Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, Y. Articles by Salyers, A. A. Search for Related Content PubMed PubMed Citation Articles by Wang, Y. Articles by Salyers, A. A. Agricola Articles by Wang, Y. Articles by Salyers, A. A.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, August 2005, p. 4930-4934, Vol. 71, No. 8
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.8.4930-4934.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

SHORT REPORT

Distribution of the ermG Gene among Bacterial Isolates from Porcine Intestinal Contents

Yanping Wang,¹ Gui-Rong Wang,² Nadja B. Shoemaker,^2* Terence R. Whitehead,³ and Abigail A. Salyers²

New York University School of Medicine, Skirball Institute of Biomolecular Medicine, New York, New York 10016,¹ Department of Microbiology, University of Illinois, Urbana, Illinois 61801,² Fermentation Biotechnology Research Unit, National Center for Agricultural Utilization Research, USDA, Peoria, Illinois 61604³

Received 1 April 2004/ Accepted 28 February 2005

Top Abstract Introduction Nucleotide sequence accession... References

 
The ermG gene was first found in the soil bacterium Bacillus sphaericus. More recently, it was found in several human intestinal Bacteroides species. We report here the first finding of ermG genes in gram-positive bacteria isolated from porcine feces and from under-barn manure pits used to store porcine wastes. The porcine ermG sequences were identical to the sequence of the B. sphaericus ermG gene except that six of the seven ermG-containing strains contained an insertion sequence element insertion in the C-terminal end of the gene. The porcine ermG genes were found in three different gram-positive genera, an indication that it is possible that the gene is being spread by horizontal gene transfer. A segment of a Bacteroides conjugative transposon that carries an ermG gene cross-hybridized with DNA from six of the seven porcine isolates, but the restriction patterns in the porcine strains were different from that of the Bacteroides conjugative transposon.

Top Abstract Introduction Nucleotide sequence accession... References

 
Macrolide antibiotics are used widely to treat human bacterial infections, but they are also used in agriculture. Tylosin is an example of a macrolide antibiotic that is used as a growth promoter and is used to prevent infections in young pigs (20). Previously, we showed that the ermG gene, a gene that confers resistance to macrolides, has appeared relatively recently in human colonic Bacteroides species (15), where it was found in several species and on two conjugative transposons (CTns) (4, 12, 17). The only previously reported ermG gene was found in Bacillus sphaericus (11), a soil bacterium and insect pathogen that is being used commercially to control mosquito larvae. The finding of ermG genes in human colonic Bacteroides species raised the question of how widely the ermG gene might be distributed in nature, especially in bacteria that are routinely exposed to macrolides. Since growing and finishing pigs are often fed the macrolide tylosin as a growth promoter and to prevent disease, the intestinal bacteria of pigs seemed a possible source where other examples of ermG might be found.

Accordingly, we surveyed 48 pure-culture (PC) isolates obtained from porcine feces or from under-barn manure storage pits at the Fermentation Biotechnology Research Unit, National Center for Agricultural Utilization Research, Peoria, Ill. In this swine production facility, tylosin is included in feed for growing and finishing pigs at a concentration of 10 to 60 g per ton. Cultivation methods were described previously (5). These strains were selected initially as resistant to erythromycin/tylosin or tetracycline. Tetracycline-resistant strains were included in our survey, along with the erythromycin/tylosin-resistant strains, because a preliminary survey had indicated that some of the tetracycline-resistant strains might contain ermG.

The 48 isolates were screened by DNA hybridization, using DNA extracted from the resistant strains. The ermG probe was the 445-bp internal fragment generated by PCR from the ermG gene carried by the Bacteroides conjugative transposon CTnGERM1. This gene has more than 99% sequence identity with the B. sphaericus ermG gene (13). The primers amplified a region of the Bacteroides ermG gene that extended from bp 265 to bp 710 at the end of the ermG gene (15). The sequences of the two primers were as follows: for bp 265, CATTTCCTAGCCACAATCCAT (forward primer), and for bp 710, TTAAATAGCGATACAAATTGTTCG (reverse primer). Primers were synthesized by Operon Technologies Inc. The conditions used for DNA isolation and for the hybridization screen have been described previously (15). The hybridization analysis identified seven strains that contained ermG (Table 1).

