This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moon, G.-S.
Right arrow Articles by Kim, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moon, G.-S.
Right arrow Articles by Kim, W. J.
Agricola
Right arrow Articles by Moon, G.-S.
Right arrow Articles by Kim, W. J.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, September 2005, p. 5630-5632, Vol. 71, No. 9
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.9.5630-5632.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

SHORT REPORT

Secretion of Recombinant Pediocin PA-1 by Bifidobacterium longum, Using the Signal Sequence for Bifidobacterial {alpha}-Amylase

Gi-Seong Moon,1 Yu-Ryang Pyun,2 Myeong Soo Park,3 Geun Eog Ji,3,4 and Wang June Kim1*

Food Safety Research Division, Korea Food Research Institute, Seongnam, Gyeonggi 463-746, Korea,1 Department of Biotechnology, Yonsei University, Seoul 120-749, Korea,2 Research Center, BIFIDO Co., Ltd., Seoul 151-818, Korea,3 Department of Food and Nutrition, Seoul National University, Seoul 151-742, Korea4

Received 7 November 2004/ Accepted 14 April 2005


arrow
ABSTRACT
 
A recombinant DNA, encoding the chimeric protein of the signal sequence for bifidobacterial {alpha}-amylase mature pediocin PA-1, was introduced into Bifidobacterium longum MG1. Biologically active pediocin PA-1 was successfully secreted from the strain and showed bactericidal activity against Listeria monocytogenes and the same molecular mass as native pediocin PA-1.


arrow
INTRODUCTION
 
As a consequence of recurring and serious listeriosis outbreaks (5, 11), Listeria monocytogenes has become a focus of bacteriocin researchers. The search for bacteriocin-producing lactic acid bacteria has been directed towards substances whose targets are Listeria spp., and consequently, a large number of antilisterial bacteriocins have been revealed (2, 7, 12). Particularly, class IIa bacteriocins (pediocin-like bacteriocins) are highly active against Listeria spp. and are the most promising candidates for food biopreservatives (4). Pediocin PA-1, produced by Pediococcus spp., is a representative class IIa bacteriocin and has been heterologously produced by other genera to inhibit food-borne pathogens or food spoilage bacteria (6, 14, 17). However, to the best of our knowledge, study of the heterologous production of pediocin PA-1 in bifidobacteria has been absent. Bifidobacteria, the main microflora of the human intestinal tract (9), have been used as representative probiotics. Because bifidobacteria are generally recognized as safe and colonize the large intestine, they could be promising candidates as hosts for expression of beneficial foreign proteins/peptides for human use (8, 16). In this study, pediocin PA-1 was heterologously expressed in Bifidobacterium longum MG1 and secreted from the strain by using the signal sequence for bifidobacterial {alpha}-amylase. The recombinant B. longum MG1 efficiently killed L. monocytogenes in a coculture.

Escherichia coli JM109 was grown in LB medium at 37°C. B. longum MG1 was grown in MRS medium (Merck, Darmstadt, Germany) supplemented with 0.05% (wt/vol) L-cystein HCl (Sigma Co.) at 37°C without agitation. Lactobacillus plantarum NCDO 955 was grown in MRS medium at 37°C without agitation. L. monocytogenes KFRI 799 was grown in BHI medium at 35°C and on Oxford Listeria selective agar for the selective enumeration. Agar plates were made by adding 1.5% agar to broth media. Antibiotics (Sigma Co.) were added as selective agents with appropriate concentrations (chloramphenicol, 2 µ/ml for B. longum and 20 µ/ml for E. coli; ampicillin, 100 µ/ml). MRS agar plates spread with B. longum were anaerobically incubated in an atmosphere generation system (GasPak system, Oxoid, Basingstoke, Hampshire, England).

Plasmids and PCR product used in this study are summarized in Table 1. Primers PSamyF (5'-GCTCTAGAGCGGGCATCGCCGAATATACTCCC-3') and PSamyR (5'-GGCCTGTGCTGCGGTGCTGGC-3') were used to amplify a 400-bp fragment containing a promoter and deduced signal sequence of the bifidobacterial {alpha}-amylase gene. A recombinant DNA, pBESAF2, was used as the template. Primers pedSF (5'-AAATACTACGGTAATGGGGTTAC-3') and pedABR (5'-CGGGATCCCGAAAAAGCCGCAAGGCGAGGGAGGTGCTGCGTTCGCGTTTGGGACAACGTTTACTATTGGCTAGGC CACGT-3') were used to amplify a 570-bp region containing mature pedA and pedB. PedB (immunity protein) could be used for the bifidobacterial strains sensitive to pediocin PA-1. A putative bifidobacterial transcription terminator is underlined (15). Ped+ plasmid was used as the template. The two PCR products were ligated by T4 DNA ligase (Takara Bio, Shiga, Japan) and designated PSAB. PSAB was amplified by using primers PSamyF and pedABR and cloned into the yT&A cloning vector. The recombinant DNA, named pPSAB, was introduced into E. coli JM109. The E. coli transformant exhibited strong antimicrobial activity against an indicator, L. plantarum NCDO 955 (data not shown). This result indicates that the promoter and signal sequence for bifidobacterial {alpha}-amylase work well in the host strain. For the construction of the E. coli-Bifidobacterium shuttle vector, a 4.9-kb fragment containing pMG1 and the chloramphenicol acetyltransferase gene was liberated from pBESAF2 digested by the SphI and XbaI restriction enzymes and ligated with pPSAB digested by the same enzymes. The recombinant DNA, named pPSAB1 (Fig. 1A), was introduced into B. longum MG1 by using an electroporation method (1). A negative control DNA, named pYMGCAT, was also introduced in the host strain. As expected, B. longum MG1 transformed by pPSAB1 exhibited antimicrobial activity against L. plantarum NCDO 955, whereas the host strain transformed by pYMGCAT did not exhibit this (Fig. 1B). These results indicate that the bifidobacterial promoter and signal sequence work well in their own genus. Approximately 90% of pPSAB1 was stably maintained in B. longum MG1 over 20 successive subcultures without an antibiotic press, and the recombinant host strain still showed antimicrobial activity against L. plantarum NCDO 955 (data not shown).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Plasmids (PCR product) used in this study



