This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, B.
Right arrow Articles by Oliver, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, B.
Right arrow Articles by Oliver, J. D.
Agricola
Right arrow Articles by Smith, B.
Right arrow Articles by Oliver, J. D.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, February 2006, p. 1445-1451, Vol. 72, No. 2
0099-2240/06/$08.00+0     doi:10.1128/AEM.72.2.1445-1451.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

In Situ and In Vitro Gene Expression by Vibrio vulnificus during Entry into, Persistence within, and Resuscitation from the Viable but Nonculturable State

Ben Smith and James D. Oliver*

Department of Biology, University of North Carolina at Charlotte, Charlotte, North Carolina 28223

Received 6 July 2005/ Accepted 8 December 2005


arrow
ABSTRACT
 
Isolation of Vibrio vulnificus during winter months is difficult due to the entrance of these cells into the viable but nonculturable (VBNC) state. While several studies have investigated in vitro gene expression upon entrance into and persistence within the VBNC state, to our knowledge, no in situ studies have been reported. We incubated clinical and environmental isolates of V. vulnificus in estuarine waters during winter months to monitor the expression of several genes during the VBNC state and compared these to results from in vitro studies. katG (periplasmic catalase) was down-regulated during the VBNC state in vitro and in situ compared to the constitutively expressed gene tufA. Our results indicate that the loss of catalase activity we previously reported is a direct result of katG repression, which likely accounts for the VBNC response of this pathogen. While expression of vvhA (hemolysin) was detectable in environmental strains during in situ incubation, it ceased in all cases by ca. 1 h. These results suggest that the natural role of hemolysin in V. vulnificus may be in osmoprotection and/or the cold shock response. Differences in expression of the capsular genes wza and wzb were observed in the two recently reported genotypes of this species. Expression of rpoS, encoding the stress sigma factor RpoS, was continuous upon entry into the VBNC state during both in situ and in vitro studies. We found the half-life of mRNA to be less than 60 minutes, confirming that mRNA detection in these VBNC cells is a result of de novo RNA synthesis.


arrow
INTRODUCTION
 
Vibrio vulnificus is a gram-negative bacterium found in estuarine and coastal waters, including the East, Gulf, and Pacific Coasts of the United States and coastal waters throughout the world (15, 26, 27, 35, 46), at high numbers in bivalve mollusks. This bacterium is capable of causing rapidly fatal septicemia and wound infections subsequent to the ingestion of raw or undercooked seafood or following the exposure of wounds to water containing this pathogen (27). The ingestion of raw shellfish, especially oysters, is the most common means of developing primary septicemia, which affects individuals who either are immunocompromised or display underlying hepatic disorders with increased serum iron levels almost exclusively (32). In fact, it has been established experimentally that elevated serum iron levels highly correlate with the growth of V. vulnificus in human serum (25, 44, 52). V. vulnificus is of extreme significance to the seafood industry, as it causes more seafood-borne deaths than any other organism in the United States and also has the highest case fatality rate of any food-borne infection reported in this country (23). Indeed, 30 to 40 cases resulting in death occur each year in the United States. Interestingly, approximately 90% of all who suffer from V. vulnificus-induced primary septicemia are males, due to the apparent protection from the endotoxin by estrogen in females (24).

The environment for V. vulnificus, as for all estuarine bacteria, consists of constantly fluctuating nutrient, salinity, pollutant, water temperature, pH, and light exposure levels. It is well established that bacteria are capable of responding to environmental stresses by employing various survival mechanisms (41). For example, it has been reported in numerous studies that during a temperature downshift to less than 10°C, V. vulnificus enters the viable but nonculturable (VBNC) state in both in vitro and in situ conditions (31, 50). Cells existing in this state retain viability and the potential for infection (6) and yet are no longer culturable on routine laboratory media. To date, it has been reported that 60 bacterial species, including pathogens and nonpathogens and gram-negative and gram-positive microorganisms, are capable of entering and persisting within such a survival state (30). Cells have been reported to enter this state in response to natural stresses such as starvation; unfavorable temperatures, osmotic levels, or oxygen concentrations; and exposure to harmful light (29). The VBNC state is characterized by cell dwarfing and decreases in macromolecular synthesis, nutrient transport, and respiration rates (28, 37). However, while biosynthesis during this state continues at low levels in comparison to that occurring in actively metabolizing cells, ATP production remains at high levels compared to that by moribund cells (5, 9). In addition, several reports have indicated the continued transcription of genes by cells in the VBNC state in the laboratory (8, 21, 42, 54). The constitutive transcription of vvhA (hemolysin) in VBNC cultures of V. vulnificus, detectable after 4.5 months, supports the fact that these cells are viable and have a need for this protein (42). It is also well known that cells of V. vulnificus within the VBNC state can resuscitate in vitro (34, 49), in vivo (33), and in situ (31) once the adverse conditions reverse. In the case of V. vulnificus, temperature upshift induces resuscitation, which may account for the higher incidences of isolation and infection that occur during warm-water months, during which water temperatures are above 15°C (11, 12, 14, 38, 45, 46, 47, 48).

To learn which genes might be important in the VBNC state of V. vulnificus, it is essential to study the response of this organism in its natural environment (in situ) as it compares to that found in in vitro studies in which the estuary conditions are mimicked. To our knowledge, very few studies on in situ gene expression in any bacteria have previously been reported. By studying cells suspended in the membrane diffusion chambers developed by McFeters and Stuart (22), it was possible to monitor the expression of selected genes which may be involved in the VBNC state. By analyzing the expression of tufA, a gene encoding an elongation factor essential for efficient protein synthesis also found in Enterococcus faecalis (tuf) (10, 21), it was possible to monitor viability in cells existing in the VBNC state. We also monitored the expression of the rpoS gene, used by cells to combat numerous environmental stresses. Also, V. vulnificus produces a heat-stable, cytotoxic hemolysin which has been shown to possess cytolytic activity against mammalian erythrocytes and Chinese hamster ovary cells (18) and is reported to induce vasodilatation upon infection (17). We examined expression of the vvhA gene encoding this hemolysin, as it could provide insight into the virulence of this pathogen, as well as the natural role of this cytotoxin in V. vulnificus. Wright et al. (53) identified a locus including wza and wzb genes in V. vulnificus, which code for sugar transferases required for capsule synthesis at the cell surface (51). Expression of these capsular genes during in situ incubation or during the VBNC state in V. vulnificus has not been reported. Previous work in our lab has shown that catalase activity in V. vulnificus decreases at low temperatures, and as a consequence, these cells are unable to defend against the hydrogen peroxide present in routine media and become nonculturable (16). However, during resuscitation at 20°C, catalase activity is restored, leading to a renewed culturable state. It was not known whether this decrease in catalase activity is a direct result of transcriptional, translational, or posttranslational modifications. Therefore, the analysis of katG, which encodes the periplasmic catalase in V. vulnificus (39), was also a targeted gene for such nonculturable cells.

