This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bigot, A.
Right arrow Articles by Charbit, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bigot, A.
Right arrow Articles by Charbit, A.
Agricola
Right arrow Articles by Bigot, A.
Right arrow Articles by Charbit, A.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, October 2006, p. 6623-6631, Vol. 72, No. 10
0099-2240/06/$08.00+0     doi:10.1128/AEM.00624-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

A Homolog of Bacillus subtilis Trigger Factor in Listeria monocytogenes Is Involved in Stress Tolerance and Bacterial Virulence

Armelle Bigot,{dagger} Eleonore Botton,{dagger} Iharilalao Dubail, and Alain Charbit*

INSERM U-570, CHU Necker-Enfants Malades, 156, rue de Vaugirard, 75730 Paris Cedex 15, France

Received 17 March 2006/ Accepted 21 July 2006


arrow
ABSTRACT
 
Molecular chaperones play an essential role in the folding of nascent chain polypeptides, as well as in the refolding and degradation of misfolded or aggregated proteins. They also assist in protein translocation and participate in stress functions. We identified a gene, designated tig, encoding a protein homologous to trigger factor (TF), a cytosolic ribosome-associated chaperone, in the genome of Listeria monocytogenes. We constructed a chromosomal {Delta}tig deletion and evaluated the impact of the mutation on bacterial growth in broth under various stress conditions and on pathogenesis. The {Delta}tig deletion did not affect cell viability but impaired survival in the presence of heat and ethanol stresses. We also identified the ffh gene, encoding a protein homologous to the SRP54 eukaryotic component of the signal recognition particle. However, a {Delta}ffh deletion was not tolerated, suggesting that Ffh is essential, as it is in Bacillus subtilis and Escherichia coli. Thus, although dispensable for growth, TF is involved in the stress response of L. monocytogenes. The {Delta}tig mutant showed no or very modest intracellular survival defects in eukaryotic cells. However, in vivo it showed a reduced capacity to persist in the spleens and livers of infected mice, revealing that TF has a role in the pathogenicity of L. monocytogenes.


arrow
INTRODUCTION
 
Listeria monocytogenes is a gram-positive bacterium that is widespread in nature and is responsible for sporadic severe infections in humans and other animal species (20). L. monocytogenes is a facultative intracellular pathogen that is capable of invading most host cells, including epithelial cells, hepatocytes, fibroblasts, endothelial cells, and macrophages (56). The molecular mechanisms of its intracellular parasitism have been investigated extensively, and several secreted or surface-exposed proteins (such as listeriolysin O, phospholipases, and internalins) have been shown to play a crucial role in the virulence of this pathogen (14, 18).

The dedicated export machinery and folding catalysts, which help exported proteins arrive at their final destinations and with the correct folding, are thus likely to play a key role in the pathogenesis of L. monocytogenes. Several proteins involved in protein secretion, maturation, or sorting have already been identified (7, 8, 10, 35, 46). However, the potential role of cytosolic chaperones in the pathogenesis of L. monocytogenes has not been addressed previously.

Trigger factor (TF) is a ribosome-associated cytosolic chaperone that possesses peptidyl-prolyl cis/trans-isomerase activity (4, 19, 30). This highly conserved molecular chaperone and folding catalyst is one of the first chaperones to interact with the signal sequence of nascent preproteins (6, 40, 51). In Bacillus subtilis, TF is not essential for protein secretion or cell viability under normal conditions (26, 47). In the human pathogen Streptococcus pyogenes, TF (also designated RopA) is required for secretion and maturation of the secreted cysteine protease SpeB (38, 39, 43). An S. pyogenes TF mutant produces the protease but does not secrete it, suggesting that TF is required for its targeting to the secretory pathway. Moreover, a mutant TF lacking only the central region of the protein allows normal secretion of the protease, but the secreted protein has a defect in processing to the mature form (38). Very recently, a TF homologue has also been identified (58) in Streptococcus mutans, the primary etiological agent of human dental caries. Inactivation of the gene encoding TF did not have a major impact on the growth rate in broth. However, the mutant strain showed decreased tolerance to stresses such as acid killing and to oxidative stresses and an altered capacity to form biofilms (58).

In mammalian cells, the signal recognition particle (SRP) and the SRP receptor play a central role in targeting presecretory proteins to the membrane of the endoplasmic reticulum (59). An SRP-like system has also been identified in both gram-negative and gram-positive bacteria and is composed of small cytoplasmic RNA (scRNA) (also called 4.5S RNA) and the fifty-four homologue (Ffh). FtsY is the SRP receptor at the bacterial membrane (42). Recent data have shown that signal peptide hydrophobicity could be a critical determinant for signal peptide binding to Ffh or TF in B. subtilis (61), as it is in gram-negative bacteria (11, 52, 53).

These observations prompted us to address the role of TF and Ffh in L. monocytogenes. We identified the genes encoding TF and Ffh homologues in the genome of L. monocytogenes strain EGD-e (25). We successfully constructed a {Delta}tig chromosomal deletion mutant of L. monocytogenes and studied the impact of the {Delta}tig deletion on stress responses, protein secretion, and L. monocytogenes pathogenesis. Our data indicate that TF has a role in stress tolerance and in virulence.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and growth conditions.
Brain heart infusion (BHI) (Difco Laboratories, Detroit, Mich.) and Luria-Bertani (Difco Laboratories) broth and agar were used to growth L. monocytogenes and Escherichia coli strains, respectively. We used the reference strain L. monocytogenes EGD-e belonging to serovar 1/2a (25). Wild-type bacteria were transformed by electroporation, as previously described (45). Strains harboring plasmids were grown in the presence of the following antibiotics: for pUC19 derivatives, 100 µg ml–1 ticarcillin; and for pAUL-A derivatives, 150 µg ml–1 (E. coli) or 5 µg ml–1 (L. monocytogenes) erythromycin. Plasmids and strains used in this study are listed in Table 1.


View this table:
[in this window]
[in a new window]
  		TABLE 1. L. monocytogenes strains and plasmids used in this study

Genetic manipulations.
Chromosomal DNA and plasmid isolation, restriction enzyme analyses, and PCR amplification were performed according to standard protocols (1, 49). Restriction enzymes and ligase were purchased from New England Biolabs and Gibco and were used as recommended by the manufacturers. DNA was amplified with the DNA polymerase DyNAzyme (Finnzymes, Espoo, Finland) using a thermal cycler (Bio-Rad, Marne La Coquette, France). Oligonucleotides were synthesized by Eurogentec. Nucleotide sequencing was carried out with Taq dideoxy terminators and by using the DyePrimer cycling sequence procedure developed by Applied Biosystems (Perkin-Elmer) with fluorescently labeled primers purchased from Life Technologies, Paisley, Scotland. Labeled extension products were analyzed with an ABI Prism 310 apparatus (Perkin-Elmer, Applied Biosystems). Protein and nucleotide databases were searched using the programs BLASTP and BLASTN (National Center for Biotechnology Information, Los Alamos, NM), available via the Internet. Protein sequences were aligned by using the CLUSTALW program (http://www.infobiogen.fr/services/analyseq/cgi-bin/clustalw_in.pl).

