separations. During these phase separations, 10 to 15% of the aqueous phase was consistently left behind to prevent carryover of genomic DNA to downstream processes (DNA accumulates near the interface of acid phenol). Over three serial phase separations, the inefficient transfer of aqueous volumes likely accounts for the 56% efficiency of the RNA isolation step. Similarly, the cell lysis step involves one organic-aqueous phase separation (bead beating is performed in a two-phase phenol-aqueous lysis buffer), and the incomplete transfer of the aqueous layer could account for the 84% efficiency of this step. Taken together, this analysis suggests that physical losses contributed significantly more towards the overall loss of mRNA than mRNA degradation.
As a proof of concept, the ref mRNA technique was applied to investigate the effects of chlorinated ethene exposure on the quantity of tceA mRNA in the ANAS enrichment. Results show that the quantities of tceA mRNA in the TCE- and cDCE-exposed subcultures were 25-fold higher than in the VC-exposed and chlorinated ethene-starved subcultures. This effect was likely not due to cell growth, as the reported 19-hour doubling time of the tceA host organism, Dehalococcoides ethenogenes 195 (24), is much longer than the 8-hour time period of the chlorinated ethene exposure experiment. Instead, these differences likely represent chlorinated ethene-dependent differences in the expression level of the tceA gene.
The observation of increased tceA gene expression after exposure to TCE or cDCE but not VC is consistent with a regulatory scheme where tceA expression increases only in response to growth-supporting substrates of the TCE reductive dehalogenase. Physiological studies of D. ethenogenes 195 have shown that this strain can couple growth with the dechlorination of TCE and cDCE but not with VC (23, 24). In addition, biochemical studies of the purified TCE reductive dehalogenase have shown that dechlorination rates for TCE and cDCE were more than 2 orders of magnitude greater than the dechlorination rate for VC (20, 21). Interestingly, prior to ref mRNA normalization, tceA mRNA quantities in the VC-exposed subculture were substantially higher than in the starvation subculture (3-fold). After ref mRNA normalization, however, this difference was reduced to 1.4-fold, demonstrating the substantial effect that application of the ref mRNA technique can have on the interpretation of RT-qPCR data.

ACKNOWLEDGMENTS
This work was supported by the Lawrence Berkeley National Laboratory
Earth Science Division LDRD, National Science Foundation grant
no. 0104740, and the NIEHS Superfund Basic Research Project
ES04705.

FOOTNOTES
* Corresponding author. Mailing address: Department of Civil and Environmental Engineering, University of California, Berkeley, CA 94720-1710. Phone: (510) 643-5969. Fax: (510) 642-7483. E-mail:
alvarez{at}ce.berkeley.edu.


REFERENCES
1 - Baker, P. J., and P. J. O'Shaughnessy. 2001. Expression of prostaglandin D synthetase during development in the mouse testis. Reproduction 122:553-559.[Abstract]
2 - Barloy-Hubler, F., A. Chéron, A. Hellégouarch, and F. Galibert. 2004. Smc01944, a secreted peroxidase induced by oxidative stresses in Sinorhizobium meliloti 1021. Microbiology 150:657-664.[Abstract/Free Full Text]
3 - Bordi, C., M. Ansaldi, S. Gon, C. Jourlin-Castelli, C. Iobbi-Nivol, and V. Mejéan. 2004. Genes regulated by TorR, the trimethylamine oxide response regulator of Shewanella oneidensis. J. Bacteriol. 186:4502-4509.[Abstract/Free Full Text]
4 - Bustin, S. A. 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25:169-193.[Abstract]