Although numerous reports have shown that cells within the VBNC state continue the production of mRNA (8, 21, 42, 54), it is possible that the transcripts being detected are a result of a markedly increased half-life of the mRNA while in this state. Consequently, it is conceivable that the detectable mRNA in VBNC populations is not being produced by viable cells but rather was synthesized prior to the loss of culturability and thus is not an indication of cell viability. By measuring the approximate half-life of V. vulnificus rpoS mRNA in VBNC cells following the inhibition of de novo RNA synthesis and the performance of reverse transcriptase PCR (RT-PCR) at time points subsequent to treatment, it was possible to determine the stability of this RNA during this survival state.


arrow
MATERIALS AND METHODS
 
Bacteria and culture conditions.
V. vulnificus C7184o/k, a clinical isolate, Env1, an oyster isolate, and 707o, a water isolate, were used in these studies. Cells were grown overnight in 5 ml heart infusion (HI) broth (Difco, Detroit, MI) at room temperature (ca. 22°C) with vigorous shaking. After 24 h of growth, a 1% (vol/vol) inoculation of the overnight cultures into fresh HI broth was performed, and the cells were grown to early logarithmic phase (optical density at 610 nm of 0.13 to 0.18) with vigorous shaking at room temperature.

In vitro experiments.
Cells were grown to log phase as described above, and a 1% (vol/vol) inoculation into microcosms of half-strength artificial seawater ( ASW) (reference 50) prechilled to 4°C was performed. These cells were then incubated at this temperature to monitor culturability and gene expression during entrance into and persistence within the VBNC state.

In situ experiments.
Cells were grown to log phase as described above, and a 1% (vol/vol) inoculation into ASW or autoclaved, filter-sterilized estuarine water (taken from the intracoastal waterway near Beaufort, NC) was performed. Cells (25 ml) from this inoculation were loaded into sterile membrane diffusion chambers of the type described by McFeters and Stuart (22) with affixed 76-mm-diameter, 0.2-µm-pore-size polycarbonate sterile filters (Osmonics, Inc., Livermore, Calif.) (1). Chambers were then suspended at depths of 2 to 4 feet in estuarine water near Beaufort or Topsail Island, NC, as previously described (31).

Determination of culturability.
Bacterial samples taken from the chambers (in situ) or flasks (in vitro) were serially diluted in ASW, plated onto HI agar, and incubated at room temperature. Plate counts were recorded after incubation for 24 h. When culturability was <10 CFU/ml, filtrations of 1-ml and 10-ml portions were performed using 0.22-µm filters (Nuclepore; Fisher Scientific) which were placed onto HI agar at room temperature for incubation. Bacterial cultures were considered to be VBNC when there was <0.1 CFU/ml.

Determination of viable and total cell counts.
For both in vitro and in situ studies, 1-ml samples were removed periodically to determine viability and total cell counts using a LIVE/DEAD BacLight assay kit (Molecular Probes, Eugene, OR) according to the manufacturer's directions. The BacLight kit uses SYTO 9 stain and propidium iodide to measure membrane integrity to distinguish live (intact cell membrane) and dead (lacking an intact cell membrane) cells. Samples stained with these reagents were filtered through 0.2-µm-pore-size black polycarbonate filters (Osmonics, Inc., Livermore, Calif.). An epifluorescence microscope (Olympus model BX51) was used to view live (green) and dead (red) cells by use of an appropriate filter cube. Minimums of 30 fields or 300 cells were counted in all samples to determine the total numbers and numbers of viable cells present as previously described (1). Thus, the total cell count was the measure of live plus dead cells by the microscopic count, viability was determined based on a microscopic LIVE/DEAD BacLight assay, and culturable cells were the population able to grow aerobically on HI agar.

Monitoring of environmental conditions.
During in situ experiments, salinity was measured with a handheld Schuco refractometer (Thomas Scientific, Swedesboro, NJ) and surface water temperature with a thermometer.

RNA extractions and PCR and RT-PCR products.
At each time point during in vitro and in situ experiments, 500-µl aliquots from both membrane diffusion chambers or microcosms were immediately treated with 1 ml RNAprotect bacterium reagent (QIAGEN, Valencia, CA) to stabilize the RNA, vortexed for 5 seconds, and incubated at room temperature, undisturbed, for 5 min. Each sample was then centrifuged at 14,000 x g at 4°C for 15 min, the supernatants were discarded, and the pellets were stored at –20°C for up to 2 weeks (RNAprotect bacterium reagent handbook; QIAGEN). Total RNA was extracted using a TRIzol Max bacterial RNA isolation kit (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Following RNA extraction, total RNA was quantified by Gene Spec analysis (MiraiBio, Inc., Alameda, CA). For all samples, 1 µg RNA was used for DNase I treatment according to the manufacturer's instructions (Invitrogen). For PCR analysis of DNase I-treated RNA, a master mix containing 5 µl 10x buffer, 2 µl (25 mM) MgCl2, 1 µl (10 mM) dNTP, 2.5 µl (6 µM) sense primer, 2.5 µl (6 µM) antisense primer, 0.25 µl (5 units/µl) HotStarTaq DNA polymerase, and 26.75 µl water was used per sample for a total volume of 40 µl/sample (QIAGEN HotStarTaq DNA polymerase). DNase I-treated RNA (10 µl) added to 40 µl master mix was used for PCR samples to detect DNA contamination; any samples with positive amplification were not used. Positive controls for PCR consisted of 40 µl master mix and 10 µl DNA extracted from log-phase V. vulnificus C7184o/k. Negative controls for PCR consisted of 40 µl master mix and 10 µl water (no DNA template). An RT-PCR master mix for each sample consisted of 10 µl 5x buffer containing 12.5 mM MgCl2, 2 µl (10 mM) dNTP, 5 µl (6 µM) sense primer, 5 µl (6 µM) antisense primer, 2 µl One-Step enzyme mix, and 16 µl RNase-free water for a volume of 40 µl per sample. DNase I-treated RNA (10 µl) and 40 µl master mix was used for RT-PCR (QIAGEN RT-PCR One-Step kit) as described by the manufacturer. Positive controls for RT-PCR consisted of 10 µl DNase-free RNA and 40 µl master mix, and negative controls consisted of 10 µl RNase-free water and 40 µl master mix. PCR and RT-PCR products (10 µl) were visualized on a 1% agarose gel with ethidium bromide, with a DNA ladder (Promega, Madison, WI) being used to assess the fragment sizes of bands.

