Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Pecson, B. M. Articles by Nelson, K. L. Search for Related Content PubMed PubMed Citation Articles by Pecson, B. M. Articles by Nelson, K. L. Agricola Articles by Pecson, B. M. Articles by Nelson, K. L.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, December 2006, p. 7864-7872, Vol. 72, No. 12
0099-2240/06/$08.00+0     doi:10.1128/AEM.01983-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

A Real-Time PCR Method for Quantifying Viable Ascaris Eggs Using the First Internally Transcribed Spacer Region of Ribosomal DNA

Brian M. Pecson,¹ José Antonio Barrios,² David R. Johnson,¹ and Kara L. Nelson^1*

Department of Civil and Environmental Engineering, MS 1710, University of California, Berkeley, California 94720-1710,¹ Instituto de Ingeniería UNAM, Apartado Postal 70-402, Ciudad Universitaria, 04510 Coyoacan, Mexico²

Received 21 August 2006/ Accepted 11 October 2006

Top Abstract Introduction Materials and Methods Results Discussion References

 
Worldwide, 1.4 billion people are infected with the intestinal worm Ascaris lumbricoides. As a result, Ascaris eggs are commonly found in wastewater and sludges. The current microscopy method for detecting viable Ascaris eggs is time- and labor-intensive. The goal of this study was to develop a real-time quantitative PCR (qPCR) method to determine the levels of total and viable Ascaris eggs in laboratory solutions using the first internally transcribed spacer (ITS-1) region of ribosomal DNA (rDNA) and rRNA. ITS-1 rDNA levels were proportional to Ascaris egg cell numbers, increasing as eggs developed from single cells to mature larvae and ultimately reaching a constant level per egg. Treatments causing >99% inactivation (high heat, moderate heat, ammonia, and UV) eliminated this increase in ITS-1 rDNA levels and caused decreases that were dependent on the treatment type. By taking advantage of this difference in ITS-1 rDNA level between viable, larvated eggs and inactivated, single-celled eggs, qPCR results were used to develop inactivation profiles for the different treatments. No statistical difference from the standard microscopy method was found in 75% of the samples (12 of 16). ITS-1 rRNA was detected only in samples containing viable eggs, but the levels were more variable than rDNA levels and ITS-1 rRNA could not be used for quantification. The detection limit of the rDNA-based method was approximately one larvated egg or 90 single-celled eggs; the detection limit for the rRNA-based method was several orders of magnitude higher. The rDNA qPCR method is promising for both research and regulatory applications.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The helminth Ascaris lumbricoides parasitizes the intestinal tracts of 1.4 billion people worldwide, roughly a quarter of the world's population (8). In many cases, Ascaris infection (ascariasis) causes malnutrition and a host of physical and mental disabilities (7, 8, 23). One female worm can shed up to 200,000 eggs per day in the feces of infected hosts. Without effective collection and treatment of this human waste, the eggs become dispersed in the environment and may initiate new infections (8).

The control of ascariasis is hindered by the strong resistance of Ascaris eggs to inactivation. Chemicals and treatments that inactivate most pathogens—strong acids and bases, disinfectants, and mesophilic aerobic and anaerobic digestion—have been proven ineffective against Ascaris (2, 19, 38). Because they are one of the most resistant pathogens, Ascaris eggs are often used to determine the efficacy of processes used to treat fecal and wastewater sludges in experimental studies and for regulatory purposes.

The single-celled Ascaris eggs that are shed in feces develop into eggs containing the infective third-stage larvae in moist, warm, aerobic environments (12). The current method for measuring Ascaris egg viability in wastewater and sludges mimics this natural process: eggs are incubated for 4 weeks to allow viable eggs to develop and then viewed microscopically for the presence of the larvae (35). Various improvements to the method have been proposed, e.g., shorter incubation times and improved counting accuracy, but all still require the laborious task of identifying viable eggs microscopically (4, 11, 18, 21, 25).

PCR has emerged as a method for the specific, sensitive, and rapid detection of pathogens in a variety of matrices, from wastewater to soil to food items (13, 15, 20, 29). The entire assay can be completed within a few hours, making PCR an extremely fast method of detecting pathogens of all types, including bacteria, viruses, protozoa, and helminths, including Ascaris larvae (9, 13, 15, 20). With quantitative PCR (qPCR), both the presence and the quantity of a given target sequence can be determined (20, 39). A variety of approaches to enable determination of viability have also been explored, although most of these methods are not quantitative (3, 10, 22, 26, 31, 40). Molecular methods for determining Ascaris egg quantities and their viability have not been reported.

One difficulty in using PCR to determine viability is the identification of a suitable nucleic acid target. The ideal target is specific to the pathogen, present in sufficient quantities to be detected, and proportional to the number of viable pathogens present. One benefit of mRNA is its short half-life, which makes it less likely to be detected in inactivated cells. However, mRNA is often inconstantly expressed, present in low numbers, and homologous to mRNAs of other species. DNA and rRNA often fail to meet the requirements because their persistence in inactivated organisms leads to false-positive results (10, 22, 40). In contrast to most waterborne pathogens, a unique characteristic of the eukaryotic Ascaris egg is that it develops from a single-celled embryo into an infective larva with roughly 600 cells (30). One of the objectives of our research was to determine whether this increase in cell number could be exploited to differentiate viable and inactivated eggs.