View this table: [in this window] [in a new window]

TABLE 1. Characteristics of the seven ermG-containing porcine isolates

To obtain a fuller picture of erm and tet genes found in the porcine strains that contained ermG, we also used as probes internal segments from ermA, ermB, ermC, ermF, ermQ, and ermT as well as the tet genes tetM and tetQ. These probes have been described previously (15, 19). They were chosen because they represent erm and tet genes that, unlike ermG, are known to have a wide distribution in different genera of bacteria. Whereas ermF and tetQ are prevalent in Bacteroides and related genera, ermA, ermB, and tetM have been found in a variety of gram-positive bacteria as well as in some gram-negative bacteria (1, 2, 13). The ermQ and ermT genes have been found primarily in gram-positive bacteria (3, 19). As shown in Table 1, the ermA and ermC genes were found in some of the ermG-containing strains. The tetM gene was found in six of the seven strains. The seventh strain contained an unidentified tetracycline resistance gene because it was phenotypically resistant to tetracycline, but its DNA did not hybridize to any of the tet gene probes tested.

When the erm probes for genes other than ermG were used to screen all 48 of the resistant strains, we found that 2 contained ermA, 12 contained ermB, 3 contained ermC, and 2 contained ermT. None of the strains contained the ermF gene or the ermQ gene, which has been found primarily in Clostridium perfringens (3). Examples of tet genes were also found in strains other than those shown in Table 1. Altogether, 3 of the 48 isolates contained tetQ and 25 (about 50%) contained the tetM gene. These results show that a number of erm and tet genes that have been found previously in human clinical isolates are also found in porcine intestinal bacteria and bacteria from the manure pits.

To characterize further the ermG genes identified by hybridization, we wanted to compare sequences from these genes with sequences from known ermG genes. Initially, crude boiled cell extracts were used as the source of DNA for PCR amplification. Amplicons were sequenced and compared to the sequences of the few known ermG genes in the databases. The portion of the ermG gene selected for amplification was chosen because it covered the region of variability between the B. sphaericus and Bacteroides genes (15). Also, these primers were found to be the most reliable when used to amplify DNA from the porcine isolates. The PCR survey of DNA from boiled cells identified ermG in only four of the isolates shown in Table 1. The sequences of the four PCR amplicons were all identical to the sequence of the ermG gene found on a plasmid in B. sphaericus (M15332). They differed from the ermG genes found in the Bacteroides spp. by only one to five nucleotides. The failure of PCR amplification to find the ermG genes in the other three strains identified by DNA hybridization was probably due to inhibitors in the boiled cell extracts because PCR products were obtained from the three additional strains when purified DNA was used as the template. The ermG sequences of these three additional strains were identical to the ermG gene sequences from the other porcine isolates.

An unexpected feature of the PCR products obtained from six of the seven ermG-containing strains was that the amplified DNA was predominantly 2.5 kb in size, with a very faint product of the expected 445-bp size. Hybridization analysis indicated that both bands contained ermG sequences (data not shown). PC21 was the only strain whose DNA produced only a 445-bp amplicon. The larger product proved to be due to the insertion of a foreign DNA segment that had occurred at bp 671 of the ermG sequence, very close to the reverse primer (bp 710 to bp 687 [Fig. 1]). The presence of the 445-bp amplicons in PCRs from all six strains that contained insertions indicated that the insertion was missing in a low percentage of the cells, possibly due to excision or loss of the insertion. A complete sequence of the insertion, named IS PC252, was obtained (AY904360).

View larger version (19K): [in this window] [in a new window]

FIG. 1. Map of the IS element found inserted in the C-terminal end of ermG from six PC strains. The map is from the sequence of the 2.5-kb PCR amplicon obtained for six of the seven PC strains containing ermG. The insertion sites in all six strains were identical, and the partial sequences of both ends of the insertion and the ermG gene sequences were identical. The ermG primers are described in the text. The ermG sequences are indicated by the dark arrows and labeled with base pair numbers of the ermG sequence from B. sphaericus. Sequences of the ermG genes can be found under the following GenBank accession numbers: the ermG genes from Bacillus sphaericus and the PC isolates, M15332; the ermG gene from CTnGERM1, AY171301; and the ermG gene from CTn7853, L42817. The double-strand sequence of the entire IS element, called IS PC252, was done for PC78A. The two proteins encoded by the open reading frames in the integrated IS are indicated by the arrows. The closest homologs to known genes in the databases are shown below the corresponding arrows for Orf1 and Orf2. They belong to the IS232-like elements found in Enterococcus faecium (transposase BAD02264.1 and transposition helper BAD02265.1) and Bacillus thuringiensis (IstA and IstB A37801). The E values and the percent sequence identity over percent similarity values are provided. The element is flanked by the 7-bp repeat of bp 665 to 671 of the ermG target site.