Construction of a {Delta}tig chromosomal deletion mutant of L. monocytogenes.
We constructed a {Delta}tig mutant of L. monocytogenes strain EGD-e carrying a 1,261-bp deletion (from nucleotide 1 to nucleotide 1261) that left only the six last codons of the gene. Chromosomal integration was performed by allelic replacement, using the standard procedure described previously (28, 36). Briefly, two DNA fragments flanking the tig genes were amplified by PCR from EGD-e chromosomal DNA (Table 2 shows the pairs of primers used for each PCR). The primers used for the 5' fragment (designated fragment A) were primers 1 and 2; the primers used for the 3' fragment (designated fragment B) were primers 3 and 4. After PCR amplification, fragments A (1,121 bp) and B (720 bp) were purified (using a QIAGEN Qiaprep Spin Miniprep kit) and digested with restriction enzymes HindIII and BamHI (fragment A) or BamHI and EcoRI (fragment B). The two fragments were successively cloned into pUC19 and digested by BamHI and EcoRI (to obtain pUC19+B [Table 1]) and then by HindIII and BamHI (to obtain plasmid pUC19+{Delta}tig). The fragment A-fragment B region was then amplified from the recombinant plasmid (with primers 17 and 18), digested by HindIII and XbaI, and finally subcloned in the thermosensitive shuttle vector pAUL-A. The resulting plasmid, designated pAUL-A+{Delta}tig, was then electroporated into EGD-e. After electroporation, selected clones were grown at a nonpermissive temperature (37°C) with erythromycin to force chromosomal integration of the recombinant plasmids via a single crossover. We then screened the second crossover event, leading to excision of the plasmid (Ems clones), by growing the recombinant bacteria at a permissive temperature for many generations in the absence of erythromycin. The resulting EGD-{Delta}tig mutant was verified by sequence analysis of chromosomal DNA using pairs of internal or flanking primers.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Primers used in this study

Construction of a {Delta}ffh chromosomal deletion mutant.
We attempted to construct a {Delta}ffh mutant by the same procedure in wild-type EGD-e, as well as in an EGD-{Delta}tig genetic background. To do this, two DNA fragments flanking the ffh genes were ligated and cloned into the thermosensitive plasmid pAUL-A, yielding pAUL-A-{Delta}ffh. This plasmid was then introduced into either EGD-e or EGD-{Delta}tig. Chromosomal integration of the recombinant plasmid was obtained (using the procedure described above for construction of the {Delta}tig mutant). The second crossover event, leading to excision of the plasmid, was screened by growing the recombinant bacteria at a permissive temperature for up to ~100 generations in the absence of erythromycin. All the clones recovered were either still Emr (i.e., had not lost the integrated plasmid) or Ems but had lost the plasmid carrying the mutated ffh region (reconstituting a wild-type chromosomal region). Thus, the second crossover event, leading to the allelic exchange, was possible only when the wild-type ffh allele was kept on the bacterial chromosome, strongly suggesting that both the {Delta}ffh single mutation and the {Delta}tig-{Delta}ffh double mutation are lethal.

RNA extraction and reverse transcription-PCR (RT-PCR).
Cultures of L. monocytogenes EGD-e (at an optical density at 600 nm [OD600] of 0.4) were centrifuged at 4,000 x g for 10 min, and the pellets were resuspended in 1 ml of Trizol (Invitrogen) and then broken with a Fastprep apparatus (two 30-s treatments at the maximum speed). The tubes were centrifuged (13,000 x g, 1 min), and the supernatants were transferred to new tubes containing 300 µl of chloroform-isoamyl alcohol. After 10 min of centrifugation at 13,000 x g, each aqueous phase was transferred to a tube containing isopropanol. Total RNA was then precipitated overnight at 4°C and washed twice with 500 µl of 70% ethanol. The RNA was resuspended in 60 µl of RNase-free water. Contaminating DNA was removed by two digestions with DNase used according to the instructions of the manufacturer (Roche Diagnostics, Mannheim, Germany). After digestion, RNA was purified with an RNeasy kit (QIAGEN) and eluted in 30 µl of RNase-free water.

RT-PCR experiments were carried out with 4 µl of RNA and 2.5 pmol of specific reverse primers for each amplification. After denaturation at 65°C for 10 min, 12 µl of a mixture containing 2 µl of deoxynucleoside triphosphates (25 mM), 4 µl of 4x buffer, 2 µl of dithiothreitol, 1 µl of RNasin (Promega), and 1.5 µl of Superscript II (Invitrogen) was added. Samples were incubated for 60 min at 42°C, heated at 75°C for 15 min, and chilled on ice. Samples were diluted with 40 µl of H2O and stored at –20°C.

For classical reverse transcription-PCR, the conditions were identical for all reactions. The 50-µl reaction mixtures consisted of 5 µl of template, 10 pmol of each primer, 1 µl of deoxynucleoside triphosphates (10 mM), 5 µl of 5x buffer, and 0.5 µl of DyNAzyme DNA polymerase (Finnzymes, Espoo, Finland), and a thermal cycler obtained from Bio-Rad (Marne La Coquette, France) was used. Primers 5 to 16 were used to amplify the cDNAs (Table 2).

For cDNA quantitation, amplification was monitored with the SYBR green fluorescent dye. The specific primers used for this reaction were primers 19 and 20 (for tig) and primers 21 and 22 (for the gyrA gene, which was used as an internal control). For each reaction, the mixture consisted of 25 µl of template, 12.5 µl of SYBR green Jumpstart Taq ReadyMix (Sigma), 1 µl of each primer (10 µM), and 5.5 µl of water. The reactions were carried out in sealed tubes using an ABI PRISM 7700 sequence detection system (Applied Biosystems). For each cDNA template, the reaction was carried out five times for the tig gene and five times for the gyrA gene. The gyrA housekeeping gene was chosen to normalize the results because in L. monocytogenes its expression has been shown to remain constant under various conditions (3). The means of the five replicates were used to obtain a tig/gyrA expression ratio. The reactions were carried out several times to obtain several ratios for the same RNA sample and for different RNA samples (biological replicates). The data presented below are the means and standard deviations of at least two different experiments (up to six experiments for the 37°C experiment and the 50°C heat shock experiment).

Temperature, ethanol, and NaCl stresses. (i) Temperature stress.
For heat shock, L. monocytogenes EGD-e and EGD-{Delta}tig were grown in BHI medium at 37°C until mid-log phase (OD600, 0.5). A fraction of each culture was plated onto BHI agar and incubated at 37°C (zero-time control). The remaining portions of the cultures were shifted to 50°C and incubated for up to 1 h with agitation. For each strain, fractions were collected at 15-min intervals and plated on dishes at 37°C to determine the number of surviving bacteria. The resistance to heat shock was expressed as the percentage of surviving bacteria after incubation at 50°C (for each time the ratio of the number of CFU after incubation at 50°C to the initial number of CFU). The experiment was repeated three times.

For cold shock, L. monocytogenes EGD-e and EGD-{Delta}tig were grown until mid-log phase in BHI medium at 37°C. Then the strains were plated on dishes and incubated at 4°C. The number of surviving bacteria was monitored for 12 days by transferring the plates to 37°C.