The target used in this study was the first internally transcribed spacer (ITS-1) region of ribosomal DNA (rDNA), one of two spacer regions transcribed with the three rDNA subunits (18S, 5.8S, and 28S). This target was chosen because of its potential to differentiate Ascaris from other helminths and also to distinguish human A. lumbricoides from pig Ascaris suum. The ITS regions are often used for distinguishing organisms within the same genus because they have higher sequence variability than the rDNA subunits. In addition, the transcription product of ITS-1 has two important characteristics for a marker of viability: its presence is necessary for basic cell functioning, yet it is short-lived within the cell. The removal of ITS-1 from the genome prevents the proper formation of ribosomes and thereby inhibits protein formation (14, 24, 36). Because ITS-1 rRNA is rapidly degraded by enzymes after transcription, it should not be detected in inactivated cells. Accordingly, ITS-1 may overcome the problems of DNA and rRNA persistence in inactivated cells. While the ITS region has been used previously to classify and detect organisms (6, 16, 28, 42), it has not been used to determine viability. The goal of this study was to develop a qPCR method to determine the levels of total and viable Ascaris eggs in laboratory solutions using ITS-1 rDNA and rRNA.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The experimental approach consisted of four phases. In the first phase, qPCR methods to measure and quantify Ascaris ITS-1 rDNA and rRNA were developed. In the second phase, the methods were utilized to create profiles of the ITS-1 rDNA and rRNA levels during the development of Ascaris eggs from single cells to third-stage larvae. In the third phase, changes to the DNA and RNA profiles were monitored after inactivating the eggs by using various forms of treatment. In the fourth phase, a qPCR method was applied to quantify viable eggs and generate inactivation profiles; this method was compared to the standard microscopy technique.

Ascaris suum eggs.
Ascaris suum eggs were purchased from Excelsior Sentinel (Ithaca, NY); the company collected the eggs from the intestinal contents of pigs, using sequential sieving to concentrate and clean the eggs. Eggs were shipped at a concentration of 10⁵/ml and stored at 4°C in 0.5% formalin. The eggs were not exposed to any other chemicals prior to the experiments. Three different batches of eggs were used for these experiments.

Isolation of nucleic acids.
Genomic DNA and RNA were isolated from suspensions of Ascaris eggs by using UltraClean microbial DNA and RNA kits (MoBio Laboratories, Carlsbad, CA) according to the manufacturer's instructions. The volume of egg suspension used for extractions (700 to 1,400 µl) corresponded to 2,000 to 3,000 eggs. DNase I treatment was used to eliminate contaminating DNA from RNA extracts (Turbo DNA-Free kit; Ambion, Austin, TX).

ITS-1 primer and probe design.
TaqMan primers and probe were purchased from Applied Biosystems, Foster City, CA. The ITS-1 sequences of both A. lumbricoides and A. suum used for primer and probe design were found in the NCBI GenBank database (www.ncbi.nlm.nih.gov) (accession numbers AJ000895 and AJ000896, respectively). The primer-probe set was designed to target both species (ITS-1 forward primer TGCACATAAGTACTATTTGCGCGTAT, ITS-1 reverse primer TGATGTAATAGCAGTCGGCGG, and ITS-1 probe 6-carboxyfluorescein-CGTGAGCCACATAGTAAATTGCACACAAATG-6-carboxytetramethylrhodamine) and optimized using Primer Express software (Applied Biosystems). The primers amplified an 82-bp segment beginning at bp 31 of AJ000895.

Development of ITS-1 rDNA standards.
DNA standards were created using a TOPO-TA cloning system (Invitrogen, Carlsbad, CA). A 201-bp ITS-1 region was cloned into the pCR 2.1-TOPO plasmid, and the recombinant plasmid DNA was purified from a 50-ml Escherichia coli culture by use of a QIAGEN miniprep kit (Valencia, CA) and linearized by digestion with HindIII restriction endonuclease (New England Biolabs, Beverly, MA). The DNA sequence was verified (UC Berkeley DNA Sequencing Facility), and the mass of the plasmid standard was determined using a PicoGreen DNA quantification system (Molecular Probes, Eugene, OR). The copy number of ITS-1 rDNA per volume was calculated assuming a recombinant plasmid size of 4.1 kb and an average molecular mass of 660 Da per nucleotide pair. The initial stock solution was serially diluted to give standard concentrations from 10¹ to 10⁷.

Development of ITS-1 rRNA standards.
The linearized pCR 2.1-TOPO plasmid containing the 201-bp ITS-1 insert was transcribed in vitro using T7 RNA polymerase (Roche Diagnostics, Indianapolis, IN). The DNA plasmid was removed using DNase I treatment (Turbo DNA-Free; Ambion). A 2100 bioanalyzer (Agilent, Palo Alto, CA) was used to confirm the efficiency of the plasmid digestion and to verify the length of the transcribed product. The mass of the RNA transcript was determined using a RIBO green RNA quantification system (Molecular Probes, Eugene, OR), and the copy number per volume was calculated assuming a transcript size of 350 bp and an average molecular mass of 330 Da per nucleotide.

Reverse transcription.
Experimental samples and RNA standards were reverse transcribed using a reverse transcription reagent kit (Applied Biosystems). Each 10-µl reaction contained 4 µl of experimental sample or 2 µl of standard and 0.5 µM of the reverse primer. The mixture was incubated for 30 min at 48°C, followed by 5 min at 95°C.

Real-time quantitative PCR.
The ITS-1 rDNA standards and experimental samples were amplified in parallel with an ABI Prism 7000 sequence detection system (Applied Biosystems). Each 25-µl PCR contained 5 µl of sample or ITS-1 rDNA standard, 12.5 µl of 2x TaqMan universal PCR master mix (Applied Biosystems), 0.7 µM of both forward and reverse primers, and 0.2 µM of probe. The following thermocycling conditions were used: 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. The same protocol was followed using 5 µl of the reverse-transcribed RNA samples and standards.