There was no significant nucleotide identity between IS PC252 and anything in the databases, but the deduced amino acid sequences of proteins encoded by the two open reading frames (Orfs) (Fig. 1) were similar to those of several gram-positive insertion sequence (IS) element transposases and transfer helper proteins, e.g., IS232-related elements found in several Bacillus species (7, 9, 10). The insertion resulted in a 7-bp duplication of bp 665 to 671, which flanked the integrated element. Thus, the insertion was probably due to an IS element. A map of the putative IS element, the position of the insertion in the ermG genes, and the labeling of the two open reading frames with their nearest homologs in the BLASTP searches are shown in Fig. 1. Orf1 may be truncated or nonfunctional because the ATG start includes 2 bp of the target sequence and the promoter, if there is one, must originate downstream of the end of the ermG gene. The fact that the strains carrying the ermG gene that had sustained an insertion were all phenotypically erythromycin resistant indicates that the insertion did not completely inactivate the ermG gene; that the IS element could excise, leaving a functional gene; or that other erm or erythromycin resistance genes were responsible for the resistance phenotype. If the last alternative is true, there are several isolates (PC3, PC21, PC74, PC78A, and PC96B) that must contain as yet unidentified genes, because no known erm gene other than ermG was detected by hybridization or PCR in these strains.

Finding identical ermG genes, with or without the IS insertion, in the porcine intestinal isolates would suggest that horizontal transfer of the gene has occurred if the gene is found in different genera and species. Accordingly, we determined the 16S rRNA gene sequences from all of the seven porcine isolates that contained ermG. The identities of these isolates, as deduced from the rRNA analysis, are shown in Table 1. A dendrogram showing the nearest relatives in the databases is shown in Fig. 2. Previous studies of bacteria in the porcine intestine have shown that gram-positive bacteria predominate (5, 8). As in humans, bacteria of gram-positive genera such as Clostridium, Eubacterium, and Lactobacillus are found in high numbers, although the porcine species are thought to be different from the species that predominate in humans (8, 18, 21, 22). The antibiotic-resistant isolates were virtually all members of these and related genera (Table 1). Four of the five isolates (PC3, PC7, PC78A, and PC96B) that were identified as strains of Clostridium sartagoforme were isolated from the middle of the manure pit. The fifth isolate, PC74, was obtained from feces. The 16S rRNA sequence of PC7 was identical to that of Clostridium sartagoforme, but the other four strains differed from PC7 and each other by one or two nucleotides and are thus different strains of this Clostridium species. In addition, PC7 contained ermA. The other two isolates, PC81 (pit) and PC21 (feces), were clearly from different genera. Thus, horizontal transfer of the ermG gene between genera seems to have occurred in the case of the porcine isolates. It is interesting that even the form of the ermG gene that had sustained an insertion near its 3' end turned up in strains from species other than Clostridium sartagoforme.

View larger version (33K): [in this window] [in a new window]

FIG. 2. Dendrogram showing the phylogenic affiliations, as deduced from rRNA gene sequences, of the porcine fecal and manure pit PC isolates that contain ermG. The tree is rooted by Bacteroides thetaiotaomicron. The bar represents 10% sequence divergence. Bootstrap values of 90% or greater, based on 100 replications, are indicated. The tree was prepared by a neighbor-joining method using the TREECON software (16). The five strains that cluster with Clostridium sartagoforme differ from each other by one or two nucleotides, and PC7 is identical to the C. sartagoforme sequence in the database (GenBank accession number CSA18175).