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 1. Genetic map of pPSAB1 (A), antimicrobial activities of B. longum MG1 and its transformants (B), and bioassay after tricine SDS-PAGE of exported proteins of the transformants (C). (B): deferred antagonism assay (3) against L. plantarum NCDO 955; lane 1, MG1; lane 2, MG1(pYMGCAT); lane 3, MG1(pPSAB1). (C) L. monocytogenes KFRI 799 was used as an indicator; lane 1, exported proteins from MG1(pYMGCAT); lane 2, exported proteins from MG1(pPSAB1); lane 3, native pediocin PA-1.

To investigate the influence of bacteriocin production on the growth of B. longum MG1, two transformants, B. longum MG1(pPSAB1) and MG1(pYMGCAT), were cultured at 37°C for 3 days, and the optical density at 600 nm, pH value, and bacteriocin activity of the neutralized culture supernatant were measured periodically. B. longum MG1(pYMGCAT) did not show antimicrobial activity against L. monocytogenes KFRI 799 until 72 h, whereas B. longum MG1(pPSAB1) showed the activity after 24 h and it reached 64 arbitrary units/ml (3) at 72 h. Although the two transformants showed a difference in bacteriocin activity, meaningful differences did not appear in the optical density at 600 nm and pH value (data not shown). These results indicate that the production of recombinant pediocin PA-1 in B. longum MG1 has little influence on the growth of the host strain.

To confirm secretion of the recombinant pediocin PA-1 from B. longum MG1(pPSAB1), exported proteins from the transformant were precipitated with ammonium sulfate, followed by a well diffusion assay (3) and tricine sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The precipitate resuspended with distilled and deionized H2O showed antimicrobial activity against L. monocytogenes KFRI 799, whereas a precipitate from B. longum MG1(pYMGCAT) did not exhibit the activity (data not shown). The molecular mass of the antimicrobial peptide was the same as that of native pediocin PA-1 on a tricine SDS-PAGE gel (Fig. 1C). These results indicate that the recombinant pediocin PA-1 is expressed in and secreted from B. longum MG1(pPSAB1).

To investigate bactericidal activity of B. longum MG1 (pPSAB1) against L. monocytogenes, a coculture was performed in MRS broth. The transformant reduced cell counts of L. monocytogenes by 7 log compared with the control (only L. monocytogenes was inoculated), whereas B. longum MG1(pYMGCAT) reduced by 3 log (Fig. 2). These results indicate that recombinant pediocin PA-1 from B. longum MG1(pPSAB1) plays a significant role in the reduction of cell counts of L. monocytogenes. The secretion of the recombinant pediocin PA-1 in a probiotic Bifidobacterium sp. has a significant value, and regular intake of the improved probiotics could efficiently prevent several food-borne pathogens, including L. monocytogenes, from causing disease in human intestine.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 2. Changes of cell counts of L. monocytogenes during coculture with B. longum MG1(pPSAB1) or MG1(pYMGCAT). Lis, L. monocytogenes KFRI 799; MG1, B. longum MG1. Each point represents the average cell count from triple experiments.

In conclusion, a representative class IIa bacteriocin, pediocin PA-1, was expressed in and secreted from a B. longum strain by using the promoter and signal sequence for bifidobacterial {alpha}-amylase. To the best of our knowledge, this is the first report on heterologous production of bacteriocin in Bifidobacterium sp. and meaningful consequences for human health. However, for the application of the recombinant bacterium to humans, the plasmid vector should be changed into food-grade one.