ITS-1 rDNA and rRNA developmental profile.
In the second phase of experiments, a stock of A. suum eggs (roughly 1,500 eggs/ml) was placed uncapped in an incubator under optimal aerobic growing conditions (28°C and 100% relative humidity [RH], model 3015 water-jacketed incubator; VWR Scientific Products). Four 1.2-ml replicates were removed for both DNA and RNA extractions every 2 days until day 30 and once at day 44. In addition, a stock of single-celled control eggs was kept at 4°C to prevent development. DNA was extracted from these nondeveloping control eggs to measure the day-to-day variability in extraction efficiency.

The concentration and developmental stage of the eggs were determined microscopically at every sampling period. Eggs containing 6 cells or larvae were easily distinguishable, but the number of cells in eggs between these two stages was difficult to enumerate. Accordingly, the developmental stage was broken down into five categories: one cell, two to three cells, four to six cells, seven or more cells, and fully larvated eggs. ITS-1 rDNA and rRNA quantities at each sampling period were measured by qPCR using the previously described primer-probe set.

Complete-inactivation experiments.
In the third phase of experiments, eggs were exposed to five different treatments: high heat, moderate heat at two different exposure times, ammonia, and low-pressure UV (Table 1). The five treatment conditions were chosen with the goal of achieving over 99.99% inactivation of the eggs, such that no viable eggs were remaining in the samples. All solutions were buffered with either HEPES or CHES (Fisher Scientific). All of the heated samples were incubated in 50-ml plastic centrifuge tubes in a water bath. The quasi-collimated beam used for the UV experiments has been described previously (5). In brief, the suspensions of eggs were placed in 50-mm glass petri dishes and gently stirred under a quasi-collimated UV beam. Control samples were concurrently stirred in the absence of UV to control for the effect of stirring alone.

View this table: [in this window] [in a new window]

TABLE 1. Treatment conditions for phase 3 complete-inactivation experiments

Following treatment, all samples were placed on ice. The experimental solutions were replaced with 0.1 N H₂SO₄, and all samples were incubated uncapped under optimum aerobic growth conditions. DNA extractions were performed after 0, 2, 4, 6, 8, 10, 12, 15, 18, and 30 days of incubation. RNA extractions were performed every 2 days from day 0 to day 12. ITS-1 rDNA and rRNA levels at each sampling period were quantified using qPCR and reverse transcriptase qPCR, respectively. The concentration and viability of the eggs in each sample were also measured by microscopic examination. Briefly, eggs were incubated for 30 days and viewed at x100 magnification using bright-field microscopy (Olympus BH-2 microscope). Eggs that had developed to the fully larvated stage were considered viable, while all others were deemed inactivated. The fraction of inactivated eggs was calculated as the number of inactivated eggs divided by the total eggs counted (typically 200 eggs).

Incomplete-inactivation experiments.
The fourth phase of experiments was conducted to determine if the levels of ITS-1 rDNA and rRNA could be used to measure the number of viable eggs in a partially inactivated sample. Eggs were exposed to four treatments predicted to cause up to 99% inactivation (Table 2). For each type of inactivation, samples were collected at four different times so that inactivation profiles could be generated. The same experimental protocol used in the complete-inactivation experiments was followed. Following the treatments, the eggs were incubated under optimum conditions to allow for the development of viable eggs. DNA and RNA extractions were taken on days 10 and 8, respectively, and the levels of ITS-1 DNA and RNA were quantified using qPCR and RT-qPCR. The concentration and viability of eggs in each sample were also determined microscopically after a 30-day incubation under optimum conditions.

View this table: [in this window] [in a new window]

TABLE 2. Treatment conditions for phase 4 incomplete-inactivation experiments

Statistical analysis.
Statistical analyses of data were performed with JMP statistical software (SAS Institute, Inc., Cary, NC).

Top Abstract Introduction Materials and Methods Results Discussion References

 
Developmental profiles.
The total number of eggs in each sample was 1,440 ± 30 (average ± 95% confidence interval [95% CI]), and this number remained constant throughout the course of the experiment (slope of eggs per sample versus time was not statistically significant within the 95% CI by use of linear regression; data not shown). During this time, the developmental stage of the eggs increased consistently, with the majority of the eggs (73%) going from single cells to the fully developed larvae within 12 days (Table 3). Because cell counts for eggs in between the 7- and 600-celled stages could not be determined accurately under the microscope, a hypothetical growth curve was made to estimate egg cell numbers during development. By use of the initial data of the microscopic cell counts, a doubling time of 1 day starting on day 2 was assumed, and this constant growth rate was assumed until the eggs reached their 600-celled larvated stage on day 12 (Table 3).

View this table: [in this window] [in a new window]

TABLE 3. Ascaris egg cell number during development

The hypothetical number of cells per egg is shown in Fig. 1, along with the levels of ITS-1 rDNA in incubated and control eggs. The single-celled control eggs contained 42.2 ± 5.8 ITS-1 rDNA copies per viable egg (geometric mean ± 95% CI). This value was calculated by dividing the geometric mean of the ITS-1 rDNA for the control eggs by the total number of control eggs (1.12 x 10⁵ targets/ml ÷ 2.7 x 10³ eggs/ml). If we assume that the ITS-1 rDNA copy number is the same in all cells and that larvated eggs have 600 cells, then the theoretical ITS-1 rDNA copy number in larvated eggs should be 2.5 x 10⁴ (42.2 copies/cell x 600 cells). In the developing eggs, ITS-1 rDNA levels increased from day 0 to day 8 before leveling off (slope not statistically significant within the 95% CI by use of linear regression). After day 8, the geometric mean was 8.8 x 10³ copies of ITS-1 rDNA per egg (Fig. 1). One reason that this value is below the theoretical number is the inclusion of some nonlarvated eggs in the population.