(ii) Ethanol stress.
Five-milliliter portions of overnight BHI medium cultures of EGD-e and EGD-{Delta}tig were diluted in 45 ml of BHI medium supplemented with ethanol at a final concentration of 3% (vol/vol). Growth in the presence of ethanol was determined by monitoring the OD600.

(iii) Salt stress.
Similarly, the growth of EGD-e and EGD-{Delta}tig was monitored in the presence of NaCl at final concentrations ranging from 340 mM to 1.7 M.

Protein preparation and analyses.
Proteins were prepared from EGD-e and EGD-{Delta}tig grown in Luria-Bertani medium supplemented with 10% BHI.

(i) Secreted proteins.
Bacteria were grown at 4°C, 37°C, or 42°C with agitation and collected by centrifugation in mid-log phase. Cell-free supernatants were filtered through a 0.22-µm-pore-size Millipore filter. The filtered supernatants were concentrated by the methanol extraction method described previously (13) and were finally solubilized in 500 mM Tris-HCl (pH 8).

(ii) Envelope proteins.
Extracts were prepared from the bacterial pellets of mid-log-phase cultures. The pellets were washed once in phosphate-buffered saline, and then the bacteria were broken with a Fastprep apparatus. Envelope fractions were recovered by centrifuging the lysate at 18,000 x g for 45 min at 4°C. Contaminating proteins were removed from each pellet by solubilization; the pellet was vortexed for 5 min with 500 µl of 2% Triton X-100, and the supernatant was discarded. The pellet was finally resuspended in 50 mM Tris-HCl (pH 8). The amount of total protein in each extract was determined by the Bradford method (12).

The extracts were finally resuspended in sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) loading buffer, and 15 µg of each extract was loaded into each well on 11% SDS-polyacrylamide gels. After electrophoresis, the gels were either silver stained or treated with Coomassie blue.

Cell cultures and infections. (i) Culture of cell lines.
Mouse macrophage cell line J774 (ATCC TIB67), human colon carcinoma cell line Caco-2 (ATCC HTB37), and human hepatocellular carcinoma cell line HepG-2 (ATCC HB 8065) were propagated as previously described (17) in RPMI medium containing 10% fetal bovine serum. Cells were seeded at a concentration of 2 x 105 cells per well in 12-well tissue culture plates (Falcon). Monolayers were used 24 h (J774 and Caco-2) or 48 h (HepG-2) after seeding.

(ii) Bone marrow-derived macrophages.
Bone marrow-derived macrophages (BMM) from a BALB/c mouse were obtained and cultured as described previously (15).

(iii) Invasion assays.
The invasion assays were carried out essentially as described previously (23). Briefly, cell monolayers were incubated for 30 min (BMM and J774) or 1 h (Caco-2 and HepG-2) at 37°C with the bacterial suspensions in Dulbecco modified Eagle medium (multiplicities of infection, 0.1 for BMM, 1 for J774, and 100 for nonphagocytic cell lines) to allow the bacteria to enter. After washing (time zero of the kinetic analysis), the cells were incubated for several hours in fresh culture medium containing gentamicin (10 µg ml–1) to kill extracellular bacteria. At several times, cells were washed three times in RPMI and processed for counting of infecting bacteria. For this, cells were lysed with distilled water. The titer of viable bacteria released from the cells was determined by spreading preparations onto BHI medium plates. For each strain and time in an experiment, the assay was performed in triplicate. Each experiment was repeated at least twice.

Infection of mice and virulence assays.
The virulence of the mutant was first estimated by determining the 50% lethal dose (LD50) using the Probit method (48). Animal experiments were performed according to the INSERM guidelines for laboratory animal husbandry. Specific-pathogen-free, 6-to 8-week-old, female Swiss mice (Janvier, Le Genest St. Isle, France) were used. Bacteria were diluted in 0.15 M NaCl and then inoculated intravenously (i.v.) into the mice via the lateral tail vein (0.5 ml). Groups of five mice were challenged with various doses of bacteria (107, 106, 105, and 104 bacteria per mouse), and mortality was observed for 10 days.

Bacterial growth in organs was monitored after i.v. inoculation of 104 bacteria. After 1, 2, 3, 6, or 7 days of incubation, groups of five to eight mice for each strain were sacrificed, and organs (spleens and livers) were aseptically removed and separately homogenized in 0.15 M NaCl. Bacterial counts in organ homogenates were determined at various times on BHI agar plates, as described previously (2). The whole kinetic analysis was performed twice. The data were analyzed statistically by using Student's t test.


arrow
RESULTS
 
lmo1267 gene encodes TF.
We identified a unique gene, designated tig, in the genome of L. monocytogenes strain EGD-e by BLASTP search, using the amino acid sequence of TF from B. subtilis. The L. monocytogenes tig gene encodes a 427-amino-acid protein having 62% identity with TF of B. subtilis. The central domain, which has homology to the FK506-binding peptidyl-prolyl cis/trans-isomerase family, is the most conserved portion of the protein (76% identity). The N- and C-terminal domains (residues 1 to 161 and 248 to 427), which are required for binding to substrate polypeptides (37), show lower levels of sequence conservation (61% and 44% identity, respectively).

Genetic organization of the tig locus.
The tig gene is localized between two open reading frames in the same orientation. Upstream, lmo1266 encodes a 312-residue protein whose function is unknown. Downstream, clpX encodes a protein that has been shown to participate in virulence and stress resistance in Salmonella enterica serovar Typhimurium and Staphylococcus aureus (21, 22, 60). The functions of clpX in L. monocytogenes are currently unknown. The three genes are flanked by two predicted transcription terminators (Fig. 1). We analyzed transcription of the tig locus by RT-PCR in wild-type strain EGD-e and in the EGD-{Delta}tig mutant grown in laboratory conditions (see Materials and Methods). This assay showed that the three genes were cotranscribed (Fig. 1B), suggesting that they belong to an operon. Moreover, lmo1266 and clpX were still transcribed in the {Delta}tig mutant, indicating that the deletion did not have a polar effect on the expression of the adjacent genes.


Figure 1
View larger version (32K):
[in this window]
[in a new window]
  		FIG. 1. Genetic organization of the tig locus of L. monocytogenes and transcriptional analysis. (A) Schematic diagram of the organization of the tig locus. The arrows indicate the approximate sizes and orientations of the different genes. The lollipop-shaped symbols indicate putative transcription terminators. The numbers above brackets indicate the sizes (in base pairs) of the intergenic regions. The deleted region ({Delta}) in the tig mutant is indicated by a gray bar. (B) RT-PCR. The arrows and dotted lines in panel A indicate the positions of the primers and PCR products used in the RT-PCR analysis. The amplified products, designated 1 to 6, were subjected to Tris-acetate-EDTA-agarose gel electrophoresis. Gel a, RT-PCR with RNA of wild-type strain EGD-e grown until mid-log phase at 37°C in BHI broth; gel b, positive control (DNA); gel c, negative control (no reverse transcriptase).