arrow
ACKNOWLEDGMENTS
 
This study was supported by a grant (project no. E044010) of the Korea Food Research Institute. We also acknowledge the research support system of the National Research Lab on Probiotics, designated by the Korean Ministry of Science and Technology.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Food Safety Research Division, Korea Food Research Institute, San 46-1, Baekhyun-Dong, Bundang-Gu, Seongnam, Gyeonggi 463-746, Korea. Phone: 82-31-780-9110. Fax: 82-31-709-9876. E-mail: wjkim{at}kfri.re.kr. Back


arrow
REFERENCES
 
    1
  1. Argnani, A., R. J. Leer, N. van Luijk, and P. H. Pouwels. 1996. A convenient and reproducible method to genetically transform bacteria of the genus Bifidobacterium. Microbiology 142:109-114.[Abstract/Free Full Text]
    2. 2
  2. Berjeaud, J. M., and Y. Cenatiempo. 2004. Purification of antilisterial bacteriocins. Methods Mol. Biol. 268:225-233.[Medline]
    3. 3
  3. Daeschel, M. A. 1992. Procedures to detect antimicrobial activities of microorganisms, p. 57-80. In B. Ray and M. A. Daeschel (ed.), Food biopreservatives of microbial origin. CRC Press, Boca Raton, Fla.
    4. 4
  4. Ennahar, S., T. Sashihara, K. Sonomoto, and A. Ishizaki. 2000. Class IIa bacteriocins: biosynthesis, structure and activity. FEMS Microbiol. Rev. 24:85-106.[CrossRef][Medline]
    5. 5
  5. Farber, J. M., and P. I. Peterkin. 1991. Listeria monocytogenes, a food-borne pathogen. Microbiol. Rev. 55:476-511.[Abstract/Free Full Text]
    6. 6
  6. Horn, N., A. Fernandez, H. M. Dodd, M. J. Gasson, and J. M. Rodriguez. 2004. Nisin-controlled production of pediocin PA-1 and colicin V in nisin- and non-nisin-producing Lactococcus lactis strains. Appl. Environ. Microbiol. 70:5030-5032.[Abstract/Free Full Text]
    7. 7
  7. Ingham, A., M. Ford, R. J. Moore, and M. Tizard. 2003. The bacteriocin piscicolin 126 retains antilisterial activity in vivo. J. Antimicrob. Chemother. 51:1365-1371.[Abstract/Free Full Text]
    8. 8
  8. MacConaill, L. E., G. F. Fitzgerald, and D. van Sinderen. 2003. Investigation of protein export in Bifidobacterium breve UCC2003. Appl. Environ. Microbiol. 69:6994-7001.[Abstract/Free Full Text]
    9. 9
  9. Modler, H. W. 1994. Bifidogenic factors—sources, metabolism and applications. Int. Dairy J. 4:383-407.[CrossRef]
    10. 10
  10. Moon, G. S., Y. R. Pyun, and W. J. Kim. 2005. Characterization of pediocin operon of Pediococcus acidilactici K10 and expression of His-tagged recombinant pediocin PA-1 in Escherichia coli. J. Microbiol. Biotechnol. 15:403-411.
    11. 11
  11. Muriana, P. M. 1996. Bacteriocins for control of Listeria spp. in food. J. Food Prot. Suppl. 56:54-63.
    12. 12
  12. Nilsson, L., Y. Y. Ng, J. N. Christiansen, B. L. Jorgensen, D. Grotinum, and L. Gram. 2004. The contribution of bacteriocin to inhibition of Listeria monocytogenes by Carnobacterium piscicola strains in cold-smoked salmon systems. J. Appl. Microbiol. 96:133-143.[Medline]
    13. 13
  13. Park, M. S., J. M. Seo, J. Y. Kim, and G. E. Ji. 2005. Heterologous gene expression and secretion in Bifidobacterium longum. Lait 84:1-8.
    14. 14
  14. Rodríguez, J. M., M. I. Martínez, N. Horn, and H. M. Dodd. 2002. Heterologous production of bacteriocins by lactic acid bacteria. Int. J. Food Microbiol. 80:101-116.
    15. 15
  15. Rossi, M., P. Brigidi, A. G. V. Rodriguez, and D. Matteuzzi. 1996. Characterization of the plasmid pMB1 from Bifidobacterium longum and its use for shuttle vector construction. Res. Microbiol. 147:133-143.[Medline]
    16. 16
  16. Schell, M. A., M. Karmirantzou, B. Snel, D. Vilanova, B. Berger, G. Pessi, M.-C. Zwahlen, F. Desiere, P. Bork, M. Delley, R. D. Pridmore, and F. Arigoni. 2002. The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract. Proc. Natl. Acad. Sci. USA 99:14422-14427.[Abstract/Free Full Text]
    17. 17
  17. Somkuti, G. A., and D. H. Steinberg. 2003. Pediocin production by recombinant lactic acid bacteria. Biotechnol. Lett. 25:473-477.[CrossRef][Medline]

Applied and Environmental Microbiology, September 2005, p. 5630-5632, Vol. 71, No. 9
0099-2240/05/$08.00+0     doi:10.1128/AEM.71.9.5630-5632.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moon, G.-S.
Right arrow Articles by Kim, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moon, G.-S.
Right arrow Articles by Kim, W. J.
Agricola
Right arrow Articles by Moon, G.-S.
Right arrow Articles by Kim, W. J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»