Expression of the ubiE Gene of Geobacillus stearothermophilus V in Escherichia coli K-12 Mediates the Evolution of Selenium Compounds into the Headspace of Selenite- and Selenate-Amended Cultures

The ubiE gene of Geobacillus stearothermophilus V, with itsown promoter, was cloned and introduced into Escherichia coli.The cloned gene complemented the ubiE gene deficiency of E.coli AN70. In addition, the expression of this gene in E. coliJM109 resulted in the evolution of volatile selenium compoundswhen these cells were grown in selenite- or selenate-amendedmedia. These compounds were dimethyl selenide and dimethyl diselenide.

INTRODUCTION

Top

Introduction

Selenium plays an essential role in cellular metabolism whenpresent at controlled, defined concentrations. Higher levelsof selenium, however, are toxic. The relative toxicity of oxyanionsof selenium is SeO₃^2– > SeO₄^2– (4). Althoughthe mechanism(s) of selenite and selenate toxicity is not understoodat the molecular level, they probably act as or induce oxidizingagents that may cause general oxidative damage to the cell.In support of this possibility, proteomic analyses have shownthat the response of Escherichia coli to selenite and selenateexposure involves the induction of over 20 proteins, of which8 exhibit antioxidant properties (2).

The biomethylation of sulfur, selenium, and tellurium is a well-establishedphenomenon. Different biogenic, volatile, and methylated formsof these elements have been detected in the headspace of bothbacterial and fungal cultures (3), and mechanisms for the reductionand methylation of these metalloids have been discussed previously(4).

For several years, we have been studying resistance to heavymetals and metalloids exhibited by soil bacteria. Our modelhas been the thermotolerant, plasmidless, gram-positive rodGeobacillus stearothermophilus V (formerly Bacillus stearothermophilusV), which is naturally resistant to selenite (MIC > 175 µg/ml)and tellurite (MIC ${approx}$ 125 µg/ml) (13). Because we are interestedin identifying potential genes involved in this resistance,our strategy has been to construct gene libraries of G. stearothermophilusV and to utilize them to transform metalloid-sensitive E. colihosts, selecting for the acquisition of a metalloid resistancephenotype. Using this strategy, we have shown that cysK andiscS gene products of G. stearothermophilus V mediate low-leveltellurite resistance in E. coli (11, 14) and that the ubiE geneproduct of this bacterium mediates resistance to tellurium toxicsalts through the conversion of tellurate into volatile Te compounds(1). In this work, we communicate that the ubiE gene of G. stearothermophilusV is also responsible for the evolution of CH₃SeCH₃ (dimethylselenide [DMSe]) and CH₃SeSeCH₃ (dimethyl diselenide [DMDSe])into the headspace of SeO₃^2–- or SeO₄^2–-amendedE. coli cultures.

To clone the G. stearothermophilus V ubiE gene along with itsown promoter (600pr), appropriate DNA fragments were obtainedby PCR using plasmid p1VH as the template (1) and primers ORF600pr,GTCGGAGCGTTTTGATTTTTGCTTCCTTTG (nucleotides 1675 to 1704, GenBankaccession number AAR04820), and ORF600R (1). The amplified PCRproduct was cloned into a pGEM-T cloning vector, sequenced,and used for all subsequent work.

To obtain mixed selenium-sulfide compounds, the chemical reductionof CH₃SSCH₃ (dimethyl disulfide) in the presence of DMDSe wascarried out as described previously (3, 10). Gas chromatographywith fluorine-induced chemiluminescence and gas chromatography/massspectrometry were used to detect organoselenium compounds abovebacterial headspace as described elsewhere (1, 10).

ORF600 of Geobacillus stearothermophilus V encodes a UbiE methyltransferase.

Top

Orf600 of geobacillus...

Open reading frame 600 (ORF600), carrying the ubiE gene of G.stearothermophilus V is one of three major ORFs encoded in plasmidp1VH, which was originally isolated as a tellurite-resistantrecombinant clone upon transformation of tellurite-sensitiveE. coli with a HindIII gene library of G. stearothermophilusV (1). We reported previously that the expression of this genein E. coli cells that were exposed to potassium tellurate resultedin the evolution of dimethyl telluride (1). To show that thisgene encodes a true UbiE methyltransferase, we cloned the ubiEgene, including its promoter, into the pGEM-T cloning vector.The cloned gene was then transformed into E. coli AN70, an ubiE-deficientstrain which was isolated after N-methyl-N'-nitro-N-nitrosoguanidinetreatment of E. coli AB3311 (15).

As shown in Table 1, the presence of the ubiE gene was requiredto overcome the difficulty for this strain to grow with succinateas the sole carbon source. The expression of the G. stearothermophilusV ubiE gene in both E. coli AN70 and E. coli JM109 was demonstratedby reverse transcription (RT)-PCR analysis (Fig. 1, arrow) usingprimers ORF600F and ORF600R (1).

View this table:
[in this window]
[in a new window]
TABLE 1. Genetic complementation of E. coli^a with the ubiE gene of G. stearothermophilus V

View larger version (111K):
[in this window]
[in a new window]
FIG. 1. Expression of the G. stearothermophilus V ubiE gene in E. coli. Agarose gel (1.5%) electrophoresis of the RT-PCR products obtained using primers ORF600F and ORF600R, specific for the ubiE gene of G. stearothermophilus V, was performed (1). In each case, the template was 20 ng of total RNA extracted from E. coli AN70 (lane A), E. coli JM109 (lane B), E. coli AN70/600pr (lane C), or E. coli JM109/600pr (lane D). Lane E is a negative control to which no template was added. Std, molecular weight standard (HaeIII-digested ${Phi}$ X174 replicative-form DNA). After incubating the RNA preparations at 25°C for 30 min with 1 unit of RQ1 DNase (Promega), the deoxyribonuclease was inactivated for 10 min at 70°C. The RT-PCR was then incubated for 1 h at 42°C and then for 30 cycles that consisted of 1 min at 95°C, 1 min at 55°C, and 1 min at 72°C, followed by a final extension of 10 min at 72°C.