View larger version (15K): [in this window] [in a new window]

FIG. 1. Ascaris ITS-1 DNA copy number per egg and estimated cell number per egg during development. Symbols: •, ITS-1 copies in developing eggs; , ITS-1 copies in control eggs (not incubated); , hypothetical cell number per egg. Error bars represent 95% CI. d, days.

The minimum detection limit (MDL) was determined in accordance with U.S. EPA procedures (34). The MDL for the qPCR of ITS-1 rDNA was 160 copies, determined by multiplying the standard deviation of seven replicates of 200 ITS-1 rDNA copies by Student's t value for seven replicates with 6 degrees of freedom. The limit of quantitation (LOQ) for the qPCR was 510 ITS-1 rDNA copies, calculated as 10 times the standard deviation. To determine the MDL and LOQ for the whole method, these values were multiplied by a factor of 23.4 to account for the difference between the total DNA initially extracted and the quantity utilized for qPCR. The method MDL and LOQ were 3,750 and 12,000 ITS-1 rDNA copies, respectively. Assuming larvated eggs contain 2.5 x 10⁴ ITS-1 DNA copies per egg, then the method is capable of detecting and quantifying as little as a single larvated egg. The MDL and LOQ for single-celled eggs are 90 and 280 eggs, respectively, assuming 42.2 ITS-1 rDNA copies per single-celled egg.

The results of the ITS-1 rRNA reverse transcription-qPCR are presented in Fig. 2. The general trend in ITS-1 rRNA levels was similar to that for ITS-1 rDNA levels, but the variability was much higher. By use of the approach described above, the MDLs for the ITS-1 rRNA qPCR and the entire method were 179 and 2,300 ITS-1 rRNA copies, respectively, using a factor of 12.78 to account for the difference between the initial extraction and the qPCR. The presence or absence of targets during development followed a consistent pattern (Table 4). All of the replicates were below the detection limit on day 0, while both positive and negative results were obtained on days 2 and 4. Starting on day 6, the RNA levels in all of the replicates were positive until day 44, when both positive and negative replicates were recorded. The ITS-1 rRNA levels in the controls without reverse transcriptase and the nontemplate controls were not detectable, except in three separate replicates without reverse transcriptase (data not shown). In each of these replicates, the DNA contamination accounted for <7% of the signal of the sample run with reverse transcriptase.

View larger version (11K): [in this window] [in a new window]

FIG. 2. Ascaris ITS-1 RNA copy number per egg during development. Error bars represent 95% CI. d, days.

View this table: [in this window] [in a new window]

TABLE 4. Presence/absence of ITS-1 rRNA during development of Ascaris eggsa

Complete inactivation.
Despite undergoing completely inactivating treatments, the total number of eggs (viable plus inactivated) did not decrease significantly after treatment, except for the UV treatment (slope of total egg numbers versus time was not statistically significant within the 95% CI by use of linear regression [data not shown]). Although the eggs maintained their physical integrity, all of the experimental samples had >99% inactivation as determined by incubation/microscopy (data not shown).

The inactivation was also evident in the nucleic acid profiles of all of the experimental treatments (Fig. 3 and 4). Unlike the control samples, the ITS-1 rDNA levels in all of the heat-treated samples failed to increase after treatment (Fig. 3). However, only the 70°C treatment caused ITS-1 rDNA levels to drop below the detection limit. The remaining samples (52°C for 1 day and 7 days and the ammonia treatment) showed up to 1-log decreases in ITS-1 rDNA levels within the first few days. After this initial decrease, their ITS-1 rDNA levels generally leveled out through day 30. There was no significant difference between the 52°C/1-day and the 52°C/7-day samples at any time point (Student's t test, = 0.05).

View larger version (12K): [in this window] [in a new window]

FIG. 3. Total Ascaris ITS-1 DNA copy number versus incubation time after eggs were exposed to treatments causing >99% inactivation. Approximately 2,000 Ascaris eggs were used in each treatment. Symbols: +, 52°C, pH 7 for 1 day; , 52°C, pH 7 for 7 days; , 44°C, pH 9, 2,000 ppm NH3-N for 72 h; , 70°C, pH 7; •, control (untreated), pH 7. Error bars represent 95% CI. d, days.

View larger version (11K): [in this window] [in a new window]

FIG. 4. Total Ascaris ITS-1 DNA copy number versus incubation time after eggs were exposed to a UV treatment causing >99% inactivation. Approximately 2,000 Ascaris eggs were used in each treatment. Symbols: +, UV dose of 10,000 J/m2; •, control (no UV). Error bars represent 95% CI. d, days.

Similarly to the ITS-1 rDNA developmental profile (Fig. 1), the heat controls had greater than a 2-log increase in DNA from day 0 to day 10, after which point the profile leveled out (Fig. 3). Each egg had a geometric mean of 8.4 x 10³ copies of ITS-1 rDNA, consistent with the results from the developmental profile (Fig. 1). The ITS-1 levels of the controls were significantly higher than those of the treated samples starting on day 6 (analysis of variance with Tukey-Kramer HSD, = 0.05). The minimum difference between the controls and the heated samples was always >2.5 log units starting on day 10.

In the UV controls, the ITS-1 rDNA levels increased over 2 log units from day 2 to day 10 and then leveled off (Fig. 4). The levels in the UV-treated eggs decreased from day 0 to day 6 before leveling off. The UV controls had significantly higher ITS-1 rDNA levels than the treated samples starting on day 4 (Student's t test, = 0.05). The minimum difference between the UV samples and the controls was always >1.9 log units starting on day 10.

In all of the treated samples, the ITS-1 rRNA levels were below the detection limit at every sampling period (Table 5). The heat and UV controls had ITS-1 rRNA levels below the detection limit until days 6 and 8, respectively. After this point, the levels remained above the detection limit throughout the testing period, in agreement with the RNA data from the developmental experiments (Table 4).