Another interesting observation from Fig. 2 is that most of the porcine isolates were related to Clostridium coccoides, a species that is found in high numbers in the human colon (22). If animal gram-positive bacterial species are related to these prominent members of the human intestinal bacterial population, transfer of resistance genes from transient animal isolates to these bacteria in the human colon may occur more readily than transfer to numerically predominant gram-negative bacteria, such as Bacteroides species. Perhaps the human gram-positive anaerobes, such as Clostridium coccoides, should be considered more seriously in the future as possible reservoirs of antibiotic resistance genes.

In Bacteroides species, ermG is carried on conjugative transposons, such as CTnGERM1 and CTn7853 (12, 17). These CTns are related but are not identical. In a recent study, Wang et al. (17) cloned 7.2 kbp of DNA upstream of the ermG gene and 4.5 kbp of DNA downstream of the ermG gene. About 3 kb of the upstream clone was virtually identical in DNA sequence to DNA found previously in gram-positive species, such as Tn1207.1 in Streptococcus pyogenes and Streptococcus pneumoniae (14). In the streptococci, this 3-kbp region contains a homolog of an ABC transporter of unknown function and mefA, a gene that, unlike the erm gene, confers resistance to macrolides but not to streptogramins and lincosamides. A 2-kb region immediately downstream of the ermG gene in CTnGERM1 contained sequences that had been found previously on a Staphylococcus aureus ermB-containing plasmid (6). Other sequences in the downstream region included a homolog of a Bacteroides fragilis IS element (17). Hybridization probes consisting of the upstream and downstream regions from CTnGERM1 hybridized to DNA from cells containing CTn7853, although there were restriction site differences (Fig. 3).

View larger version (58K): [in this window] [in a new window]

FIG. 3. Southern blot of DNA isolated from ermG-containing isolates. DNA was extracted from the seven porcine isolates that hybridized to an ermG internal probe. The DNA was digested with EcoRV (left side of the figure) or HindIII (right side of the figure). The 7.5-kb upstream fragment from CTnGERM1 (17) was labeled with fluorescein (Renaissance kit and protocol; PerkinElmer Life Sciences, Inc.) and was used to probe the Southern blot of the digested DNAs. The locations of the HindIII standard fragments in kb are indicated to the left of the gel. Samples in lanes 1 through 7 are from PC3, PC7, PC74, PC78A, PC96B, PC81, and PC21, respectively. Samples in lanes 8 and 9 are B. thetaiotaomicron strains containing CTnGERM1 and CTn7853, respectively.

To ascertain whether any of the porcine isolates carried DNA that hybridized to the DNA adjacent to ermG on CTnGERM1, we used a 7.2-kbp PstI fragment from the region immediately upstream of ermG and a 4.5-kbp PstI-AccI fragment downstream of ermG as hybridization probes. Neither of these probes contained any ermG sequences. The upstream probe hybridized to a 9.4-kb EcoRV band or a 3.8-kb HindIII fragment from the six porcine strains with the insertion but not to DNA in PC21 (Fig. 3). The patterns seen for the six PC isolates were all the same, but the patterns were much different and much simpler than those seen in the cases of the Bacteroides conjugative transposons CTnGERM1 and CTn7853 (Fig. 3, lanes 8 and 9, respectively). The downstream probe did not hybridize with DNA from any of the PC strains (data not shown). The DNA of PC21 could not be digested with HindIII, indicating that the strain has a HindIII modification system. The DNA was readily digested by EcoRV but did not hybridize to either probe.

Two main conclusions can be drawn from the results presented in this report. First, ermG in antibiotic-resistant isolates from the porcine intestinal tract, all of which were gram-positive bacteria, has been found for the first time. Evidently, ermG is more widely distributed in the bacterial world than appeared to be the case originally. Our results also support the theory that ermG may have originated in the gram-positive bacteria and is being transferred among and between phylogenetically different genera, including the gram-negative bacteria, such as Bacteroides spp.