PCR and RT-PCR primers.
The following primer pairs were used to detect the various genes as follows. vvhA sense (5'CGCCGCTCACTGGGGCAGTGGCTG 3') and vvhA antisense (5'CCAGCCGTTAACCG-AACCACCCGC 3') were used to produce a vvhA species-specific fragment; rpoS sense (5'CGGTTGTTGGTATCGGAAGG 3') and rpoS antisense (5'GGCGAATCCACCATGTTGCG 3') were used to detect this stress-responsive sigma factor; tufA sense (5'TCTCAATCCAAGGTCGTGGT 3') and tufA antisense (5'ACCAGGCATTACCATTTCT 3') were used to detect this elongation factor; katG sense (5'CTACGGCGGTTTGATGAT 3') and katG antisense (5'CATCACAGCAGCGAGCGG 3') were used to detect catalase expression; and wza sense (5'CACCCTGAACTGACGATT 3'), wza antisense (5'TGCTCTTCACCGTTGCGA 3'), wzb sense (5'GGTAAGCCAGCCGATGC 3'), and wzb antisense (5'CTTTGCCCAGGCTTGTG 3') were used to detect these two sugar transferase genes essential for capsule production.

PCR and RT-PCR amplification.
PCR and RT-PCR amplification was conducted in a Techne PHC-3 thermocycler, with cycle numbers varying according to the primer used. PCR amplifications consisted of an initial heating step for 15 min at 95°C to activate the HotStarTaq DNA polymerase followed by 30 cycles of denaturation (94°C for 1 min), annealing (1 min, temperature dependent on primers; see below), and extension (72°C for 1 min). After cycling was complete, a final extension (72°C for 10 min) was performed. RT-PCR amplifications consisted of a reverse transcription step for 30 min at 50°C followed by an initial PCR step for 15 min at 95°C to activate the HotStarTaq DNA polymerase. Next, 30 cycles of denaturation (94°C for 1 min), annealing (1 min, temperature dependent on primers; see below), and extension (72°C for 1 min) were performed. A final extension at 72°C for 10 min occurred after cycling was complete. All PCR and RT-PCR products were then stored at 4°C until use. The annealing temperatures in both PCR and RT-PCR amplification were as follows: 50°C for tufA; 52°C for rpoS; 60°C for katG, wza, and wzb; and 72°C for vvhA.

Resuscitation conditions.
After entry of the cells into the VBNC state in both the in situ and in vitro studies, 1 ml of cell suspension (<0.1 CFU/ml) was removed and incubated at room temperature (ca. 22°C) for 24 h, serially diluted in ASW, and plated onto HI agar. The results from the enumeration of CFU were recorded after 24 h of incubation at room temperature.

Determination of rpoS mRNA half-life in VBNC cells.
V. vulnificus C7184o/k was grown to early logarithmic phase as described above. Approximately 10 ml of this growth was used to inoculate a sterile flask containing 1,000 ml ASW prechilled to 4°C. Culturability of cells was determined until it was less than 0.1 CFU/ml, indicating the presence of cells in the VBNC state. Two 50-ml aliquots of the VBNC culture were aseptically removed and placed into sterile 50-ml conical tubes (USA Scientific, Ocala, FL) kept at 4°C. One microcosm received 5 µg/ml rifampin (Sigma, St. Louis, MO) diluted in methanol to inhibit de novo RNA synthesis, while the second received methanol only (10 µl) as a control. After 1, 5, 30, and 60 min, RNA samples were extracted, PCR and RT-PCR were performed, and culturability was determined as described above. The expression of rpoS was used as an indication of the approximate half-life of V. vulnificus mRNA during the VBNC state.

Determination of RT-PCR limit of detection.
V. vulnificus C8174o/k was grown to early log phase as described above to a concentration of ca. 108 CFU/ml. This cell suspension was serially diluted in ASW to cell concentrations of ca. 106 CFU/ml, 104 CFU/ml, 103 CFU/ml, and 102 CFU/ml, which were determined in relation to culturability on HI agar. RNA samples were immediately taken from each dilution and extracted as described above. By use of primers for vvhA (hemolysin), PCR and RT-PCR were performed. This allowed us to determine the number of cells required for mRNA detection in our RT-PCR methodology.


arrow
RESULTS AND DISCUSSION
 
In vitro culturability and viability.
After 120 h in ASW maintained at 4°C, all three V. vulnificus strains were no longer culturable on HI agar (<0.1 CFU/ml), while total and viable cell counts remained high even after the cells were VBNC for 5 days (Fig. 1). These findings are comparable to previous studies in which mid-logarithmic-phase V. vulnificus strains were reported to enter the VBNC state upon incubation in ASW at 4°C in 4 to 6 days (44), 10 days (31), and 3 to 14 days (42). Following incubation for 240 h at 4°C (5 days VBNC), 1 ml of each microcosm was removed and incubated at room temperature (ca. 22°C) for 24 h to induce resuscitation. This resulted in restored culturability up to 106 CFU/ml, a result similar to those reported by Whitesides and Oliver (49).