View this table: [in this window] [in a new window]

TABLE 5. Presence/absence of ITS-1 rRNA after treatments causing >99% inactivation and controls

Incomplete inactivation.
To determine the number of viable eggs in the treated samples, we used the method outlined here. (i) Prepare the control eggs. Incubate at 28°C, 100% RH. After day 30, determine the number of larvated eggs microscopically. Extract DNA from the control eggs on the same day as the treated sample. (ii) Prepare the treated sample. Incubate at 28°C, 100% RH. On day 10, extract DNA. (iii) Measure ITS-1 copy numbers in the control and treated samples. (iv) Determine ITS-1 copy number/larvated egg in the control samples by use of the following equation: (ITS-1/larvated egg)_control = measured ITS-1 in control/measured number of larvated eggs in control. (v) Determine number of viable eggs in the treated sample by use of the following equation: estimated viable eggs in sample = measured ITS-1 in sample/(ITS-1/larvated egg)_control. A 10-day incubation was chosen to precede ITS-1 measurement based on the data from the developmental experiments, in which 8 days was sufficient to reach the maximum levels of ITS-1 rDNA. The heat control and UV control had geometric means of 4.6 x 10⁴ and 5.3 x 10⁴ copies per viable egg, respectively. The total ITS-1 rDNA levels in the experimental samples were divided by these values to determine the number of viable eggs in each of the experimental samples.

The viability levels determined by qPCR and the standard incubation/microscopy method are compared in Fig. 5. In 12 of the 16 treatments tested, there was no statistical difference between the two methods, and in only one sample did the two methods differ by more than 1 order of magnitude (Table 6).

View larger version (10K): [in this window] [in a new window]

FIG. 5. Comparison of inactivation profiles of Ascaris eggs for various treatments as determined by qPCR and microscopy. Graphs report numbers of viable eggs as a function of either treatment time or UV dose. (a) 70°C; (b) 48°C; (c) 42°C, pH 9, and 2,000 ppm NH3-N; (d) UV. Symbols: +, real-time PCR method; •, microscopy method; , microscopy detection limit. Error bars represent 95% CI.

View this table: [in this window] [in a new window]

TABLE 6. Comparison of Ascaris egg viability measurements between microscopy and qPCR methods after inactivating treatments

The presence or absence of ITS-1 rRNA after each of the treatments is also presented in Table 6. The least intense treatments resulted in the highest number of viable eggs and often resulted in the detection of ITS-1 rRNA. The more intense treatments caused either positive and negative results or simply negative results.

Top Abstract Introduction Materials and Methods Results Discussion References

 
ITS-1 rDNA as a molecular target.
ITS-1 had a number of characteristics that made it a good candidate for a molecular marker of viability. First, ITS-1 rDNA levels were proportional to Ascaris cell numbers. Just prior to the eggs reaching their maximum cell number (days 10 to 12), the ITS-1 rDNA quantities leveled off (day 8). It is reasonable that the ITS-1 rDNA numbers could level off shortly before morphological evidence of larval formation because DNA is replicated before cell division. Although the ITS-1 rDNA copy number per genome has not been reported previously for Ascaris, the experimentally determined number, 42.2 ± 5.8, was similar to the value of 55 reported for the nematode Caenorhabditis elegans (33).

Interestingly, while the ITS-1 rDNA levels in inactivated eggs did decrease (Fig. 3), only the 70°C sample decreased the levels below the detection limit. The remaining treatments caused only partial deterioration of the DNA. One factor that may explain why DNA was detected in inactivated eggs was that the eggs remained structurally intact during and after the treatment, as observed by microscopy and as reflected in the total egg counts. The presence of their intact eggshells may have prevented the entrance of external nucleases that would otherwise have caused degradation (10, 22, 40). We hypothesize that the DNA within eggs remains detectable by PCR until the protective eggshells themselves are permeabilized or degraded. Because the DNA in the inactivated eggs was still detectable, it contributed to false-positive PCR results when determining viability (discussed in more detail below).

The ITS-1 rDNA is also a specific target for A. lumbricoides and A. suum. These two species present different burdens to society, the former affecting the productivity of pig farming and the latter affecting public health. Both genetic and protein-based techniques have been developed to differentiate the two species (1, 41). Genetic analysis has shown that no differences exist in their rDNA sequences or in their ITS-2 regions, though there are 6-bp differences in their ITS-1 regions. Accordingly, the ITS-1 region of the Ascaris species has the potential to differentiate the species.

Initially, the sequence between bp 105 and 175 was chosen to take advantage of the mismatch between A. suum and A. lumbricoides at bp 133. However, sequencing the DNA of 10 transfected clones showed that one of the 10 clones contained the A. lumbricoides sequence and nine contained the A. suum sequence. Because the Ascaris eggs were extracted exclusively from the contents of pig intestines, there are two possible explanations for the presence of the A. lumbricoides sequence. The first possibility is that the pigs were infected with A. lumbricoides, in which case this study provides further documentation of the cross-infectivity of the two species (8). Another possibility is that the pigs were infected exclusively with A. suum but that A. suum has heterogeneous ITS-1 rDNA sequences, including the reputed A. lumbricoides sequence. Regardless of the explanation, because both sequences were found in the initial stock, the ITS-1 rDNA sequence could not be used to distinguish the two species. Thus, the primer-probe set was redesigned to target an upstream sequence of ITS-1 that was identical in both the A. suum and the A. lumbricoides sequence but not present in any other known species.