We have focused on ermG because this might be an indicator of recent gene transfers between gram-positive and gram-negative bacteria and between human and animal intestinal bacteria (13, 15). Yet the results of our study show clearly that the interpretation of such data is not going to be straightforward. Finding genes with high sequence identity in gram-positive and gram-negative bacteria, and in soil, animal, and human bacterial isolates, suggests that promiscuous DNA transfers occur in nature. Ideally, one would also find evidence of a transmissible element carrying the transferred gene. It is intriguing that DNA upstream of the ermG gene in Bacteroides conjugative transposons CTnGERM1 and CTn7853 hybridizes with DNA from six of the seven porcine isolates that carry ermG. However, it is also clear that only a portion of that region is shared. Since we have not cloned and sequenced the upstream and downstream DNA segments that flank ermG in the porcine strains, we cannot be sure that ermG in the porcine isolates is genetically linked to these upstream sequences, as it is in the case of the Bacteroides elements. Indirect support for the hypothesis that the DNA that hybridized to the upstream probe is linked to ermG comes from our finding that DNA in PC81, which is in a different genus than the other five strains, also hybridized to the upstream probe. It is unlikely that the EcoRV and HindIII restriction fragments of the two groups that hybridize to the upstream probe would be the same size unless the region was on an element or part of an element that has been acquired along with the ermG gene. Thus, the cross-hybridizing DNA could be part of a transmissible element that is being transferred among the porcine strains. If so, it is not identical to the ermG-carrying CTns found in Bacteroides species.

Top Abstract Introduction Nucleotide sequence accession... References

 
The sequence of the IS element of PC78A (IS PC252) was submitted to GenBank and given the accession number AY904360. The accession numbers of other sequences deposited in GenBank can be found in Table 1.

 
This work was supported by Ellison Medical Foundation grant IDSS042703. Some of the probes used in this study were constructed in connection with another project that is funded by grant AI/GM 22383 from the U.S. National Institutes of Health.

 
* Corresponding author. Mailing address: Department of Microbiology, University of Illinois, B103 CLSL, 601 S. Goodwin Ave., Urbana, IL 61801. Phone: (217) 333-2061. Fax: (217) 244-8485. E-mail: nadjasho{at}life.uiuc.edu.

Top Abstract Introduction Nucleotide sequence accession... References

 