Figure 1
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. Entrance of V. vulnificus into the VBNC state in ASW at 4°C. Shown are total cell counts ({blacksquare}), viable cell counts ({blacktriangleup}), and culturability on HI agar ({blacktriangledown}) for strains 707o (— — —), Env1 (—), and C7184o/k (- - - -). Down arrows indicate culturability below the level of detection for each strain.

Half-life of mRNA in a VBNC population.
Several reports have shown that cells in the VBNC state retain viability, as indicated by continued mRNA synthesis (9, 21, 42, 54). In fact, unlike DNA, mRNA has been argued to be a reliable marker of viability in general due to its short half-life and its role in bacterial cell physiology (43). Such turnover is typical of bacteria, with half-lives of most mRNA species being only a few minutes (7, 43). Bernstein et al. (4), examining mRNA decay rates in Escherichia coli, found that mean half-life values for 16 different gene functional classes varied from 3.8 to 6.4 min. Albertson et al. (3) reported the half-life of the marine Vibrio sp. strain S14 mRNA pool to increase from 1.7 to 10.3 min during 24 h of total energy and nutrient starvation, while Albertson and Nyström (2) found the half-life of the E. coli mRNA pool to increase only 2.2-fold, to 4.0 min, during a starvation period of 2 h. Significantly, these authors reported that transcript stability appeared to be global, since transcripts of all genes exhibited approximately the same level of stability. In contrast, Pease et al. (36) reported that transcript half-life was unaffected by nutrient half-lives. The use of mRNA detection by RT-PCR in VBNC populations in V. vulnificus and Vibrio parahaemolyticus was recently assessed as to its accuracy as a marker of viability by performing RT-PCR before and after a lethal treatment (10 min at 100°C). In both studies (3, 42), no mRNA was detected subsequent to lethal treatment, indicating that positive RT-PCR amplification is associated with the presence of live cells. In order to further validate this conclusion in our studies, we treated a VBNC population of V. vulnificus C7184o/k, maintained at 4°C in ASW, with rifampin (which binds to the beta subunit of RNA polymerase to inhibit de novo transcription) and performed RT-PCR for the constitutively expressed gene rpoS on samples before and after treatment. The purpose of this experiment was to show that the detection of mRNA by RT-PCR in VBNC populations is a result of de novo transcription and not an increased half-life during this state. We discovered that the half-life of rpoS in V. vulnificus C7184o/k cells present in the VBNC state was less than 60 min (data not shown), indicating that the mRNA in VBNC populations detected by RT-PCR methodology is associated with viable cells.

In vitro gene expression.
Our limit of detection indicated that ca. 103 cells/ml were required to generate a RT-PCR band by use of primers for the hemolysin gene (data not shown). Using this methodology, we then examined expression of six genes that may be important as V. vulnificus enters the VBNC state. Cells examined were those shown in Fig. 1. Expression of vvhA, rpoS, tufA, wza, and wzb in V. vulnificus C7184o/k and Env1 was detectable during the initial cold-shock response and entry into the VBNC state and following resuscitation from the VBNC state (Table 1). However, expression of vvhA in V. vulnificus 707o (vvhA positive by PCR) was not detectable at any time point during this study, even though rpoS, tufA, wza, and wzb were constitutively expressed. Saux et al. (42) reported that vvhA transcripts in VBNC populations maintained at 4°C in ASW in one clinical and two environmental strains of V. vulnificus were detectable for up to 4.5 months by RT-PCR and suggested the possible use of this molecular method to detect viable V. vulnificus cells in the environment when they are no longer culturable. Although our findings for V. vulnificus C7184o/k and Env1 are consistent with their study, expression of vvhA in strain 707o was not detectable, indicating that this species-specific hemolysin gene should not be utilized as a viability marker for V. vulnificus. However, while we were unable to detect vvhA mRNA in strain 707o by our RT-PCR methodology, it is possible that the levels of transcript were below our limit of detection. Nevertheless, it was recently reported that tdh1 and tdh2, encoding the thermostable direct hemolysin in V. parahaemolyticus, were not expressed in VBNC populations (8), supporting our contention that the use of RT-PCR targeting the hemolysin gene to investigate the viability of VBNC populations may not be reliable.


View this table:
[in this window]
[in a new window]
 
TABLE 1. In vitro mRNA detection of six genes by RT-PCR during entrance into, persistence within, and resuscitation from the VBNC state for three strains of V. vulnificus maintained in 1/2 ASW at 4°C

Our ability to detect katG, which codes for the periplasmic catalase in V. vulnificus (16, 39), was consistently decreased in all three V. vulnificus strains in comparison to tufA after 120 and 240 h in ASW at 4°C when cells were viable but nonculturable (Fig. 2). However, upon resuscitation, the level of katG returned to that seen in prechilled cells.


Figure 2
View larger version (45K):
[in this window]
[in a new window]
 
FIG. 2. (A) RT-PCR results for katG upon in vitro entry into, persistence within, and resuscitation from the VBNC state by the three V. vulnificus strains maintained in ASW at 4°C for which results are shown in Table 2. (B) Representative RT-PCR result for tufA expression by V. vulnificus 707o during the same conditions. Lanes: DNA, 100-bp ladder (600 bp at top, decreasing by 100 bp/band); – and +, negative and positive controls, respectively; times of study (in hours); R, 24-h room temperature upshift, which induced resuscitation of the VBNC cells.

These in vitro studies provide strong evidence that cells of V. vulnificus, even though nonculturable, are viable and productive of mRNA while in the VBNC state.

In situ culturability, viability, and resuscitation from the VBNC state.
During three in situ experiments in which V. vulnificus cells were loaded into membrane diffusion chambers and incubated in cold (<15°C) estuarine waters, all three V. vulnificus strains entered the VBNC state, decreasing from 106 to 107 CFU/ml to <0.1 CFU/ml over a 14-day period. During this time, total and viable cell counts remained elevated. Following a room temperature upshift (ca. 22°C) for 24 h, all three V. vulnificus strains resuscitated to levels between 3.1 x 104 and 6.2 x 106 CFU/ml.