5 - Bustin, S. A. 2002. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29:23-39.[Abstract]
6 - Cabrol, S., A. Olliver, G. B. Pier, A. Andremont, and R. Ruimy. 2003. Transcription of quorum-sensing system genes in clinical and environmental isolates of Pseudomonas aeruginosa. J. Bacteriol. 185:7222-7230.[Abstract/Free Full Text]
7 - Chin, K.-J., A. Esteve-Núñez, C. Leang, and D. R. Lovley. 2004. Direct correlation between rates of anaerobic respiration and levels of mRNA for key respiratory genes in Geobacter sulfurreducens. Appl. Environ. Microbiol. 70:5183-5189.[Abstract/Free Full Text]
8 - Corbella, M. E., and A. Puyet. 2003. Real-time reverse transcription-PCR analysis of expression of halobenzoate and salicylate catabolism-associated operons in two strains of Pseudomonas aeruginosa. Appl. Environ. Microbiol. 69:2269-2275.[Abstract/Free Full Text]
9 - Denef, V. J., J. Park, T. B. Tsoi, J.-M. Rouillard, H. Zhang, J. A. Wibbenmeyer, W. Verstraete, E. Gulari, S. A. Hashsham, and J. M. Tiedje. 2004. Biphenyl and benzoate metabolism in a genomic context: outlining genome-wide metabolic networks in Burkholderia xenovorans LB400. Appl. Environ. Microbiol. 70:4961-4970.[Abstract/Free Full Text]
10 - Devers, M., G. Soulas, and F. Martin-Laurent. 2004. Real-time reverse transcription PCR analysis of expression of atrazine catabolism genes in two bacterial strains isolated from soil. J. Microbiol. Methods 56:3-15.[CrossRef][Medline]
11 - Dinamarca, M. A., I. Aranda-Olmedo, A. Puyet, and F. Rojo. 2003. Expression of the Pseudomonas putida OCT plasmid alkane degradation pathway is modulated by two different global control signals: evidence from continuous cultures. J. Bacteriol. 185:4772-4778.[Abstract/Free Full Text]
12 - El-Shehawy, R., C. Lugomela, A. Ernst, and B. Bergman. 2003. Diurnal expression of hetR and diazocyte development in the filamentous non-heterocystous cyanobacterium Trichodesminum erythraeum. Microbiology 149:1139-1146.[Abstract/Free Full Text]
13 - Fey, A., S. Eichler, S. Flavier, R. Christen, M. Hofle, and C. A. Guzmán. 2004. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70:3618-3623.[Abstract/Free Full Text]
14 - Freeman, W. M., S. L. Vrana, and K. E. Vrana. 1996. Use of elevated reverse transcription reaction temperatures in RT-PCR. BioTechniques 20:782-783.[Medline]
15 - Freeman, W. M., S. J. Walker, and K. E. Vrana. 1999. Quantitative RT-PCR: pitfalls and potential. BioTechniques 26:112-125.[Medline]
16 - Fuchs, B., K. Zhang, M. G. Rock, M. E. Bolander, and G. Sarkar. 1999. High temperature cDNA synthesis by AMV reverse transcriptase improves the specificity of PCR. Mol. Biotechnol. 12:237-240.[CrossRef][Medline]
17 - Gourse, R. L., T. Gall, M. S. Bartlett, J. A. Appleman, and W. Ross. 1996. rRNA transcription and growth rate-dependent regulation of ribosome synthesis in Escherichia coli. Annu. Rev. Microbiol. 50:645-677.[CrossRef][Medline]
18 - Jelaso, A. M., E. Lehigh-Shirey, J. Means, and C. F. Ide. 2003. Gene expression patterns predict exposure to PCBs in developing Xenopus laevis tadpoles. Environ. Mol. Mutagen. 42:1-10.[CrossRef][Medline]
19 - Liu, W., and D. A. Saint. 2002. A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics. Anal. Biochem. 302:52-59.[CrossRef][Medline]
20 - Magnuson, J. K., M. F. Romine, D. R. Burris, and M. T. Kingsley. 2000. Trichloroethene reductive dehalogenase from Dehalococcoides ethenogenes: sequence of tceA and substrate range characterization. Appl. Environ. Microbiol. 66:5141-5147.[Abstract/Free Full Text]
21 - Magnuson, J. K., R. V. Stern, J. M. Gossett, S. H. Zinder, and D. R. Burris. 1998. Reductive dechlorination of tetrachloroethene to ethene by a two-component enzyme pathway. Appl. Environ. Microbiol. 64:1270-1275.[Abstract/Free Full Text]