A low level of growth of E. coli AN70 was also seen in M9 mediumsupplemented with glucose, confirming the metabolic illnessof this strain; these growth difficulties were almost overcomewhen E. coli AN70 was grown in M9 minimal medium supplementedwith yeast extract or with Casamino Acids (Table 1). Since theAN70 strain grew very poorly in the presence of Se oxyanions,the following results were obtained using E. coli JM109 as host.

The UbiE methyltransferase of G. stearothermophilus V methylates selenite and selenate salts.

Top

The ubie methyltransferase of...

E. coli JM109 cells carrying the G. stearothermophilus ubiEgene or the cloning vector alone was grown in the presence of0.2 mM sodium selenite or 0.2 mM sodium selenate, and cultureheadspaces were analyzed for the presence of volatile organoseleniumcompounds as described above. As shown in Fig. 2B and D, theexpression of the G. stearothermophilus V ubiE gene resultedin the evolution of organoselenium compounds like DMSe and DMDSe.Totals of 2.5-fold more DMSe and 9-fold more DMDSe in the headspaceof selenate-amended cultures than in those that were grown inthe presence of sodium selenite were found (Fig. 2B and D).None of these volatile organoselenium derivatives was seen inthe headspace of control cell cultures carrying the cloningvector alone (Fig. 2A and C).

View larger version (19K):
[in this window]
[in a new window]
FIG. 2. Detection of volatile selenium compounds above the headspace of E. coli expressing the ubiE gene of G. stearothermophilus V. A to D, Fluorine-induced chemiluminescence/gas chromatography chromatogram from 1 ml of headspace of E. coli JM109 carrying pGEM-T cloning vehicle (A and C) or plasmid 600pr (B and D). Cells were grown for 48 h in the presence of 0.2 mM Na₂SeO₃ (A and B) or 0.2 mM Na₂SeO₄ (C and D). Chromatograms are representatives of triplicate runs.

These results showed that ORF600, encoding UbiE methyltransferase,is responsible for the selenium biomethylation seen in E. coliJM109/600pr. Thus, as expected and as observed with telluriteamendments (1), this recombinant E. coli strain appears to beable to reduce and methylate not only sulfur salts (as sulfatein the growth medium) to organosulfur compounds, but also seleniumsalts to DMSe and DMDSe.

One of the most important results of this work is the clearrequirement of the expression of the G. stearothermophilus VubiE gene for selenium biomethylation in E. coli. The controldata in Table 1 and Fig. 2A and C show that the absence of thismethyltransferase gene does not allow the methylation of seleniumoxyanions; however, the expression of ubiE yields volatile organoseleniumcompounds (Fig. 2B and D).

In addition to the results reported here, other methyltransferasesbelonging to the thiopurine methyltransferase and to the UbiE-MmtAgroups that participate in metalloid biomethylation in bacteriahave been described previously in the literature (6, 7, 8).A phylogenetic analysis using sequences of proteins belongingto the above groups, which included the G. stearothermophilusV methyltransferase studied here, positioned it undoubtedlywithin the UbiE subgroup (Fig. 3). These results suggest thatG. stearothermophilus V UbiE may play a selenium-methylatingfunction in addition to its classical C-methylation activityduring ubiquinone-menaquinone biosynthesis.

View larger version (45K):
[in this window]
[in a new window]
FIG. 3. Neighbor-joining phylogenetic tree of UbiE/COQ5 (A), UbiE/MmtA (B), and thiopurine methyltransferase (C) methyltransferase enzymes. Fifty-nine different sequences, including proteins belonging to the above groups, were used. Alignments of the sequences were performed using the Clustal X (12) program, and the phylogenetic tree was computed using MEGA software (version 3.1) (5). Organism names, a distance scale, bootstrap values, and GenBank accession numbers of the sequences used are indicated in the figure. The black arrow indicates the G. stearothermophilus V UbiE enzyme.

ACKNOWLEDGMENTS

This work was supported by grant no. 1030234 from FONDECYT andDICYT (Universidad de Santiago de Chile) to C.C.V. and a RobertA. Welch Departmental Grant and Enhancement Grant for Researchto J.W.S., M.F.P., and T.G.C. D.E.F. and M.A.A. were supportedby doctoral fellowships from MECESUP UCH106 (Chile).

We thank Catherine F. Clarke at UCLA for providing the ubiE-deficientstrain E. coli AN70.

FOOTNOTES

* Corresponding author. Mailing address: Laboratorio de Microbiología Molecular, Departamento de Ciencias Biológicas, Facultad de Química y Biología, Universidad de Santiago de Chile, Casilla 40, Correo 33, Santiago, Chile. Phone: (56) 2 681 0357. Fax: (56) 2 681 2108. E-mail: cvasquez{at}usach.cl

J.W.S. and D.E.F. contributed equally to this work.

Present address: Roche Diagnostics Chile, Av. Quilín,3750 Santiago, Chile.

REFERENCES

Top