Notably, a {sigma}B-dependent promoter 47 bp upstream of lmo1266 was predicted using the program available at the Database of Transcriptional Regulation in B. subtilis (http://dbtbs.hgc.jp/). This promoter (GGTTAGATTTTTAACAATAAGGGTAAA [underlined bases correspond to the bipartite sigma recognition sequence]) has only two mismatches compared to the canonical {sigma}B promoter of L. monocytogenes described previously (60). A similar genetic organization is found in B. subtilis (the genes are designated ysoA, tig, and clpX, respectively) and in the nonpathogenic species Listeria innocua (25), as well as in other isolates of L. monocytogenes whose sequences are known (44). This three-gene organization is also conserved in several species of Bacillus (Bacillus anthracis, Bacillus halodurans, Bacillus cereus) and in staphylococci (S. aureus, Staphylococcus epidermidis). In some other bacterial species, tig is followed by a clpP gene, and in E. coli, tig is followed by both clpP and clpX.

Role of TF in bacterial growth and stress resistance.
The growth kinetics of the EGD-{Delta}tig mutant were first compared to the growth kinetics of EGD-e in minimal medium (not shown) or in BHI medium at 37°C (Fig. 2A), 4°C, and 42°C (not shown). At different times during growth, the morphology of the bacteria was also determined by Gram staining (not shown). In all the conditions tested, the growth and morphology of EGD-{Delta}tig were undistinguishable from the growth and morphology of parental strain EGD-e, indicating that the lack of TF had no effect on bacterial septation and growth in broth.


Figure 2
View larger version (25K):
[in this window]
[in a new window]
  		FIG. 2. Growth and stresses. (A) Growth at 37°C. Growth in BHI medium at 37°C was monitored for strains EGD-e and EGD-{Delta}tig. (B) Resistance to heat shock at 50°C: survival of L. monocytogenes EGD-e and the {Delta}tig mutant after incubation at 50°C. Bacteria were exposed to heat shock at 50°C for 15, 30, 45, or 60 min and then immediately plated on BHI medium plates. The percentage of surviving bacteria corresponds to the ratio of the number of CFU after incubation at 50°C to the initial number of CFU. (C) Ethanol stress: growth curves of EGD-e and EGD-{Delta}tig in BHI broth containing 3% ethanol. The values are means and standard deviations of three experiments. (D) tig transcription level. Transcription was quantified by real-time quantitative PCR with mRNA extracted from bacteria in the exponential growth phase (OD600, 0.4) in BHI broth at different temperatures (4°C to 42°C). For heat shock bacteria were grown until the OD600 was 0.4 at 37°C and then incubated for 20 min at 50°C before RNA extraction. For shock with 3% ethanol bacteria were grown until the OD600 was 0.4 in BHI broth supplemented with ethanol (final concentration, 3%). Data were analyzed by analysis of variance, followed by a multiple-comparison test using Tukey's method. The asterisk indicates that there is a significant difference between two conditions (P < 0.05).

We first tested the susceptibility of EGD-{Delta}tig to temperature stress (cold or heat stress). As shown in Fig. 2B, EGD-{Delta}tig appeared to be more resistant to a shock at 50°C than EGD-e was; for EGD-e 58% survival was recorded after 30 min and 25% survival was recorded after 60 min, compared to 89% and 73%, respectively, for the {Delta}tig mutant. Thus, as previously observed with E. coli, the absence of TF leads to longer survival of L. monocytogenes at a high temperature (31, 32). In contrast, the {Delta}tig deletion did not modify the growth of L. monocytogenes at 4°C or the ability of L. monocytogenes to survive in a cold shock assay (data not shown; see Materials and Methods for the cold shock procedure).

We quantitatively monitored tig transcription by real-time RT-PCR, using the SYBR green method. The results were normalized using the gyrA gene (encoding the L. monocytogenes gyrase), whose expression has previously been shown to be constant under many growth conditions (3). As shown in Fig. 2D, the transcription level of tig remained constant at the different growth temperatures tested (4°C to 42°C). However, after a 20-min heat shock at 50°C, the transcription of tig decreased considerably (it was 15-fold lower than the transcription recorded at 37°C), indicating that tig expression is strongly downregulated under these conditions (see Materials and Methods for details).

The kinetics of bacterial growth were then monitored in the presence of various concentrations of either ethanol (final concentrations, 3% to 5%) or NaCl (final concentrations, 340 mM to 1.7 M). For mutant strain EGD-{Delta}tig there was a significant reduction in the growth rate in BHI medium containing 3% ethanol (Fig. 2C) (P = 0.01, as determined by Student's t test). However, under these conditions the level of tig transcription was not significantly modified (Fig. 2D). No defect was observed under the NaCl stress conditions tested (not shown).

Role of TF in protein secretion.
We compared the extracellular proteomes of EGD-e and EGD-{Delta}tig by SDS-polyacrylamide gel electrophoresis, using either culture supernatants or cell envelope fractions from exponentially grown bacteria (see Materials and Methods). All the assays performed with these two fractions (Fig. 3A and B; results of two-dimensional gel analyses not shown) failed to reveal any reproducible difference between EGD-{Delta}tig and EGD-e. Secretion of the major virulence factors listeriolysin O and phosphatidylcholine-hydrolyzing phospholipase C was also monitored by Western blotting (not shown), but this did not reveal any significant secretion defect of the EGD-{Delta}tig mutant.


Figure 3
View larger version (87K):
[in this window]
[in a new window]
  		FIG. 3. SDS-PAGE analysis of the extracellular proteome. (A) Secreted proteins (silver-stained 11% SDS-polyacrylamide gel). (B) Cell envelope fraction (Coomassie blue-stained 11% SDS-polyacrylamide gel). Fifteen micrograms of protein extract was loaded in each well.

Role of TF in intracellular survival.
The impact of the {Delta}tig deletion on L. monocytogenes pathogenesis was first evaluated in vitro. Intracellular survival and multiplication of EGD-e and EGD-{Delta}tig were monitored (i) in BMM (Fig. 4A) and macrophage-like cell line J774 (Fig. 4B) and (ii) in two different types of nonphagocytic mammalian cell lines, HepG-2 hepatocytes and Caco-2 enterocytes (Fig. 4C and D). In BMM, J774 macrophages, and Caco-2 enterocytes, the intracellular multiplication of the mutant was identical to that of EGD-e (Fig. 4A, B, and D). In HepG-2 cells, intracellular multiplication of the mutant strain was slightly reduced (ca. fivefold at each of the three times tested) (Fig. 4C). The P values determined by Student's t test were 0.02, 0.07, and 0.003 for 2, 4, and 6 h in the kinetic analysis, respectively; these results were reproducible. The P values of 0.02 and 0.003 are clearly significant based on the accepted standard cutoff value of 0.05, so the results indicate that the tig mutant has a modest but significant growth defect in these cells. Altogether, these results suggest that TF does not play an important role in intracellular survival and multiplication of L. monocytogenes.


Figure 4
View larger version (16K):
[in this window]
[in a new window]
  		FIG. 4. Kinetics of intracellular multiplication. The invasiveness of EGD-e ({blacklozenge}) and EGD-{Delta}tig ({circ}) was evaluated with bone marrow-derived macrophages (A), J774 macrophages (B), HepG-2 cells (C), and Caco-2 cells (D). The symbols and error bars indicate the means and standard deviations for the number (log10) of bacteria per well (three wells per assay; two different assays).