In situ gene expression.
We employed three V. vulnificus strains to investigate in situ gene expression of six different genes during entry into, persistence within, and resuscitation from the VBNC state. These studies were carried out during January, February, and April 2005 in estuarine waters along the North Carolina coast, which at those times were at 8, 11, and 14°C, respectively.

Expression of the hemolysin gene, vvhA, by strain C7184k/o was observed at all times (up to 14 days) (Table 2), even though culturability declined to <0.1 CFU/ml by the day 14 sampling. This strain also expressed vvhA at time zero in room temperature, filter-sterilized estuarine water. In contrast, vvhA mRNA in strains 707o and Env1 was not detectable at time zero (room temperature, filter-sterilized estuarine water) but was transiently expressed in response to cold-water incubation for 0.25 h. After 0.5 to 1 h of incubation, no vvhA transcripts were detectable in either of these strains. We made identical observations during all three of our in situ studies; this thus appears to be a response to introduction into cold estuarine waters. Unlike that in strain Env1, expression in strain 707o was not restored following a 24-h room temperature upshift (Table 2 and Fig. 3). Lee et al. reported that hemolysin production in V. vulnificus, like that of the thermostable direct hemolysin in V. parahaemolyticus, was affected by various temperatures and salinities and suggested that V. vulnificus is capable of responding to such shifts by increasing the production of hemolysin (19, 20). Results from our studies indicate that expression of vvhA in strains of V. vulnificus is indeed influenced by environmental factors, as transient expression occurred only after incubation in natural estuarine water. We suggest that the natural role of hemolysin in V. vulnificus may be in osmoprotection and/or the cold shock response.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Composite results of mRNA detectiona during threeb in situ studies


Figure 3
View larger version (47K):
[in this window]
[in a new window]
 
FIG. 3. Expression of vvhA in three strains of V. vulnificus following in situ incubation during February 2005. Lanes: DNA, 100-bp ladder; –, negative control; times of study (in hours and days); R, 24-h room temperature upshift of the day 14 VBNC cells resulting in resuscitation to culturability.

In contrast to vvhA, rpoS and tufA were expressed by all three V. vulnificus strains at every sample period in all cold-water studies as well as at time zero (Table 2). These findings are the same as those observed during in vitro incubation at 4°C in ASW (Table 1). RpoS has been shown to play a role in survival during exposure to reactive oxygen species, acidic conditions, and hyperosmolarity in V. vulnificus (13). In addition, this alternate sigma factor has been linked to the transcription of several virulence genes. In fact, a V. vulnificus RpoS mutant was unable to produce albuminase, caseinase, or elastase and exhibited a reduced collagenase and gelatinase activity in comparison to the wild-type strain (13). We have shown that during both in vitro and in situ incubation at temperatures below 15°C, transcription of rpoS continues even when cells are VBNC, which demonstrates the likely importance of this alternate sigma factor in survival under such conditions. Similar to our findings, it was recently reported that rpoS was expressed in a VBNC population of V. parahaemolyticus maintained at 4°C in ASW (8).

In agreement with our findings following in vitro incubation in ASW maintained at 4°C, which induced all three V. vulnificus strains to enter the VBNC state, expression of katG appeared to be down-regulated in VBNC populations of V. vulnificus incubated in cold estuarine water in comparison to the expression of tufA (Table 2 and Fig. 4). Upon resuscitation of the nonculturable populations that had entered the VBNC state in the estuary, katG expression was restored. Our laboratory has previously shown that catalase activity decreases as V. vulnificus enters the VBNC state (16), resulting in cells that are unable to combat the hydrogen peroxide present in routine media. Results from our current study confirm the role of catalase in the VBNC state in V. vulnificus and suggest that the loss of catalase activity is a direct result of repressed transcription of katG.


Figure 4
View larger version (61K):
[in this window]
[in a new window]
 
FIG. 4. (A) Detection of katG mRNA in three V. vulnificus strains during in situ incubation during February 2005 for 14 days and following resuscitation. (B) Representative RT-PCR result for the expression of tufA during the same conditions in V. vulnificus 707o. Lanes: DNA, 100-bp ladder; –, negative control; times of study (in hours or days); R, 24-h room temperature upshift of the day 14 VBNC cells resulting in resuscitation to culturability.

Our laboratory recently reported that V. vulnificus strains can be divided into two groups, termed C type (clinical origin) and E type (environmental origin) based on differences in the DNA sequence of a 200-bp randomly amplified polymorphic DNA PCR amplicon found in all V. vulnificus isolates (40). PCR analysis of V. vulnificus C7184k/o and 707o revealed that both are of the C type. Differential expression of wza and wzb, two genes involved in capsular synthesis, was observed in the three strains during both in vitro and in situ incubation (Tables 1 and 2). V. vulnificus Env1, an E-type strain, expressed wza and wzb during both in vitro and in situ studies at all time points, including when the cells were VBNC and following resuscitation. However, wza and wzb expression in V. vulnificus C7184k/o (C type) and 707o (C type) during in situ incubation was down-regulated below our limit of detection by 14 days when the cells were in the VBNC state. Expression of these genes in the two C-type strains during in vitro incubation in ASW at 4°C was similar to in situ results, in that both genes were down-regulated to low levels of expression after being VBNC for 5 days (Table 1). These findings suggest that there may be a difference in capsular regulation between C-type and E-type V. vulnificus strains, although more strains need to be tested to verify this possibility. Nevertheless, this is the first report of expression of these capsular genes during incubation in the natural environment and while cells are no longer culturable.