Quantifying total and viable egg levels with qPCR.
We found that quantifying viable egg levels based on ITS-1 rDNA copy number was a promising approach, producing results comparable to those of the standard microscopy technique for four different types of inactivation (Fig. 5). Furthermore, the method has a very low detection limit, capable of detecting as little as one larvated Ascaris egg. The method is based on the premise that only viable Ascaris eggs will develop from the single-celled stage to larvated eggs, which contain approximately 600 cells. Because ITS-1 rDNA did not disappear from inactivated eggs (except those treated at 70°C), however, this increase in cell number represented the maximum degree of inactivation that could be detected (2.68 log units in theory and 1.9 to 2.5 log units based on our experimental data).

The determination of the number of viable eggs was based on measuring the number of ITS-1 copies per larvated egg in control samples. The values obtained throughout the experiments clustered around the theoretically determined value of 2.5 x 10⁴ ITS-1 copies per larvated egg but ranged from 8.4 x 10³ to 5.3 x 10⁴ copies per viable egg. Because some of this variability may be associated with the qPCR procedure itself, we recommend that ITS-1 copy number always be measured in control samples that are run at the same time as experimental samples.

If only a determination of total Ascaris eggs is needed, the qPCR approach could be applied to eggs prior to incubation, which would allow rapid (same-day) determination of egg concentrations. The total egg number would then be determined by dividing by the ITS-1 copy number per single-celled egg (42 in our research, although we recommend running a control every time).

An obvious limitation to this entire approach is the assumption that all eggs are in the single-celled stage prior to the incubation period. If eggs are present at further stages of development, for example, if a larvated egg is inactivated but its ITS-1 rDNA levels persist during incubation, then the DNA method would not be able to differentiate it from a viable, larvated egg. These inactivated eggs would produce false-positive results and substantially decrease the accuracy of the method. More research is needed to document the developmental stages of Ascaris eggs in wastewaters and sludges that have been exposed to different types of treatment and the persistence of ITS-1 rDNA in larvated eggs that have been inactivated.

The approach we outlined for determining egg viability still requires incubating samples for 10 days, but this is a significant reduction over the 30-day incubation required by the current microscopy method. In principle, reducing the incubation time for the microscopy method is also a possibility and has been explored by various researchers (11, 18); we did not compare 10- versus 30-day incubation periods in the current study. However, it should be noted that it is visually more difficult to distinguish partially developed eggs from single-celled or inactivated eggs (compared to distinguishing larvated eggs). One benefit of the qPCR approach is that it does not require microscopic examination, which is tedious and potentially subjective, to determine viability.

Unlike PCR-based viability methods for other organisms (3, 22), the Ascaris qPCR method was robust in that it produced results comparable to those from microscopy for every treatment type tested: high heat, moderate heat, UV, and ammonia. These four treatments are representative of those used to inactivate pathogens in sludge and cause inactivation by different mechanisms, including protein denaturation, random breakage of phosphodiester bonds, increases in cellular permeability, dimerization of nucleic acids, and changes in intracellular pH (3, 22, 37).

Despite these advances, the DNA method still has a number of limitations, the most important of which is the production of false-positive results. To overcome this problem, methods to further reduce or eliminate the false-positive signals need to be developed (except if applied after high-temperature heat treatment). One option to degrade DNA in inactivated eggs would be to pretreat the eggs with proteinase and nucleases before PCR. This technique has been used effectively to decrease false-positive signals from inactivated viruses and Cryptosporidium oocysts (26, 32).

ITS-1 rRNA could also be used to circumvent the problem of DNA persistence. The advantage of ITS-1 rRNA is that it is degraded quickly after transcription, which may explain why it was not detected in inactivated eggs (Table 5). However, the RNA levels exhibited a high degree of variability that prevented the RNA from reaching a constant level during development. Thus, unlike the DNA, the RNA could not be used to quantify viability.

The RNA did, however, prove to be partially effective at determining the presence/absence of viable eggs. During development, the ITS-1 rRNA levels in viable Ascaris eggs were always above the detection limit from days 6 to 37. All of the complete inactivating treatments caused the ITS-1 rRNA levels to drop below the detection limit (Table 5). When subjected to treatments causing incomplete inactivation, the only samples to give positive results were those that contained viable eggs (Table 6). While the RNA method produced no false-positive results, it did produce false-negative results. Thus, another major limitation of the RNA method was the high number of eggs needed for detection. From the incomplete-inactivation results, the minimum number of viable eggs needed to produce a consistent positive result was 968 eggs (Table 6), which is much higher than the number of eggs typically encountered in U.S. sludges (in a reasonably sized sample). Using fewer viable eggs led to positive, mixed positive/negative, or negative results. The high detection limit may not be a problem if large numbers of eggs are spiked into a treatment reactor to determine its inactivation efficiency. Optimization of the RNA extraction, ethanol precipitation, and reverse transcriptase PCR may help to decrease the detection limit closer to levels typically encountered in sludges. In addition, the use of an exogenous internal reference RNA may help to control for operator-introduced variability (17). Finally, additional research is needed to determine the levels of ITS-1 rRNA after the eggs have grown into fully developed larvae. If the larva's physiological activity decreases while it awaits ingestion by a host, then it may show ITS-1 rRNA levels lower than those of developing eggs. In fact, on day 44 of the developmental experiments, the ITS-1 rRNA levels appeared to be decreasing (both positive and negative replicates were encountered).

The approach presented in this paper is the first to use molecular methods to quantify and determine the viability of a helminth egg. Having developed this method using purified egg stocks and laboratory solutions, future research is needed to assess its effectiveness with environmental samples. For example, higher detection limits and decreased accuracy are expected as a result of the steps that are used to concentrate eggs from complex environmental matrices, such as sludge or fecal wastes (4). In addition, matrix compounds may interfere with reverse transcription and PCR amplification. After further development and optimization, qPCR may be a promising alternative for faster and more accurate measurement of Ascaris eggs during evaluation of treatment processes or as a research tool.