Role of TF in virulence.
The in vivo properties of the {Delta}tig mutant were evaluated in the mouse model of infection. We first determined the LD50 of EGD-{Delta}tig after intravenous inoculation of Swiss mice. The LD50 of the mutant was of 104.9 bacteria per mouse (compared to 104.5 bacteria for EGD-e), reflecting the very modest impact of the deletion on bacterial virulence in this model.

The kinetics of bacterial multiplication in the target organs of infected mice were then monitored over a 7-day period after i.v. infection with a sublethal dose (104 bacteria per mouse). As shown in Fig. 5, a significant reduction in bacterial survival and multiplication was observed with EGD-{Delta}tig in both the spleen and the liver, compared to EGD-e. The kinetics of survival in the spleen showed similar increases in bacterial counts up to day 2, and a plateau was reached at day 3 with both strains. Then EGD-{Delta}tig was eliminated significantly more rapidly than EGD-e, and EGD-{Delta}tig was almost completely eliminated from the spleen at day 7 (P < 0.001). Comparable behavior was observed in the liver, where elimination of EGD-{Delta}tig occurred earlier than elimination of EGD-e. Notably, while EGD-e continued to multiply in infected livers until day 6, multiplication of EGD-{Delta}tig had already reached a plateau at day 3, and at day 7 the mutant strain was almost completely eliminated.


Figure 5
View larger version (17K):
[in this window]
[in a new window]
  		FIG. 5. In vivo survival of the {Delta}tig mutant. The kinetics of bacterial growth were monitored in mice infected with either EGD-e ({blacklozenge}) or EGD-{Delta}tig ({circ}). Mice were inoculated intravenously with 104 bacteria. Bacterial survival in the spleen (A) and liver (B) was monitored over a 7-day period. The symbols and error bars indicate the means and standard deviations for the number (log10) of bacteria per organ (five mice on days 1, 2, and 3 and eight mice on days 6 and 7). One asterisk indicates that the P value is <0.05, and two asterisks indicate that the P value is <0.001, as determined by Student's t test.


arrow
DISCUSSION
 
We identified a unique gene encoding a trigger factor homologue in the genome of L. monocytogenes and constructed a chromosomal deletion mutant. The deletion did not impair bacterial growth in broth and did not have a significant impact on protein secretion. However, it appeared to alter the stress response of L. monocytogenes. Furthermore, the {Delta}tig deletion reduced the capacity of L. monocytogenes to persist in infected cells in the spleen and liver, suggesting that TF is involved in bacterial virulence.

TF participates in stress response but is dispensable for bacterial growth.
Early work of Guthrie and Wickner (27) showed that in E. coli, a lack or overproduction of TF resulted in a septation defect. Moreover, while a {Delta}tig mutation increased susceptibility to a cold shock, it increased resistance to a heat shock. We found that EGD-{Delta}tig was more resistant to a shock at 50°C than EGD-e was, indicating that TF is involved in the tolerance of L. monocytogenes to a heat shock. Binding of TF to nascent chains has been shown to slow protein folding and to retard protein export (34). It is thus conceivable that under heat shock conditions, an accelerated TF-independent protein export process is more favorable for L. monocytogenes survival. This hypothesis is reinforced by the fact that under heat shock conditions, transcription of tig is downregulated compared to transcription at 37°C.

However, the {Delta}tig deletion did not modify bacterial growth and survival at 4°C (Fig. 2), which suggests that in contrast to E. coli TF (31), TF of L. monocytogenes is not involved in tolerance to cold temperatures. Notably, L. monocytogenes is one of the rare bacteria that are able to survive and multiply at low temperatures (0 to 4°C). It is thus reasonable to assume that it possesses other cold resistance mechanisms that compensate for the lack of TF.

Besides heat shock, other stimuli have been shown to induce the heat shock genes in B. subtilis (41). In particular, ethanol treatment seems to induce cell damage similar to that caused by heat shock (57). We monitored the kinetics of bacterial growth in the presence of various concentrations of ethanol or NaCl. Ethanol stress was the only condition in which the EGD-{Delta}tig mutant showed a significant reduction in the growth rate compared to wild-type strain EGD-e.

RT-PCR analyses revealed that tig was cotranscribed with lmo1266 (and clpX downstream). Since a sigma B-dependent promoter is predicted to be upstream of lmo1266, this locus might belong to the sigma B regulon of L. monocytogenes (33). Sigma B has been recognized as a general stress-responsive alternative sigma factor in several low-G+C-content gram-positive bacteria, including L. monocytogenes. It contributes to the ability of these organisms to survive under a variety environmental and energy stress conditions (see reference 54 for a recent review). However, in B. subtilis, clpX is transcribed as a monocistronic unit and is under the control of a sigma B-independent promoter (24). Thus, in L. monocytogenes, the three genes might also be under the control of sigma B-independent regulators.

TF deficiency does not impair protein secretion.
In E. coli, a lack of TF accelerates protein export, whereas TF overproduction impairs protein export (34), which prompted us to compare the extracellular proteomes of EGD-{Delta}tig and EGD-e. SDS-PAGE analyses of culture supernatants or cell envelope fractions from exponentially grown bacteria did not reveal detectable difference between the two strains (Fig. 4). We also performed repeated two-dimensional gel analyses of culture supernatants or cell envelope fractions from bacteria grown at 42°C (not shown). In all these assays, we did not detect any reproducible difference in the protein contents of the two strains. It is thus likely that TF of L. monocytogenes does not play a significant role in protein secretion. However, the low sensitivity (µg to ng range) of SDS-PAGE, as well as low levels of specific protein expression, might also account for the absence of observable differences in the protein patterns.

SRP pathway of L. monocytogenes.
Gram-negative bacteria possess two independent secretion pathways, both converging on the Sec translocon: the SecA/SecB pathway and the SRP pathway. In E. coli, discrimination between the two pathways involves the proteins TF and Ffh (6). In contrast, in gram-positive bacteria, there is no SecB homologue (for reviews, see references 50 and 55), and the SRP pathway is thus likely to be the only complex targeting exported proteins to the Sec translocon.

We identified the genes determining Ffh, scRNA, and FtsY in the genome of EGD-e. Ffh, encoded by the lmo1801 gene, exhibits 81% amino acid identity with its B. subtilis orthologue. The scRNA of L. monocytogenes was identified previously (5) but was not precisely localized on the chromosome; it corresponds to the intergenic region between lmo2710 and lmo2711. The membrane docking protein of SRP, FtsY, is encoded by lmo1803 (which exhibits 70% amino acid identity with B. subtilis FtsY). Our attempts to create a chromosomal {Delta}ffh mutant (either in a wild-type background or in a {Delta}tig genetic background) were unsuccessful, suggesting that ffh is an essential gene in L. monocytogenes, as it is in B. subtilis and E. coli (see Materials and Methods for details). Of interest, it was shown recently that inactivation of the ffh gene was not lethal in S. mutans but did render S. mutans sensitive to an acidic pH and high salt concentration (29). Strikingly, this organism appeared to tolerate complete disruption of the SRP pathway (double-deletion ffh-scRNA and ffh-fstY mutants were viable), thus suggesting that there are additional compensatory pathways in this bacterium.