We have employed a method for monitoring in situ gene expression and viability in V. vulnificus cells suspended in natural estuarine waters. Not surprisingly, our findings suggest that studies conducted in the laboratory may not accurately indicate in situ responses. To our knowledge, this is one of the first in situ studies of multiple gene expression done with any bacterium suspended in its natural environment with comparisons to in vitro results. We are currently investigating the expression of various genes in this bacterium during in situ incubation at warmer temperatures.


arrow
ACKNOWLEDGMENTS
 
This research was funded in part by the Sea Grant College Program (2975040292).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biology, University of North Carolina at Charlotte, 9201 University City Blvd., Charlotte, NC 28223. Phone: (704) 687-8516. Fax: (704) 687-3457. E-mail: jdoliver{at}uncc.edu. Back


arrow
REFERENCES
 
    1
  1. Adams, B. L., T. C. Bates, and J. D. Oliver. 2003. Survival of Helicobacter pylori in a natural freshwater environment. Appl. Environ. Microbiol. 69:7462-7466.[Abstract/Free Full Text]
  2. 2
  3. Albertson, N. H., and T. Nyström. 1994. Effects of starvation for exogenous carbon on functional mRNA stability and rate of peptide chain elongation in Escherichia coli. FEMS Microbiol. Lett. 117:181-188.[CrossRef][Medline]
  4. 3
  5. Albertson, N. H., T. Nyström, and S. Kjelleberg. 1990. Functional mRNA half-lives in the marine Vibrio sp. S14 during starvation and recovery. J. Gen. Microbiol. 136:2195-2199.
  6. 4
  7. Bernstein, J. A., A. B. Khodursky, P.-H. Lin, S. Lin-Chao, and S. N. Cohen. 2002. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc. Natl. Acad. Sci. USA 99:9697-9702.[Abstract/Free Full Text]
  8. 5
  9. Beumer, R. R., J. deVries, and F. M. Rombouts. 1992. Campylobacter jejuni non-culturable coccoid cells. Int. J. Food Microbiol. 15:153-163.[CrossRef][Medline]
  10. 6
  11. Colwell, R. R., P. R. Brayton, D. Herrington, S. A. Huq, and M. M. Levine. 1996. Viable but non-culturable Vibrio cholerae O1 reverts to a cultivable state in the human intestine. World J. Microbiol. Biotechnol. 12:28-31.[CrossRef]
  12. 7
  13. Conway, T., and G. K. Schoolnik. 2003. Microarray expression profiling: capturing genome-wide portrait of the transcriptome. Mol. Microbiol. 47:879-889.[CrossRef][Medline]
  14. 8
  15. Coutard, F., M. Pommepuy, S. Loaec, and D. Hervio-Heath. 2005. mRNA detection by reverse transcription-PCR for monitoring viability and potential virulence in a pathogenic strain of Vibrio parahaemolyticus in viable but nonculturable state. J. Appl. Microbiol. 98:951-961.[CrossRef][Medline]
  16. 9
  17. Federighi, M., J. L. Tholozan, J. M. Cappelier, J. P. Tissier, and J. L. Joure. 1998. Evidence of non-coccoid viable but non-culturable Campylobacter jejuni cells in microcosm water by direct viable count, CTC-DAPI double staining, and scanning electron microscopy. Food Microbiol. 15:539-550.[CrossRef]
  18. 10
  19. Heim, S., M. D. M. Lleo, B. Bonato, Carlos A. Guzman, and P. Canepari. 2002. The viable but nonculturable state and starvation are different stress responses of Enterococcus faecalis, as determined by proteome analysis. J. Bacteriol. 184:6739-6745.[Abstract/Free Full Text]
  20. 11
  21. Høi, L., I. Dalsgaard, A. DePaola, R. J. Siebeling, and A. Dalsgaard. 1998. Heterogeneity among isolates of Vibrio vulnificus recovered from eels (Anguilla anguilla) in Denmark. Appl. Environ. Microbiol. 64:4676-4682.[Abstract/Free Full Text]
  22. 12
  23. Hsueh, P.-R., C.-Y. Lin, H.-J. Tang, H.-C. Lee, J.-W. Liu, Y.-C. Liu, and Y.-C. Chuang. 2004. Vibrio vulnificus in Taiwan. Emerg. Infect. Dis. 10:1363-1368.[Medline]
  24. 13
  25. Hülsmann, A., T. M. Rosche, I.-S. Kong, H. M. Hassan, D. M. Beam, and J. D. Oliver. 2003. RpoS-dependent stress response and exoenzyme production in Vibrio vulnificus. Appl. Environ. Microbiol. 69:6114-6120.[Abstract/Free Full Text]
  26. 14
  27. Jones, S. H., and B. Summer-Branson. 1998. Detection of pathogenic Vibrio spp. in a northern New England estuary, USA. J. Shellfish Res. 17:1665-1669.
  28. 15
  29. Kelly, M. T. 1982. Effect of temperature and salinity on Vibrio (Beneckea) vulnificus occurrence in a Gulf Coast environment. Appl. Environ. Microbiol. 44:820-824.[Abstract/Free Full Text]
  30. 16
  31. Kong, I.-S., T. C. Bates, A. Hüsmann, H. Hassan, B. E. Smith, and J. D. Oliver. 2004. Role of catalase and oxyR in the viable but nonculturable state of Vibrio vulnificus. FEMS Microbiol. Ecol. 50:133-142.[CrossRef]
  32. 17
  33. Kook, H., S. E. Lee, Y. H. Baik, S. S. Chung, and J. H. Rhee. 1996. Vibrio vulnificus hemolysin dilates rat thoracic aorta by activating guanylate cyclase. Life Sci. 59:41-47.
  34. 18
  35. Kreger, A. S., and D. Lockwood. 1981. Detection of extracellular toxin(s) produced by Vibrio vulnificus. Infect. Immun. 33:583-590.[Abstract/Free Full Text]
  36. 19
  37. Lee, C., M. Kim, S. Y. Kim, S. J. Kim, P. Y. Ryu, H. C. Lee, J. S. Oh, S. S. Chung, and J. H. Rhee. 1998. Regulation of Vibrio vulnificus hemolysin production by environmental changes, abstr. B-172, p. 84. Abstr. Annu. Meet. Am. Soc. Microbiol. American Society for Microbiology, Washington, D.C.
  38. 20
  39. Lee, S. E., S. H. Shin, S. Y. Kim, Y. R. Kim, D. H. Shin, S. S. Chung, Z. H. Lee, J. Y. Lee, K. C. Jeong, S. H. Choi, and J. H. Rhee. 2000. Vibrio vulnificus has the transmembrane transcription activator ToxRS stimulating the expression of the hemolysin gene vvhA. J. Bacteriol. 182:3405-3415.[Abstract/Free Full Text]
  40. 21
  41. Lleò, M. D. M., S. Pierobon, M. C. Tafi, C. Signoreto, and P. Canepari. 2000. mRNA detection by reverse transcription-PCR for monitoring viability over time in an Enterococcus faecalis viable but nonculturable population maintained in a laboratory microcosm. Appl. Environ. Microbiol. 66:4564-4567.[Abstract/Free Full Text]
  42. 22
  43. McFeters, G. A., and D. G. Stuart. 1972. Survival of coliform bacteria in natural waters: field and laboratory studies with membrane diffusion chambers. Appl. Environ. Microbiol. 24:805-811.[Abstract/Free Full Text]
  44. 23
  45. Mead, P. S., S. Laurence, V. Dietz, L. F. McCaid, J. S. Bresee, C. Shapiro, P. M. Griffin, and R. V. Tauxe. 2000. Food-related illness and death in the United States. Emerg. Infect. Dis. 5:1-38.[Medline]
  46. 24
  47. Merkel, S. M., S. Alexander, J. D. Oliver, and Y. M. Huet-Hudson. 2001. Essential role for estrogen in protection against Vibrio vulnificus-induced endotoxic shock. Infect. Immun. 69:6119-6122.[Abstract/Free Full Text]
  48. 25
  49. Morris, J. G., Jr., A. C. Wright, L. M. Simpson, P. K. Wood, D. E. Johnson, and J. D. Oliver. 1987. Virulence of Vibrio vulnificus: association with utilization of transferrin-bound iron, and lack of correlation with levels of cytotoxin or protease production. FEMS Microbiol. Lett. 40:55-59.