22 - Mary, I., C.-J. Tu, A. Grossman, and D. Vaulot. 2004. Effects of high light on transcripts of stress-associated genes for the cyanobacteria Synechocystis sp. PCC 6803 and Prochlorococcus MED4 and MIT9313. Microbiology 150:1271-1281.[Abstract/Free Full Text]
23 - Maymó-Gatell, X., T. Anguish, and S. H. Zinder. 1999. Reductive dechlorination of chlorinated ethenes and 1,2-dichloroethene by "Dehalococcoides ethenogenes" 195. Appl. Environ. Microbiol. 65:3108-3113.[Abstract/Free Full Text]
24 - Maymó-Gatell, X., Y.-T. Chien, J. M. Gossett, and S. H. Zinder. 1997. Isolation of a bacterium that reductively dechlorinates tetrachloroethene to ethene. Science 276:1568-1571.[Abstract/Free Full Text]
25 - McMaugh, S. J., and B. R. Lyon. 2003. Real-time quantitative RT-PCR assay of gene expression in plant roots during fungal pathogenesis. BioTechniques 34:982-986.[Medline]
26 - Nomura, M., R. Gourse, and G. Baughman. 1984. Regulation of the synthesis of ribosomes and ribosomal components. Annu. Rev. Biochem. 53:75-117.[CrossRef][Medline]
27 - Peirson, S. N., J. N. Butler, and R. G. Foster. 2003. Experimental validation of novel and conventional approaches to quantitative real-time PCR data and analysis. Nucleic Acids Res. 31:e73.[Abstract/Free Full Text]
28 - Pichard, S. L., and J. H. Paul. 1991. Detection of gene expression in genetically engineered microorganisms and natural phytoplankton populations in the marine environment by mRNA analysis. Appl. Environ. Microbiol. 57:1721-1727.[Abstract/Free Full Text]
29 - Richardson, R. E., V. K. Bhupathiraju, D. L. Song, T. A. Goulet, and L. Alvarez-Cohen. 2002. Phylogenetic characterization of microbial communities that reductively dechlorinate TCE based upon a combination of molecular techniques. Environ. Sci. Technol. 36:2652-2662.[Medline]
30 - Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
31 - Semighini, C. P., M. Marins, M. H. S. Goldman, and G. H. Goldman. 2002. Quantitative analysis of the relative transcript levels of ABC transporter Atr genes in Aspergillus nidulans by real-time reverse transcription-PCR assay. Appl. Environ. Microbiol. 68:1351-1357.[Abstract/Free Full Text]
32 - Sharkey, F. H., I. M. Banat, and R. Marchant. 2004. Detection and quantification of gene expression in environmental bacteriology. Appl. Environ. Microbiol. 70:3795-3806.[Free Full Text]
33 - Siering, P. L., and W. C. Ghiorse. 1997. Development and application of 16S rRNA-targeted probes for detection of iron- and manganese-oxidizing sheathed bacteria in environmental samples. Appl. Environ. Microbiol. 63:644-651.[Abstract]
34 - Smith, R. D., B. Brown, P. Ikonomi, and A. N. Schechter. 2003. Exogenous reference RNA for normalization of real-time quantitative PCR. BioTechniques 34:88-91.[Medline]
35 - Thellin, O., W. Zorzi, B. Lakaye, B. De Borman, B. Coumans, G. Hennen, T. Grisar, A. Igout, and E. Heinen. 1999. Housekeeping genes as internal standards: use and limits. J. Biotechnol. 75:291-295.[CrossRef][Medline]
36 - Vandecasteele, S. J., W. E. Peetermans, R. Merckx, and J. Van Eldere. 2001. Quantification of expression of Staphylococcus epidermidis housekeeping genes with Taqman quantitative PCR during in vitro growth under different conditions. J. Bacteriol. 183:7094-7101.[Abstract/Free Full Text]
37 - Ward, D. M., A. L. Ruff-Roberts, and R. Weller. 1995. Methods for extracting RNA or ribosomes from microbial mats and cultivated microorganisms, p. 1-14. In A. Akkermans, J. van Elsas, and F. de Bruijn (ed.), Molecular microbial ecology manual. Kluwer Academic Publishers, Dordrecht, The Netherlands.