TF is involved in the persistence of L. monocytogenes in vivo.
Intracellular survival assays indicated that TF plays only a minor role in the in vitro life cycle of L. monocytogenes. However, TF appeared to participate in bacterial survival and multiplication in vivo. In spite of a modest impact on the LD50 of the strain, the {Delta}tig deletion led to a significant reduction in bacterial counts in the spleens and livers of mice infected with a sublethal dose of bacteria (up to a 1,000-fold reduction after 7 days of infection). To our knowledge, this is the first report of an in vivo role of trigger factor in bacterial pathogenesis.

The fact that the tig deletion had no detectable impact on protein expression in broth does not rule out the possibility that TF influences the production of poorly expressed proteins and/or of virulence factors preferentially expressed in vivo. At this stage, we should bear in mind that TF, which associates with the 50S ribosomal subunit and binds to nascent polypeptide chains, functions in cooperation with other cytosolic chaperones, such as DnaK and GroEL (9, 16, 34, 47). It is reasonable to assume that the molecular mechanisms implicating TF in pathogenesis are complex, and the role of each of the other chaperones in bacterial pathogenesis remains to be elucidated. However, general protein chaperones participate in essential mechanisms employed for bacterial survival. Therefore, their specific contributions to bacterial virulence might be difficult to assess.


arrow
ACKNOWLEDGMENTS
 
This work was supported by CNRS, INSERM, and University of Paris V.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Faculté de Médecine Necker, 156, rue de Vaugirard, 75730 Paris Cedex 15, France. Phone: 33 1-40 61 53 76. Fax: 33 1-40 61 55 92. E-mail: charbit{at}necker.fr. Back