  50. 26
  51. Motes, M. L., A. DePaola, D. W. Cook, J. E. Veazey, J. C. Hunsucker, W. E. Garthright, R. J. Bladgett, and S. Chirtel. 1998. Influence on water temperature and salinity on Vibrio vulnificus in Northern Gulf and Atlantic Coast oysters (Crassostrea virginica). Appl. Environ. Microbiol. 64:1459-1465.[Abstract/Free Full Text]
  52. 27
  53. Oliver, J. D. 1989. Vibrio vulnificus, p. 596-600. In M. P. Doyle (ed.), Food-borne bacterial pathogens. Marcel Dekker, Inc., New York, N.Y.
  54. 28
  55. Oliver, J. D. 2000. Problems in detecting dormant (VBNC) cells and the role of DNA elements in this response, p. 1-15. In J. K. Jansson, J. D. van Elsas, and M. J. Bailey (ed.), Tracking genetically-engineered microorganisms. Landes Biosciences, Georgetown, Tex.
  56. 29
  57. Oliver, J. D. 2000. The viable but nonculturable state and cellular resuscitation, p. 723-730. In C. R. Bell, M. Brylinsky, and P. Johnson-Green (ed.), Microbial biosystems: new frontiers. Atlantic Canada Society for Microbial Ecology, Halifax, Canada.
  58. 30
  59. Oliver, J. D. 2005. The viable but nonculturable state in bacteria. J. Microbiol. 43:93-100.[Medline]
  60. 31
  61. Oliver, J. D., F. Hite, D. McDougald, N. L. Andon, and L. M. Simpson. 1995. Entry into, and resuscitation from, the viable but nonculturable state by Vibrio vulnificus in an estuarine environment. Appl. Environ. Microbiol. 61:2624-2630.[Abstract]
  62. 32
  63. Oliver, J. D., and J. B. Kaper. 2001. Vibrio species, p. 263-300. In M. P. Doyle, L. R. Beuchat, and T. J. Montville (ed.), Food microbiology: fundamentals and frontiers, 2nd ed. ASM Press, Washington, D.C.
  64. 33
  65. Oliver, J. D., L. Nilsson, and S. Kjelleberg. 1991. The formation of nonculturable cells of Vibrio vulnificus and its relationship to the starvation state. Appl. Environ. Microbiol. 57:2640-2644.[Abstract/Free Full Text]
  66. 34
  67. Oliver, J. D., and R. Bockian. 1995. In vivo resuscitation, and virulence towards mice, of viable but nonculturable cells of Vibrio vulnificus. Appl. Environ. Microbiol. 61:2620-2623.[Abstract]
  68. 35
  69. O'Neill, K. R., S. H. Jones, and D. J. Grimes. 1992. Seasonal incidence of Vibrio vulnificus in the Great Bay estuary of New Hampshire and Maine. Appl. Environ. Microbiol. 58:3257-3262.[Abstract/Free Full Text]
  70. 36
  71. Pease, A. J., B. R. Boa, W. Luo, and M. E. Winkler. 2002. Positive growth rate-dependent regulation of the pdxA, ksgA, and pdxB genes of Escherichia coli K-12. J. Bacteriol. 184:1359-1369.[Abstract/Free Full Text]
  72. 37
  73. Porter, J., C. Edwards, and R. W. Pickup. 1995. Rapid assessment of physiological status in Escherichia coli using fluorescent probes. J. Appl. Bacteriol. 4:399-408.
  74. 38
  75. Randa, M. A., M. F. Polz, and E. Lim. 2004. Effects of temperature and salinity on Vibrio vulnificus population dynamics assessed by quantitative PCR. Appl. Environ. Microbiol. 70:5469-5476.[Abstract/Free Full Text]
  76. 39
  77. Rhee, J. H., C. M. Kim, S. E. Lee, Y. R. Kim, Y. S. Jin, and S. S. Chung. 2000. Cloning and molecular biological characterization of the catalase-peroxidase katG gene of Vibrio vulnificus, abstr. B-309, p. 112. Abstr. Annu. Meet. Am. Soc. Microbiol. 2000. American Society for Microbiology, Washington, D.C.
  78. 40
  79. Rosche, T. M., Y. Yano, and J. D. Oliver. 2005. A rapid and simple PCR analysis indicates there are two subgroups of Vibrio vulnificus which correlate with clinical or environmental isolation. Microbiol. Immunol. 49:381-389.[Medline]
  80. 41
  81. Roszak, D. B., and R. R. Colwell. 1987. Survival strategies of bacteria in the natural environment. Microbiol. Rev. 51:365-379.[Free Full Text]
  82. 42
  83. Saux, M. F.-L., D. Hervio-Heath, S. Loaec., R. R. Colwell, and M. Pommepuy. 2002. Detection of cytotoxin-hemolysin mRNA in nonculturable populations of environmental and clinical Vibrio vulnificus strains in artificial seawater. Appl. Environ. Microbiol. 68:5641-5646.[Abstract/Free Full Text]
  84. 43
  85. Sheridan, G. E. C., C. I. Masters, J. A. Shallcross, and B. M. Mackey. 1998. Detection of mRNA by reverse transcription-PCR as an indicator of viability in Escherichia coli cells. Appl. Environ. Microbiol. 64:1313-1318.[Abstract/Free Full Text]
  86. 44
  87. Simpson, L. M., and J. D. Oliver. 1987. Ability of Vibrio vulnificus to obtain iron from transferrin and other iron-binding proteins. Curr. Microbiol. 15:155-157.[CrossRef]
  88. 45
  89. Tamplin, M., G. E. Rodrick, N. J. Blake, and T. Cuba. 1982. Isolation and characterization of Vibrio vulnificus from two Florida estuaries. Appl. Environ. Microbiol. 44:1466-1470.[Abstract/Free Full Text]
  90. 46
  91. Tilton, R. C., and R. W. Ryan. 1987. Clinical and ecological characteristics of Vibrio vulnificus in the Northeastern United States. Diag. Microbiol. Infect. Dis. 6:109-117.[CrossRef][Medline]
  92. 47
  93. Vanoy, R. W., M. L. Tamplin, and J. R. Schwarz. 1992. Ecology of Vibrio vulnificus in Galveston Bay oysters, suspended particulate matter, sediment and seawater: detection by monoclonal antibody-immunoassay-most probable number procedures. J. Ind. Microbiol. 9:219-223.
  94. 48
  95. Veenstra, J., P. J. G. M. Rietra, J. M. Coster, E. Slaats, and S. Dirks-Go. 1994. Seasonal variations in the occurrence of Vibrio vulnificus along the Dutch coast. Epidemiol. Infect. 112:285-290.[Medline]
  96. 49
  97. Whitesides, M. D., and J. D. Oliver. 1997. Resuscitation of Vibrio vulnificus from the viable but nonculturable state. Appl. Environ. Microbiol. 63:1002-1005.[Abstract]
  98. 50
  99. Wolf, P., and J. D. Oliver. 1992. Temperature effects on the viable but nonculturable state of Vibrio vulnificus. FEMS Microbiol. Ecol. 101:33-39.[CrossRef]
  100. 51
  101. Wright, A. C., J. L. Powell, M. K. Tanner, A. Enson, A. B. Karpus, J. G. Morris, Jr., and M. B. Sztein. 1999. Differential expression of Vibrio vulnificus capsular polysaccharide. Infect. Immun. 67:2250-2257.[Abstract/Free Full Text]
  102. 52
  103. Wright, A. C., L. M. Simpson, and J. D. Oliver. 1981. Role of iron in the pathogenesis of Vibrio vulnificus infections. Infect. Immun. 34:503-507.[Abstract/Free Full Text]
  104. 53
  105. Wright, A. C., J. L. Powell, J. B. Kaper, and G. Morris, Jr. 2001. Identification of a group 1-like capsular polysaccharide operon for Vibrio vulnificus. Infect. Immun. 69:6893-6901.[Abstract/Free Full Text]
  106. 54
  107. Yaron, S., and K. Matthews. 2002. A reverse transcriptase-polymerase chain reaction assay for detection of viable Escherichia coli O157:H7: investigation of specific target genes. J. Appl. Microbiol. 92:633-640.[CrossRef][Medline]