 
This work was partially supported by a UC MEXUS-CONACYT collaborative grant.

We thank Victor Holmes for his valuable assistance.

 
* Corresponding author. Mailing address: Department of Civil and Environmental Engineering, MS 1710, University of California, Berkeley, CA 94720-1710. Phone: (510) 643-5023. Fax: (510) 642-7483. E-mail: nelson{at}ce.berkeley.edu.

Published ahead of print on 20 October 2006.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Abebe, W., N. Tsuji, H. Kasuga-Aoki, T. Miyoshi, T. Isobe, T. Arakawa, Y. Matsumoto, and S. Yoshihara. 2002. Species-specific proteins identified in Ascaris lumbricoides and Ascaris suum using two-dimensional electrophoresis. Parasitol. Res. 88:868-871.[CrossRef][Medline]
2
2. Barrett, J. 1976. Studies on induction of permeability in Ascaris lumbricoides eggs. Parasitology 73:109-121.[Medline]
3
3. Bhattacharya, S. S., M. Kulka, K. A. Lampel, T. A. Cebula, and B. B. Goswami. 2004. Use of reverse transcription and PCR to discriminate between infectious and non-infectious hepatitis A virus. J. Virol. Methods 116:181-187.[CrossRef][Medline]
4
4. Bowman, D. D., M. D. Little, and R. S. Reimers. 2003. Precision and accuracy of an assay for detecting Ascaris eggs in various biosolid matrices. Water Res. 37:2063-2072.[Medline]
5
5. Brownell, S. A., and K. L. Nelson. 2006. Inactivation of single-celled Ascaris suum eggs by low-pressure UV radiation. Appl. Environ. Microbiol. 72:2178-2184.[Abstract/Free Full Text]
6
6. Chilton, N. B., R. B. Gasser, and I. Beveridge. 1995. Differences in a ribosomal DNA sequence of morphologically indistinguishable species within the Hypodontus macropi complex (Nematoda: Strongyloidea). Int. J. Parasitol. 25:647-651.[CrossRef][Medline]
7
7. Cooper, P. J., M. Chico, C. Sandoval, I. Espinel, A. Guevara, M. M. Levine, G. E. Griffin, and T. B. Nutman. 2001. Human infection with Ascaris lumbricoides is associated with suppression of the interleukin-2 response to recombinant cholera toxin B subunit following vaccination with the live oral cholera vaccine CVD 103-HgR. Infect. Immun. 69:1574-1580.[Abstract/Free Full Text]
8
8. Crompton, D. W. T. 2001. Advances in parasitology, vol. 48, p. 285-375. Academic Press, Boston, Mass.[Medline]
9
9. Deisingh, A. K., and M. Thompson. 2004. Strategies for the detection of Escherichia coli O157:H7 in foods. J. Appl. Microbiol. 96:419-429.[CrossRef][Medline]
10
10. Fontaine, M., and E. Guillot. 2003. Study of 18S rRNA and rDNA stability by real-time RT-PCR in heat-inactivated Cryptosporidium parvum oocysts. FEMS Microbiol. Lett. 226:237-243.[CrossRef][Medline]
11
11. Gaspard, P., J. Wiart, and J. Schwartzbrod. 1996. A method for assessing the viability of nematode eggs in sludge. Environ. Technol. 17:415-420.
12
12. Geenen, P. L., J. Bresciani, J. Boes, A. Pedersen, L. Eriksen, H. P. Fagerholm, and P. Nansen. 1999. The morphogenesis of Ascaris suum to the infective third-stage larvae within the egg. J. Parasitol. 85:616-622.[CrossRef][Medline]
13
13. Gomez-Couso, H., F. Freire-Santos, C. F. L. Amar, K. A. Grant, K. Williamson, M. E. Ares-Mazas, and J. McLauchlin. 2004. Detection of Cryptosporidium and Giardia in molluscan shellfish by multiplexed nested-PCR. Int. J. Food Microbiol. 91:279-288.[CrossRef][Medline]
14
14. Good, L., R. V. A. Intine, and R. N. Nazar. 1997. Interdependence in the processing of ribosomal RNAs in Schizosaccharomyces pombe. J. Mol. Biol. 273:782-788.[CrossRef][Medline]
15
15. Ishiwata, K., A. Shinohara, K. Yagi, Y. Horii, K. Tsuchiya, and Y. Nawa. 2004. Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing. Parasitol. Res. 92:50-52.[CrossRef][Medline]
16
16. Iwen, P. C., S. H. Hinrichs, and M. E. Rupp. 2002. Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Med. Mycol. 40:87-109.[Medline]
17
17. Johnson, D. R., P. K. H. Lee, V. F. Holmes, and L. Alvarez-Cohen. 2005. An internal reference technique for accurately quantifying specific mRNAs by real-time PCR with application to the tceA reductive dehalogenase gene. Appl. Environ. Microbiol. 71:3866-3871.[Abstract/Free Full Text]
18
18. Johnson, P. W., R. Dixon, and A. D. Ross. 1998. An in-vitro test for assessing the viability of Ascaris suum eggs exposed to various sewage treatment processes. Int. J. Parasitol. 28:627-633.[CrossRef][Medline]
19
19. Krishnaswami, S. K., and F. J. Post. 1968. Effect of chlorine on Ascaris (Nematoda) eggs. Health Lab. Sci. 5:225-232.[Medline]
20
20. Le Cann, P., S. Ranarijaona, S. Monpoeho, F. Le Guyader, and V. Ferre. 2004. Quantification of human astroviruses in sewage using real-time RT-PCR. Res. Microbiol. 155:11-15.[Medline]
21