{dagger} A.B. and E.B. contributed equally to this work. Back


arrow
REFERENCES
 
    1
  1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Seidman, and K. Struhl. 1990. Current protocols in molecular biology. Wiley Interscience, New York, N.Y.
    2. 2
  2. Autret, N., I. Dubail, P. Trieu-Cuot, P. Berche, and A. Charbit. 2001. Identification of new genes involved in the virulence of Listeria monocytogenes by signature-tagged transposon mutagenesis. Infect. Immun. 69:2054-2065.[Abstract/Free Full Text]
    3. 3
  3. Autret, N., C. Raynaud, I. Dubail, P. Berche, and A. Charbit. 2003. Identification of the agr locus of Listeria monocytogenes: role in bacterial virulence. Infect. Immun. 71:4463-4471.[Abstract/Free Full Text]
    4. 4
  4. Bang, H., A. Pecht, G. Raddatz, T. Scior, W. Solbach, K. Brune, and A. Pahl. 2000. Prolyl isomerases in a minimal cell. Catalysis of protein folding by trigger factor from Mycoplasma genitalium. Eur. J. Biochem. 267:3270-3280.[Medline]
    5. 5
  5. Barry, T., M. Kelly, B. Glynn, and J. Peden. 1999. Molecular cloning and phylogenetic analysis of the small cytoplasmic RNA from Listeria monocytogenes. FEMS Microbiol. Lett. 173:47-53.[CrossRef][Medline]
    6. 6
  6. Beck, K., L. F. Wu, J. Brunner, and M. Muller. 2000. Discrimination between SRP- and SecA/SecB-dependent substrates involves selective recognition of nascent chains by SRP and trigger factor. EMBO J. 19:134-143.[CrossRef][Medline]
    7. 7
  7. Bierne, H., C. Garandeau, M. G. Pucciarelli, C. Sabet, S. Newton, F. Garcia-del Portillo, P. Cossart, and A. Charbit. 2004. Sortase B, a new class of sortase in Listeria monocytogenes. J. Bacteriol. 186:1972-1982.[Abstract/Free Full Text]
    8. 8
  8. Bierne, H., S. K. Mazmanian, M. Trost, M. G. Pucciarelli, G. Liu, P. Dehoux, L. Jansch, F. G. Portillo, O. Schneewind, and P. Cossart. 2002. Inactivation of the srtA gene in Listeria monocytogenes inhibits anchoring of surface proteins and affects virulence. Mol. Microbiol. 43:869-881.[CrossRef][Medline]
    9. 9
  9. Blaha, G., D. N. Wilson, G. Stoller, G. Fischer, R. Willumeit, and K. H. Nierhaus. 2003. Localization of the trigger factor binding site on the ribosomal 50S subunit. J. Mol. Biol. 326:887-897.[CrossRef][Medline]
    10. 10
  10. Bonnemain, C., C. Raynaud, H. Reglier-Poupet, I. Dubail, C. Frehel, M. A. Lety, P. Berche, and A. Charbit. 2004. Differential roles of multiple signal peptidases in the virulence of Listeria monocytogenes. Mol. Microbiol. 51:1251-1266.[CrossRef][Medline]
    11. 11
  11. Bowers, C. W., F. Lau, and T. J. Silhavy. 2003. Secretion of LamB-LacZ by the signal recognition particle pathway of Escherichia coli. J. Bacteriol. 185:5697-5705.[Abstract/Free Full Text]
    12. 12
  12. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline]
    13. 13
  13. Caldwell, R. B., and C. T. Lattemann. 2004. Simple and reliable method to precipitate proteins from bacterial culture supernatant. Appl. Environ. Microbiol. 70:610-612.[Abstract/Free Full Text]
    14. 14
  14. Cossart, P. 2004. Bacterial invasion: a new strategy to dominate cytoskeleton plasticity. Dev. Cell 6:314-315.[CrossRef][Medline]
    15. 15
  15. de Chastellier, C., and P. Berche. 1994. Fate of Listeria monocytogenes in murine macrophages: evidence for simultaneous killing and survival of intracellular bacteria. Infect. Immun. 62:543-553.[Abstract/Free Full Text]
    16. 16
  16. Deuerling, E., H. Patzelt, S. Vorderwulbecke, T. Rauch, G. Kramer, E. Schaffitzel, A. Mogk, A. Schulze-Specking, H. Langen, and B. Bukau. 2003. Trigger factor and DnaK possess overlapping substrate pools and binding specificities. Mol. Microbiol. 47:1317-1328.[CrossRef][Medline]
    17. 17
  17. Dramsi, S., I. Biswas, E. Maguin, L. Braun, P. Mastroeni, and P. Cossart. 1995. Entry of Listeria monocytogenes into hepatocytes requires expression of inIB, a surface protein of the internalin multigene family. Mol. Microbiol. 16:251-261.[Medline]
    18. 18
  18. Dussurget, O., J. Pizarro-Cerda, and P. Cossart. 2004. Molecular determinants of Listeria monocytogenes virulence. Annu. Rev. Microbiol. 58:587-610.[CrossRef][Medline]
    19. 19
  19. Fanghanel, J., and G. Fischer. 2004. Insights into the catalytic mechanism of peptidyl prolyl cis/trans isomerases. Front. Biosci. 9:3453-3478.[Medline]
    20. 20
  20. Farber, J. M., and P. I. Peterkin. 1991. Listeria monocytogenes, a food-borne pathogen. Microbiol. Rev. 55:476-511.[Abstract/Free Full Text]
    21. 21
  21. Frees, D., S. N. Qazi, P. J. Hill, and H. Ingmer. 2003. Alternative roles of ClpX and ClpP in Staphylococcus aureus stress tolerance and virulence. Mol. Microbiol. 48:1565-1578.[CrossRef][Medline]
    22. 22
  22. Frees, D., K. Sorensen, and H. Ingmer. 2005. Global virulence regulation in Staphylococcus aureus: pinpointing the roles of ClpP and ClpX in the sar/agr regulatory network. Infect. Immun. 73:8100-8108.[Abstract/Free Full Text]
    23. 23
  23. Garandeau, C., H. Reglier-Poupet, I. Dubail, J. L. Beretti, P. Berche, and A. Charbit. 2002. The sortase SrtA of Listeria monocytogenes is involved in processing of internalin and in virulence. Infect. Immun. 70:1382-1390.[Abstract/Free Full Text]
    24. 24
  24. Gerth, U., A. Wipat, C. R. Harwood, N. Carter, P. T. Emmerson, and M. Hecker. 1996. Sequence and transcriptional analysis of clpX, a class-III heat-shock gene of Bacillus subtilis. Gene 181:77-83.[CrossRef][Medline]
    25. 25
  25. Glaser, P., L. Frangeul, C. Buchrieser, A. Amend, F. Baquero, P. Berche, H. Bloecker, P. Brandt, T. Chakraborty, A. Charbit, F. Chetouani, E. Couvé, A. de Daruvar, P. Dehoux, E. Domann, G. Domínguez-Bernal, E. Duchaud, L. Durand, O. Dussurget, K. D. Entian, H. Fsihi, F. Garcia-Del Portillo, P. Garrido, L. Gautier, W. Goebel, N. Gómez-López, T. Hain, J. Hauf, D. Jackson, L. M. Jones, U. Kaerst, J. Kreft, M. Kuhn, F. Kunst, G. Kurapkat, E. Madueño, A. Maitournam, J. Mata Vicente, E. Ng, G. Nordsiek, S. Novella, B. de Pablos, J. C. Pérez-Diaz, R. Purcell, B. Remmel, M. Rose, C. Rusniok, T. Schlueter, N. Simoes, A. Tierrez, J. A. Vázquez-Boland, H. Voss, J. Wehland, and P. Cossart. 2001. Comparative genomics of Listeria species. Science 294:849-852.[Abstract/Free Full Text]
    26. 26
  26. Gothel, S. F., C. Scholz, F. X. Schmid, and M. A. Marahiel. 1998. Cyclophilin and trigger factor from Bacillus subtilis catalyze in vitro protein folding and are necessary for viability under starvation conditions. Biochemistry 37:13392-13399.[CrossRef][Medline]
    27. 27
  27. Guthrie, B., and W. Wickner. 1990. Trigger factor depletion or overproduction causes defective cell division but does not block protein export. J. Bacteriol. 172:5555-5562.[Abstract/Free Full Text]
    28. 28
  28. Guzman, C. A., M. Rohde, T. Chakraborty, E. Domann, M. Hudel, J. Wehland, and K. N. Timmis. 1995. Interaction of Listeria monocytogenes with mouse dendritic cells. Infect. Immun. 63:3665-3673.[Abstract]
    29. 29
  29. Hasona, A., P. J. Crowley, C. M. Levesque, R. W. Mair, D. G. Cvitkovitch, A. S. Bleiweis, and L. J. Brady. 2005. Streptococcal viability and diminished stress tolerance in mutants lacking the signal recognition particle pathway or YidC2. Proc. Natl. Acad. Sci. USA 102:17466-17471.[Abstract/Free Full Text]
    30. 30
  30. Ito, K. 2005. Ribosome-based protein folding systems are structurally divergent but functionally universal across biological kingdoms. Mol. Microbiol. 57:313-317.[CrossRef][Medline]
    31. 31
  31. Kandror, O., and A. L. Goldberg. 1997. Trigger factor is induced upon cold shock and enhances viability of Escherichia coli at low temperatures. Proc. Natl. Acad. Sci. USA 94:4978-4981.[Abstract/Free Full Text]
    32. 32
  32. Kandror, O., M. Sherman, R. Moerschell, and A. L. Goldberg. 1997. Trigger factor associates with GroEL in vivo and promotes its binding to certain polypeptides. J. Biol. Chem. 272:1730-1734.[Abstract/Free Full Text]
    33. 33
  33. Kazmierczak, M. J., S. C. Mithoe, K. J. Boor, and M. Wiedmann. 2003. Listeria monocytogenes {sigma}B regulates stress response and virulence functions. J. Bacteriol. 185:5722-5734.[Abstract/Free Full Text]