Applied and Environmental Microbiology, February 2006, p. 1445-1451, Vol. 72, No. 2
0099-2240/06/$08.00+0     doi:10.1128/AEM.72.2.1445-1451.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Quiros, C., Herrero, M., Garcia, L. A., Diaz, M. (2009). Quantitative Approach to Determining the Contribution of Viable-but-Nonculturable Subpopulations to Malolactic Fermentation Processes. Appl. Environ. Microbiol. 75: 2977-2981 [Abstract] [Full Text]  
  • Jones, M. K., Warner, E., Oliver, J. D. (2008). Survival of and In Situ Gene Expression by Vibrio vulnificus at Varying Salinities in Estuarine Environments. Appl. Environ. Microbiol. 74: 182-187 [Abstract] [Full Text]  
  • Coutard, F., Lozach, S., Pommepuy, M., Hervio-Heath, D. (2007). Real-Time Reverse Transcription-PCR for Transcriptional Expression Analysis of Virulence and Housekeeping Genes in Viable but Nonculturable Vibrio parahaemolyticus after Recovery of Culturability. Appl. Environ. Microbiol. 73: 5183-5189 [Abstract] [Full Text]  
  • Hilton, T., Rosche, T., Froelich, B., Smith, B., Oliver, J. (2006). Capsular Polysaccharide Phase Variation in Vibrio vulnificus. Appl. Environ. Microbiol. 72: 6986-6993 [Abstract] [Full Text]  
  • Vattakaven, T., Bond, P., Bradley, G., Munn, C. B. (2006). Differential Effects of Temperature and Starvation on Induction of the Viable-but-Nonculturable State in the Coral Pathogens Vibrio shiloi and Vibrio tasmaniensis.. Appl. Environ. Microbiol. 72: 6508-6513 [Abstract] [Full Text]  
  • Thompson, F. L., Klose, K. E., the AVIB Group, (2006). Vibrio2005: the First International Conference on the Biology of Vibrios. J. Bacteriol. 188: 4592-4596 [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, B.
Right arrow Articles by Oliver, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, B.
Right arrow Articles by Oliver, J. D.
Agricola
Right arrow Articles by Smith, B.
Right arrow Articles by Oliver, J. D.