21. Malicki, J., A. Montusiewicz, and A. Bieganowski. 2001. Improvement of counting helminth eggs with internal standard. Water Res. 35:2333-2335.[Medline]
22
22. McKillip, J. L., L. A. Jaykus, and M. Drake. 1998. rRNA stability in heat-killed and UV-irradiated enterotoxigenic Staphylococcus aureus and Escherichia coli O157:H7. Appl. Environ. Microbiol. 64:4264-4268.[Abstract/Free Full Text]
23
23. Moreira-Silva, S. F., A. L. A. Leite, E. F. Brito, and F. E. L. Pereira. 2002. Nematode infections are risk factors for staphylococcal infection in children. Mem. Inst. Oswaldo Cruz 97:395-399.[Medline]
24
24. Musters, W., K. Boon, C. A. van der Sande, H. van Heerikhuizen, and R. J. Planta. 1990. Functional analysis of transcribed spacers of yeast ribosomal DNA. EMBO J. 9:3989-3996.[Medline]
25
25. Nelson, K. L., and J. L. Darby. 2001. Inactivation of viable Ascaris eggs by reagents during enumeration. Appl. Environ. Microbiol. 67:5453-5459.[Abstract/Free Full Text]
26
26. Nuanualsuwan, S., and D. O. Cliver. 2002. Pretreatment to avoid positive RT-PCR results with inactivated viruses. J. Virol. Methods 104:217-225.[CrossRef][Medline]
27
27. Pecson, B. M., and K. L. Nelson. 2005. Inactivation of Ascaris suum eggs by ammonia. Environ. Sci. Technol. 39:7909-7914.[Medline]
28
28. Peng, W. D., K. Yuan, X. M. Zhou, M. Hu, Y. G. A. El-Osta, and R. B. Gasser. 2003. Molecular epidemiological investigation of Ascaris genotypes in China based on single-strand conformation polymorphism analysis of ribosomal DNA. Electrophoresis 24:2308-2315.[CrossRef][Medline]
29
29. Picard, C., C. Ponsonnet, E. Paget, X. Nesme, and P. Simonet. 1992. Detection and enumeration of bacteria in soil by direct DNA extraction and polymerase chain reaction. Appl. Environ. Microbiol. 58:2717-2722.[Abstract/Free Full Text]
30
30. Roussell, D., M. Gruidl, and K. Bennett. 1994. Germ-line determination in Caenorhabditis and Ascaris: will a helicase begin to unravel the mystery? Parasitol. Today 10:110-113.[CrossRef][Medline]
31
31. Rudi, K., B. Moen, S. M. Dromtorp, and A. L. Holck. 2005. Use of ethidium monoazide and PCR in combination for quantification of viable and dead cells in complex samples. Appl. Environ. Microbiol. 71:1018-1024.[Abstract/Free Full Text]
32
32. Smith, J. J., T. S. Gunasekera, C. R. M. Barardi, D. Veal, and G. Vesey. 2004. Determination of Cryptosporidium parvum oocyst viability by fluorescence in situ hybridization using a ribosomal RNA-directed probe. J. Appl. Microbiol. 96:409-417.[CrossRef][Medline]
33
33. Sulston, J. E., and S. Brenner. 1974. DNA of Caenorhabditis elegans. Genetics 77:95-104.[Abstract/Free Full Text]
34
34. U.S. Environmental Protection Agency. 1984. Definition and procedure for the determination of the method detection limit. Revision 1.11, 40 CFR part 136, appendix B.
35
35. U.S. Environmental Protection Agency. 1994. A plain English guide to the EPA part 503 biosolids rule. U.S. EPA/832/R-93-003.
36
36. van der Sande, C., M. Kwa, R. W. van Nues, H. van Heerikhuizen, H. A. Raue, and R. J. Planta. 1992. Functional analysis of internal transcribed spacer 2 of Saccharomyces cerevisiae ribosomal DNA. J. Mol. Biol. 223:899-910.[CrossRef][Medline]
37
37. Warren, K. S. 1962. Ammonia toxicity and pH. Nature 195:47-49.[CrossRef][Medline]
38
38. Wharton, D. A. 1983. The production and functional morphology of helminth egg-shells. Parasitology 86:85-87.
39
39. Wiedenmann, A., P. Kruger, and K. Botzenhart. 1998. PCR detection of Cryptosporidium parvum in environmental samples—a review of published protocols and current developments. J. Ind. Microbiol. Biotechnol. 21:150-166.[CrossRef]
40
40. Yaron, S., and K. R. Matthews. 2002. A reverse transcriptase-polymerase chain reaction assay for detection of viable Escherichia coli O157:H7: investigation of specific target genes. J. Appl. Microbiol. 92:633-640.[CrossRef][Medline]
41
41. Zhu, X. Q., N. B. Chilton, D. E. Jacobs, J. Boes, and R. B. Gasser. 1999. Characterisation of Ascaris from human and pig hosts by nuclear ribosomal DNA sequences. Int. J. Parasitol. 29:469-478.[CrossRef][Medline]
42
42. Zhu, X. Q., R. B. Gasser, D. E. Jacobs, G. C. Hung, and N. B. Chilton. 2000. Relationships among some ascaridoid nematodes based on ribosomal DNA sequence data. Parasitol. Res. 86:738-744.[CrossRef][Medline]

---

Applied and Environmental Microbiology, December 2006, p. 7864-7872, Vol. 72, No. 12
0099-2240/06/$08.00+0     doi:10.1128/AEM.01983-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Pecson, B. M. Articles by Nelson, K. L. Search for Related Content PubMed PubMed Citation Articles by Pecson, B. M. Articles by Nelson, K. L. Agricola Articles by Pecson, B. M. Articles by Nelson, K. L.