Identification of Genes Involved in Cytochrome c Biogenesis in Shewanella oneidensis, Using a Modified mariner Transposon

A modified mariner transposon, miniHimar RB1, was generatedto mutagenize cells of the metal-reducing bacterium Shewanellaoneidensis. The use of this transposon led to the isolationof stable mutants and allowed rapid identification of disruptedgenes. Fifty-eight mutants, including BG104 and BG148 with transposoninsertions in the cytochrome c maturation genes ccmC and ccmF1,respectively, were analyzed. Both mutants were deficient inanaerobic respiration and cytochrome c production.

INTRODUCTION

Top

Introduction

Shewanella oneidensis is a gram-negative metal reducer thatbelongs to the ${gamma}$ group of the Proteobacteria (15, 33). It isa strict respirer that uses 14 different electron acceptorsfor respiration. These include oxygen, nitrate, and insolubleFe(III) and Mn(IV) oxides and oxyhydroxides (9, 12, 15), amongothers. In addition, Shewanella species, including S. oneidensis,can reduce toxic metals, such as chromium, arsenate, and uranium(14, 26, 27, 34). The genome sequence of S. oneidensis contains42 cytochrome c genes (6, 8). Some of these cytochromes arelocated in the outer membrane (10, 11), such as MtrC, a decahemec cytochrome that is involved in metal reduction (2).

We and other investigators have previously used Tn5 to generatemutants of S. oneidensis (2, 3, 24, 25). However, identificationof genes disrupted by Tn5 can be difficult and time-consuming.Additionally, the presence of the transposase within the insertionsequence elements can result in instability of the mutants (personalobservations). We have attempted to use miniTn5 to mutagenizeS. oneidensis but were not successful. To overcome these problems,we modified a minimariner transposon to isolate mutants of S.oneidensis.

Construction of pMiniHimar RB1 and isolation of S. oneidensis mutants.

Top

Construction of pminihimar rb1...

Derivatives of the mariner transposon, Himar1, have been usedto generate mutations in diverse organisms, such as Escherichiacoli, Mycobacterium smegmatis, and Myxococcus xanthus (7, 23,35). pMiniHimar1, a derivative of pMyk6K (23), was initiallyused in an attempt to isolate mutants of S. oneidensis, withoutsuccess. pMiniHimar1 contains a defective Himar1 element (magellan3)which includes an R6K ${gamma}$ origin of replication, a kanamycin resistancegene, and a transposase gene located downstream of a mycobacterialpromoter (23). To modify pMiniHimar1, the mycobacterial promoterwas removed by digestion with PvuI and NdeI and replaced witha 517-bp oriT-P_lac fragment that contains an origin of transfer(oriT) and the lac promoter (P_lac) that we have shown to functionin S. oneidensis (2). The oriT-P_lac fragment was obtained bycrossover PCR using oriT amplified from pJB3Cm6 (4) with theprimers oriTF (CATGCGATCGAGGCGATTAAGTTGGGTAAC; PvuI site underlined)and oriTR/lacF (CACATTAATTGCGTTGCGCTCACCCGCTGCATAACCCTGCTT)and P_lac amplified from pBC SK+ (Stratagene) with lacF (GTGAGCGCAACGCAATTAATGTG)and lacR (GGTCATATGTGTTTCCTGTGTGAAATT; NdeI site underlined).The resulting plasmid, pMiniHimar RB1 (Fig. 1), was used togenerate S. oneidensis mutants, with a transposition efficiencyof 3 x 10^–5. Transfer of the plasmid by conjugation andisolation of mutants were performed as described previously(1, 2) except that wild-type S. oneidensis cells were used inthe mating experiments. Analysis of 14 mutants by Southern transferindicated that all had single transposon insertions (data notshown). To identify disrupted genes, chromosomal DNA was digestedwith BamHI, self-ligated, and then used to transform E. coliEC100D⁺ (Epicentre Technologies). Purified plasmid DNA was sequencedusing the primer himar1 (CATTTAATACTAGCGACGCCATCT) and primer615 (TCGGGTATCGCTCTTGAAGGG). Sites of transposon insertionsin 58 mutants deficient in anaerobic respiration or metal reductionwere identified. Some of the disrupted genes in these mutantshave been previously identified and include genes encoding componentsof a type II secretion system, menaquinone biosynthesis proteins,and c cytochromes, such as mtrC and mtrA (1, 2, 5, 13, 16, 24).

View larger version (28K):
[in this window]
[in a new window]
FIG. 1. Map of pMiniHimar RB1. The locations of oriT-P_lac upstream of the transposase gene, inverted repeats (IR), origin of replication (R6K), and kanamycin (Km) resistance gene are indicated.

Analysis of cytochrome c maturation mutants.

Top

Analysis of cytochrome c...

In addition to the mutants mentioned above, we isolated twomutants, BG148 and BG104, with insertions in cytochrome c maturationgenes. BG148 has a transposon insertion in ccmC which is locatedwithin the ccmABCDE gene cluster. A 4.7-kb HindIII fragmentthat contains ccmABCDE was cloned, sequenced, and used to complementBG148. The ccm genes on this fragment encode proteins that are50% or more identical to cytochrome c maturation proteins fromother bacteria (see reference 31 for a review). CcmA and CcmBare components of an ABC transporter that is required for cytochromec maturation, whereas CcmC is thought to bind heme and presentit to the periplasmic heme chaperone CcmE (20, 22, 28, 29).