38 - Watanabe, T., H. Fujihara, and K. Furukawa. 2003. Characterization of the second LysR-type regulator in the biphenyl-catabolic gene cluster of Pseudomonas pseudoalcaligenes KF707. J. Bacteriol. 185:3575-3582.[Abstract/Free Full Text]
39 - Wawrik, B., J. H. Paul, and F. R. Tabita. 2002. Real-time PCR quantification of rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase) mRNA in diatoms and pelagophytes. Appl. Environ. Microbiol. 68:3771-3779.[Abstract/Free Full Text]
40 - Weinbauer, M. G., I. Fritz, D. F. Wenderoth, and M. G. Höfle. 2002. Simultaneous extraction from bacterioplankton of total RNA and DNA suitable for quantitative structure and function analyses. Appl. Environ. Microbiol. 68:1082-1087.[Abstract/Free Full Text]
41 - Yarzábal, A., and C. Appia-Ayme. 2004. Regulation of the expression of the Acidithiobacillus ferrooxidans rus operon encoding two cytochromes c, a cytochrome oxidase and rusticyanin. Microbiology 150:2113-2123.[Abstract/Free Full Text]
42 - Zhong, H., and J. W. Simons. 1999. Direct comparison of GAPDH, ß-actin, cyclophilin, and 28S rRNA as internal standards for quantifying RNA levels under hypoxia. Biochem. Biophys. Res. Commun. 259:523-526.[CrossRef][Medline]
43 - Zhou, G., Y. Chang, J. Zuo, X. Dong, M. Zhang, G. Hu, and F. Fang. 2001. Fudenine, a C-terminal truncated rat homologue of mouse prominin, is blood glucose-regulated and can up-regulate the expression of GAPDH. Biochem. Biophys. Res. Commun. 281:951-956.[CrossRef][Medline]
Applied and Environmental Microbiology, July 2005, p. 3866-3871, Vol. 71, No. 7
0099-2240/05/$08.00+0 doi:10.1128/AEM.71.7.3866-3871.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Wagner, A., Adrian, L., Kleinsteuber, S., Andreesen, J. R., Lechner, U.
(2009). Transcription Analysis of Genes Encoding Homologues of Reductive Dehalogenases in "Dehalococcoides" sp. Strain CBDB1 by Using Terminal Restriction Fragment Length Polymorphism and Quantitative PCR. Appl. Environ. Microbiol.
75: 1876-1884
[Abstract]
[Full Text]
-
Rowe, A. R., Lazar, B. J., Morris, R. M., Richardson, R. E.
(2008). Characterization of the Community Structure of a Dechlorinating Mixed Culture and Comparisons of Gene Expression in Planktonic and Biofloc-Associated "Dehalococcoides" and Methanospirillum Species. Appl. Environ. Microbiol.
74: 6709-6719
[Abstract]
[Full Text]
-
West, K. A., Johnson, D. R., Hu, P., DeSantis, T. Z., Brodie, E. L., Lee, P. K. H., Feil, H., Andersen, G. L., Zinder, S. H., Alvarez-Cohen, L.
(2008). Comparative Genomics of "Dehalococcoides ethenogenes" 195 and an Enrichment Culture Containing Unsequenced "Dehalococcoides" Strains. Appl. Environ. Microbiol.
74: 3533-3540
[Abstract]
[Full Text]
-
Johnson, D. R., Brodie, E. L., Hubbard, A. E., Andersen, G. L., Zinder, S. H., Alvarez-Cohen, L.