    34. 34
  34. Lee, H. C., and H. D. Bernstein. 2002. Trigger factor retards protein export in Escherichia coli. J. Biol. Chem. 277:43527-43535.[Abstract/Free Full Text]
    35. 35
  35. Lenz, L. L., S. Mohammadi, A. Geissler, and D. A. Portnoy. 2003. SecA2-dependent secretion of autolytic enzymes promotes Listeria monocytogenes pathogenesis. Proc. Natl. Acad. Sci. USA 100:12432-12437.[Abstract/Free Full Text]
    36. 36
  36. Lingnau, A., E. Domann, M. Hudel, M. Bock, T. Nichterlein, J. Wehland, and T. Chakraborty. 1995. Expression of the Listeria monocytogenes EGD inlA and inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by PrfA-dependent and -independent mechanisms. Infect. Immun. 63:3896-3903.[Abstract]
    37. 37
  37. Ludlam, A. V., B. A. Moore, and Z. Xu. 2004. The crystal structure of ribosomal chaperone trigger factor from Vibrio cholerae. Proc. Natl. Acad. Sci. USA 101:13436-13441.[Abstract/Free Full Text]
    38. 38
  38. Lyon, W. R., and M. G. Caparon. 2003. Trigger factor-mediated prolyl isomerization influences maturation of the Streptococcus pyogenes cysteine protease. J. Bacteriol. 185:3661-3667.[Abstract/Free Full Text]
    39. 39
  39. Lyon, W. R., C. M. Gibson, and M. G. Caparon. 1998. A role for trigger factor and an rgg-like regulator in the transcription, secretion and processing of the cysteine proteinase of Streptococcus pyogenes. EMBO J. 17:6263-6275.[CrossRef][Medline]
    40. 40
  40. Maier, T., L. Ferbitz, E. Deuerling, and N. Ban. 2005. A cradle for new proteins: trigger factor at the ribosome. Curr. Opin. Struct. Biol. 15:204-212.[CrossRef][Medline]
    41. 41
  41. Mogk, A., A. Volker, S. Engelmann, M. Hecker, W. Schumann, and U. Volker. 1998. Nonnative proteins induce expression of the Bacillus subtilis CIRCE regulon. J. Bacteriol. 180:2895-2900.[Abstract/Free Full Text]
    42. 42
  42. Nakamura, K., M. Nishiguchi, K. Honda, and K. Yamane. 1994. The Bacillus subtilis SRP54 homologue, Ffh, has an intrinsic GTPase activity and forms a ribonucleoprotein complex with small cytoplasmic RNA in vivo. Biochem. Biophys. Res. Commun. 199:1394-1399.[CrossRef][Medline]
    43. 43
  43. Neely, M. N., W. R. Lyon, D. L. Runft, and M. Caparon. 2003. Role of RopB in growth phase expression of the SpeB cysteine protease of Streptococcus pyogenes. J. Bacteriol. 185:5166-5174.[Abstract/Free Full Text]
    44. 44
  44. Nelson, K. E., D. E. Fouts, E. F. Mongodin, J. Ravel, R. T. DeBoy, J. F. Kolonay, D. A. Rasko, S. V. Angiuoli, S. R. Gill, I. T. Paulsen, J. Peterson, O. White, W. C. Nelson, W. Nierman, M. J. Beanan, L. M. Brinkac, S. C. Daugherty, R. J. Dodson, A. S. Durkin, R. Madupu, D. H. Haft, J. Selengut, S. Van Aken, H. Khouri, N. Fedorova, H. Forberger, B. Tran, S. Kathariou, L. D. Wonderling, G. A. Uhlich, D. O. Bayles, J. B. Luchansky, and C. M. Fraser. 2004. Whole genome comparisons of serotype 4b and 1/2a strains of the food-borne pathogen Listeria monocytogenes reveal new insights into the core genome components of this species. Nucleic Acids Res. 32:2386-2395.[Abstract/Free Full Text]
    45. 45
  45. Park, S. F., and G. S. Stewart. 1990. High efficiency transformation of Listeria monocytogenes by electroporation of penicillin-treated cells. Gene 94:129-132.[CrossRef][Medline]
    46. 46
  46. Reglier-Poupet, H., C. Frehel, I. Dubail, J. L. Beretti, P. Berche, A. Charbit, and C. Raynaud. 2003. Maturation of lipoproteins by type II signal peptidase is required for phagosomal escape of Listeria monocytogenes. J. Biol. Chem. 278:49469-49477.[Abstract/Free Full Text]
    47. 47
  47. Reyes, D. Y., and H. Yoshikawa. 2002. DnaK chaperone machine and trigger factor are only partially required for normal growth of Bacillus subtilis. Biosci. Biotechnol. Biochem. 66:1583-1586.[CrossRef][Medline]
    48. 48
  48. Roth, Z. 1961. A graphic probit method for the calculation of LD50 and relative toxicity. Cesk. Fysiol. 10:408-422.[Medline]
    49. 49
  49. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, vol. 3, p. 17.37-17.41. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
    50. 50
  50. Tjalsma, H., H. Antelmann, J. D. Jongbloed, P. G. Braun, E. Darmon, R. Dorenbos, J. Y. Dubois, H. Westers, G. Zanen, W. J. Quax, O. P. Kuipers, S. Bron, M. Hecker, and J. M. van Dijl. 2004. Proteomics of protein secretion by Bacillus subtilis: separating the "secrets" of the secretome. Microbiol. Mol. Biol. Rev. 68:207-233.[Abstract/Free Full Text]
    51. 51
  51. Ullers, R. S., E. N. Houben, A. Raine, C. M. ten Hagen-Jongman, M. Ehrenberg, J. Brunner, B. Oudega, N. Harms, and J. Luirink. 2003. Interplay of signal recognition particle and trigger factor at L23 near the nascent chain exit site on the Escherichia coli ribosome. J. Cell Biol. 161:679-684.[Abstract/Free Full Text]
    52. 52
  52. Valent, Q. A., D. A. Kendall, S. High, R. Kusters, B. Oudega, and J. Luirink. 1995. Early events in preprotein recognition in E. coli: interaction of SRP and trigger factor with nascent polypeptides. EMBO J. 14:5494-5505.[Medline]
    53. 53
  53. Valent, Q. A., P. A. Scotti, S. High, J. W. de Gier, G. von Heijne, G. Lentzen, W. Wintermeyer, B. Oudega, and J. Luirink. 1998. The Escherichia coli SRP and SecB targeting pathways converge at the translocon. EMBO J. 17:2504-2512.[CrossRef][Medline]
    54. 54
  54. van Schaik, W., and T. Abee. 2005. The role of sigmaB in the stress response of Gram-positive bacteria: targets for food preservation and safety. Curr. Opin. Biotechnol. 16:218-224.[CrossRef][Medline]
    55. 55
  55. van Wely, K. H., J. Swaving, R. Freudl, and A. J. Driessen. 2001. Translocation of proteins across the cell envelope of Gram-positive bacteria. FEMS Microbiol. Rev. 25:437-454.[Medline]
    56. 56
  56. Vazquez-Boland, J. A., M. Kuhn, P. Berche, T. Chakraborty, G. Dominguez-Bernal, W. Goebel, and B. Gonzalez-Zorn. 2001. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 14:584-640.[Abstract/Free Full Text]
    57. 57
  57. Volker, U., B. Maul, and M. Hecker. 1999. Expression of the {sigma}B-dependent general stress regulon confers multiple stress resistance in Bacillus subtilis. J. Bacteriol. 181:3942-3948.[Abstract/Free Full Text]
    58. 58
  58. Wen, Z. T., P. Suntharaligham, D. G. Cvitkovitch, and R. A. Burne. 2005. Trigger factor in Streptococcus mutans is involved in stress tolerance, competence development, and biofilm formation. Infect. Immun. 73:219-225.[Abstract/Free Full Text]
    59. 59
  59. Wild, K., K. R. Rosendal, and I. Sinning. 2004. A structural step into the SRP cycle. Mol. Microbiol. 53:357-363.[CrossRef][Medline]
    60. 60
  60. Yamamoto, T., H. Sashinami, A. Takaya, T. Tomoyasu, H. Matsui, Y. Kikuchi, T. Hanawa, S. Kamiya, and A. Nakane. 2001. Disruption of the genes for ClpXP protease in Salmonella enterica serovar Typhimurium results in persistent infection in mice, and development of persistence requires endogenous gamma interferon and tumor necrosis factor alpha. Infect. Immun. 69:3164-3174.[Abstract/Free Full Text]
    61. 61
  61. Zanen, G., E. N. Houben, R. Meima, H. Tjalsma, J. D. Jongbloed, H. Westers, B. Oudega, J. Luirink, J. M. van Dijl, and W. J. Quax. 2005. Signal peptide hydrophobicity is critical for early stages in protein export by Bacillus subtilis. FEBS J. 272:4617-4630.[CrossRef][Medline]

Applied and Environmental Microbiology, October 2006, p. 6623-6631, Vol. 72, No. 10
0099-2240/06/$08.00+0     doi:10.1128/AEM.00624-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Bigot, A., Raynaud, C., Dubail, I., Dupuis, M., Hossain, H., Hain, T., Chakraborty, T., Charbit, A. (2009). lmo1273, a novel gene involved in Listeria monocytogenes virulence. Microbiology 155: 891-902 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bigot, A.
Right arrow Articles by Charbit, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bigot, A.
Right arrow Articles by Charbit, A.
Agricola
Right arrow Articles by Bigot, A.
Right arrow Articles by Charbit, A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»