BG104 has a transposon insertion in ccmF1. CcmF1 is a proteinof 660 amino acids (The Institute for Genomic Research [TIGR]locus number SO0266) that is 44% identical to CcmF from E. coli(32) (GenBank database entry U00008). CcmF is a heme lyase responsiblefor heme ligation to the apocytochrome (21). ccmF1 lies upstreamof ccmG, ccmH, and a putative thioredoxin gene (TIGR locus no.SO0267, SO0268, and SO0269, respectively) (Fig. 2). A 2.58-kbfragment that contains ccmF1 was amplified by using cmfF (CGGCTTGGAAGCAAGATT),cmfR (CAGTTGGAAAGCCGGAATAGG), and Expand high-fidelity polymerase(Roche Biochemical), cloned into pJB3Cm6 (4), and used to complementBG104.

View larger version (6K):
[in this window]
[in a new window]
FIG. 2. Arrangement of the ccm genes on the S. oneidensis chromosome. Insertion sites of miniHimar RB1 (filled triangles) and the names of the resulting mutants are indicated.

The ccm mutants, BG104 and BG148, were tested for anaerobicreduction or growth with different electron acceptors used bythe wild type as described previously (25). Both mutants weredeficient in anaerobic growth with fumarate, trimethylamineoxide, and dimethyl sulfoxide (DMSO) (Table 1). They were alsodeficient in Fe(III) and Mn(IV) reduction and in anaerobic growthwith nitrate and nitrite (data not shown). Complementation ofthe mutants restored their ability to use these electron acceptors.

View this table:
[in this window]
[in a new window]
TABLE 1. Anaerobic growth of wild-type S. oneidensis, ccm mutants (BG104 and BG148), and complemented mutants (BG104C and BG148C)

BG104 and BG148 were tested for cytochrome c production underaerobic and anaerobic conditions. Aerobic growth was in 50 mlLB in 500-ml flasks with vigorous shaking for 3 h (early logphase). Anaerobic growth was in LB supplemented with 50 mM lactateand 10 mM fumarate in a Coy anaerobic chamber. Because the ccmmutants do not grow anaerobically, the cultures were first grownaerobically, then transferred to an anaerobic chamber, and incubatedfor 4 h. Heme staining was performed using 3,3',5,5'-tetramethylbenzidine dihydrochloride as described previously (30). Proteinbands that exhibited heme c peroxidase activity were detectedin cell extracts of wild-type S. oneidensis grown aerobicallyand anaerobically but were absent from the ccm mutant cell extracts(Fig. 3). In addition to having a loss of c cytochromes, BG104and BG148 were deficient in cytochrome c oxidase activity. Complementationrestored this activity to both mutants (data not shown). Lossof cytochrome c oxidase activity has been observed in Bradyrhizobiumjaponicum and Paracoccus denitrificans mutants deficient incytochrome c maturation (17-19).

View larger version (61K):
[in this window]
[in a new window]
FIG. 3. Detection of c-type cytochromes in S. oneidensis strains. Proteins (100 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then stained for heme-associated peroxidase activity. Lanes 1 through 3, cell extracts from aerobically grown wild type, BG104 (ccmF1 mutant), and BG148 (ccmC mutant); lanes 4 through 6, cell extracts from anaerobic wild type, BG104, and BG148.

The genome sequence of S. oneidensis contains two ccmF homologs,ccmF1 (described above) and ccmF2 (TIGR locus no. SO0478). AlthoughCcmF1 and CcmF2 are 50% identical, loss of CcmF1 led to lossof c cytochromes under the growth conditions used in our studies.This finding suggests that CcmF1 may be the major heme lyasein S. oneidensis. The function of CcmF2 remains to be determined.

Concluding remarks.

Top

Concluding remarks.

Modification of pMiniHimar1 by the introduction of oriT andP_lac upstream of the transposase gene led to the isolation ofa large number of S. oneidensis mutants. Multiple transposoninsertions were not detected in the mutants that we analyzed.Additionally, the transposon insertions in these mutants werestable even in the absence of antibiotic selection. pMiniHimarRB1 has been successfully used to generate mutations in otherbacteria, such as Xenorhabdus nematophila (S. Forst, personalcommunication), and should be useful for the mutagenesis ofother bacteria that are not amenable to electroporation or transformation.

Nucleotide sequence accession number.

Top

Nucleotide sequence accession...

The HindIII fragment that was sequenced was assigned GenBankaccession number AF044582.

ACKNOWLEDGMENTS

This work was supported by National Science Foundation grantMCB 9604298 and Department of Energy grant DE-FG0200ER15068.

We thank H. Kaplan for pMiniHimar1 and M. McBride for helpfulcomments and critical reading of the manuscript. We also thankS. Forst for sharing unpublished results.

FOOTNOTES

* Corresponding author. Mailing address: Department of Biological Sciences, University of Wisconsin—Milwaukee, 3209 N. Maryland Ave., Milwaukee, WI 53211. Phone: (414) 229-2964. Fax: (414) 229-3926. E-mail: daads{at}uwm.edu.

REFERENCES

Top