(2008). Temporal Transcriptomic Microarray Analysis of "Dehalococcoides ethenogenes" Strain 195 during the Transition into Stationary Phase. Appl. Environ. Microbiol.
74: 2864-2872
[Abstract]
[Full Text]
-
Lee, P. K. H., Macbeth, T. W., Sorenson, K. S. Jr., Deeb, R. A., Alvarez-Cohen, L.
(2008). Quantifying Genes and Transcripts To Assess the In Situ Physiology of "Dehalococcoides" spp. in a Trichloroethene-Contaminated Groundwater Site. Appl. Environ. Microbiol.
74: 2728-2739
[Abstract]
[Full Text]
-
Sharp, J. O., Sales, C. M., LeBlanc, J. C., Liu, J., Wood, T. K., Eltis, L. D., Mohn, W. W., Alvarez-Cohen, L.
(2007). An Inducible Propane Monooxygenase Is Responsible for N-Nitrosodimethylamine Degradation by Rhodococcus sp. Strain RHA1. Appl. Environ. Microbiol.
73: 6930-6938
[Abstract]
[Full Text]
-
Saikaly, P. E., Barlaz, M. A., de los Reyes, F. L. III
(2007). Development of Quantitative Real-Time PCR Assays for Detection and Quantification of Surrogate Biological Warfare Agents in Building Debris and Leachate. Appl. Environ. Microbiol.
73: 6557-6565
[Abstract]
[Full Text]
-
Chen, A. K., Behlke, M. A., Tsourkas, A.
(2007). Avoiding false-positive signals with nuclease-vulnerable molecular beacons in single living cells. Nucleic Acids Res
0: gkm593v1-12
[Abstract]
[Full Text]
-
He, J., Holmes, V. F., Lee, P. K. H., Alvarez-Cohen, L.
(2007). Influence of Vitamin B12 and Cocultures on the Growth of Dehalococcoides Isolates in Defined Medium. Appl. Environ. Microbiol.
73: 2847-2853
[Abstract]
[Full Text]
-
Pecson, B. M., Barrios, J. A., Johnson, D. R., Nelson, K. L.
(2006). A Real-Time PCR Method for Quantifying Viable Ascaris Eggs Using the First Internally Transcribed Spacer Region of Ribosomal DNA. Appl. Environ. Microbiol.
72: 7864-7872
[Abstract]
[Full Text]
-
Holmes, V. F., He, J., Lee, P. K. H., Alvarez-Cohen, L.
(2006). Discrimination of Multiple Dehalococcoides Strains in a Trichloroethene Enrichment by Quantification of Their Reductive Dehalogenase Genes. Appl. Environ. Microbiol.
72: 5877-5883
[Abstract]
[Full Text]
-
Lee, P. K. H., Johnson, D. R., Holmes, V. F., He, J., Alvarez-Cohen, L.
(2006). Reductive Dehalogenase Gene Expression as a Biomarker for Physiological Activity of Dehalococcoides spp.. Appl. Environ. Microbiol.
72: 6161-6168
[Abstract]
[Full Text]
-
Rahm, B. G., Morris, R. M., Richardson, R. E.
(2006). Temporal Expression of Respiratory Genes in an Enrichment Culture Containing Dehalococcoides ethenogenes. Appl. Environ. Microbiol.
72: 5486-5491
[Abstract]
[Full Text]
-
Ritalahti, K. M., Amos, B. K., Sung, Y., Wu, Q., Koenigsberg, S. S., Loffler, F. E.
(2006). Quantitative PCR Targeting 16S rRNA and Reductive Dehalogenase Genes Simultaneously Monitors Multiple Dehalococcoides Strains. Appl. Environ. Microbiol.
72: 2765-2774
[Abstract]
[Full Text]
-
Johnson, D. R., Lee, P. K. H., Holmes, V. F., Fortin, A. C., Alvarez-Cohen, L.
(2005). Transcriptional Expression of the tceA Gene in a Dehalococcoides-Containing Microbial Enrichment. Appl. Environ. Microbiol.
71: 7145-7151
[Abstract]
[Full Text]