1
1. Aminov, R. I., J. C. Chee-Sanford, N. Garrigues, B. Teferedegne, I. J. Krapac, B. A. White, and R. I. Mackie. 2002. Development, validation, and application of PCR primers for detection of tetracycline efflux genes of gram-negative bacteria. Appl. Environ. Microbiol. 68:1786-1793.[Abstract/Free Full Text]
2
2. Aminov, R. I., N. Garrigues-Jeanjean, and R. I. Mackie. 2001. Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins. Appl. Environ. Microbiol. 67:22-32.[Abstract/Free Full Text]
3
3. Berryman, D. I., M. Lyristis, and J. I. Rood. 1994. Cloning and sequence analysis of ermQ, the predominant macrolide-lincosamide-streptogramin B resistance gene in Clostridium perfringens. Antimicrob. Agents Chemother. 38:1041-1046.[Abstract/Free Full Text]
4
4. Cooper, A. J., N. B. Shoemaker, and A. A. Salyers. 1996. The erythromycin resistance gene from the Bacteroides conjugal transposon Tc^rEm^r 7853 is nearly identical to ermG from Bacillus sphaericus. Antimicrob. Agents Chemother. 40:506-508.[Abstract]
5
5. Cotta, M. A., T. R. Whitehead, and R. L. Zeltwanger. 2003. Isolation, characterization, and comparison of bacteria from swine feces and manure storage pits. Environ. Microbiol. 5:737-745.[CrossRef][Medline]
6
6. Derbise, A., K. G. H. Dyke, and N. El Solh. 1996. Characterization of a Staphylococcus aureus transposon, Tn5405, located within Tn5404 and carrying the aminoglycoside resistance genes, aphA-3 and aadE. Plasmid 35:174-188.[CrossRef][Medline]
7
7. Leonard, C., Y. Chen, and J. Mahillon. 1997. Diversity and differential distribution of IS231, IS232 and IS240 among Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides. Microbiology 143:2537-2547.[Abstract/Free Full Text]
8
8. Leser, T. D., J. Z. Amenuvor, T. K. Jensen, R. H. Lindecrona, M. Boye, and K. Moller. 2002. Culture-independent analysis of gut bacteria: the pig gastrointestinal tract microbiota revisited. Appl. Environ. Microbiol. 68:673-690.[Abstract/Free Full Text]
9
9. Mahillon, J., R. Rezsohazy, B. Hallet, and J. Delcour. 1994. IS231 and other Bacillus thuringiensis transposable elements: a review. Genetica 93:13-26.[CrossRef][Medline]
10
10. Menou, G., J. Mahillon, M. M. Lecadet, and D. Lereclus. 1990. Structural and genetic organization of IS232, a new insertion sequence of Bacillus thuringiensis. J. Bacteriol. 172:6689-6696.[Abstract/Free Full Text]
11
11. Monod, M., S. Mohan, and D. Dubnau. 1987. Cloning and analysis of ermG, a new macrolide-lincosamide-streptogramin B resistance element from Bacillus sphaericus. J. Bacteriol. 169:340-350.[Abstract/Free Full Text]
12
12. Nikolich, M. P., N. B. Shoemaker, G. R. Wang, and A. A. Salyers. 1994. Characterization of a new type of Bacteroides conjugative transposon, Tc^r Em^r 7853. J. Bacteriol. 176:6606-6612.[Abstract/Free Full Text]
13
13. Roberts, M. C. 2002. Resistance to tetracycline, macrolide-lincosamide-streptogramin, trimethoprim, and sulfonamide drug classes. Mol. Biotechnol. 20:261-283.[CrossRef][Medline]
14
14. Santagati, M., F. Iannelli, M. R. Oggioni, S. Stefani, and G. Pozzi. 2000. Characterization of a genetic element carrying the macrolide efflux gene mef(A) in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 44:2585-2587.[Abstract/Free Full Text]
15
15. Shoemaker, N. B., H. Vlamakis, K. Hayes, and A. A. Salyers. 2001. Evidence for extensive resistance gene transfer among Bacteroides spp. and between Bacteroides and other genera in the human colon. Appl. Environ. Microbiol. 67:561-568.[Abstract/Free Full Text]
16
16. Van de Peer, Y., and R. De Wachter. 1994. TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput. Appl. Biosci. 10:569-570.[Free Full Text]
17
17. Wang, Y., G.-R. Wang, A. Shelby, N. B. Shoemaker, and A. A. Salyers. 2003. A newly discovered Bacteroides conjugative transposon, CTnGERM1, contains genes also found in gram-positive bacteria. Appl. Environ. Microbiol. 69:4595-4603.[Abstract/Free Full Text]
18
18. Whitehead, T. R., and M. A. Cotta. 2001. Characterisation and comparison of microbial populations in swine faeces and manure storage pits by 16S rDNA gene sequence analyses. Anaerobe 7:181-187.[CrossRef]
19
19. Whitehead, T. R., and M. A. Cotta. 2001. Sequence analyses of a broad host-range plasmid containing ermT from a tylosin-resistant Lactobacillus sp. isolated from swine feces. Curr. Microbiol. 43:17-20.[CrossRef][Medline]
20
20. Willis, R. W. 2000. Diarrhea in growing-finishing swine. Vet. Clin. N. Am. Food Anim. Pract. 16:135-161.[Medline]
21
21. Wilson, K., and R. Blitchington. 1996. Human colonic biota studied by ribosomal DNA sequence analysis. Appl. Environ. Microbiol. 62:2273-2278.[Abstract]
22
22. Wilson, K. H., J. S. Ikeda, and R. B. Blitchington. 1997. Phylogenic placement of community members of human colonic biota. Clin. Infect. Dis. 25(Suppl. 2):S114-S116.

---

Applied and Environmental Microbiology, August 2005, p. 4930-4934, Vol. 71, No. 8
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.8.4930-4934.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Susanna, K. A., den Hengst, C. D., Hamoen, L. W., Kuipers, O. P. (2006). Expression of Transcription Activator ComK of Bacillus subtilis in the Heterologous Host Lactococcus lactis Leads to a Genome-Wide Repression Pattern: a Case Study of Horizontal Gene Transfer. Appl. Environ. Microbiol. 72: 404-411 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, Y. Articles by Salyers, A. A. Search for Related Content PubMed PubMed Citation Articles by Wang, Y. Articles by Salyers, A. A. Agricola Articles by Wang, Y. Articles by Salyers, A. A.