Previous Article | Next Article 
Applied and Environmental Microbiology, February 2006, p. 1696-1699, Vol. 72, No. 2
0099-2240/06/$08.00+0 doi:10.1128/AEM.72.2.1696-1699.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Probing In Vivo Promoter Activities in Mycoplasma pneumoniae: a System for Generation of Single-Copy Reporter Constructs
Sven Halbedel and
Jörg Stülke*
Department of General Microbiology, Institute of Microbiology and Genetics, Georg-August University Göttingen, Grisebachstr. 8, D-37077 Göttingen, Germany
Received 12 September 2005/
Accepted 8 December 2005
 |
ABSTRACT
|
|---|
The nucleotide sequences that control transcription initiation and regulation in Mycoplasma pneumoniae are poorly understood. In this work, we developed a lacZ-based reporter plasmid that can be used to integrate fusions of promoter fragments to a promoterless lacZ gene into the chromosome of M. pneumoniae.
 |
INTRODUCTION
|
|---|
Mycoplasma pneumoniae is a human pathogen. The bacteria live on mucosal surfaces of the respiratory tract and cause diseases such as mild pneumonia and tracheobronchitis. In addition, some nonrespiratory complications affecting the skin, mucosa, the central nervous system, the heart, and other organs were reported (14, 18, 24). During the last few years, M. pneumoniae and related cell wall-less bacteria of the class Mollicutes have attracted considerable scientific interest since these bacteria possess one of the smallest genomes of any free-living organism known so far (9). The minimal genetic complement of M. pneumoniae and its close relative, M. genitalium, has prompted studies to identify the essential gene set required for independent life (5, 10). Moreover, the molecular details of the interaction of M. pneumoniae with the host tissues that lead to pathogenesis are far from being understood. Similarly, not much is known about gene expression in M. pneumoniae. A few global studies of gene expression in M. pneumoniae have been reported (15, 21, 23, 28). In good agreement with the life of M. pneumoniae in a rather constant environment is the small number of regulatory proteins encoded by the genomes of these bacteria. While the transcription of some individual genes was studied in M. pneumoniae (1, 6, 11, 12, 27), nothing is known of regulatory mechanisms in these bacteria.
The molecular analysis of M. pneumoniae has been hampered by three problems. First, the genes of M. pneumoniae and related mollicutes use the UGA opal codon to incorporate tryptophan rather than as a stop codon as in the universal genetic code. This makes it difficult to express proteins from Mycoplasma spp. in heterologous hosts in order to make them available for biochemical analysis (3, 13). Recently, a method for the simultaneous replacement of multiple opal codons was developed and used for the expression of M. pneumoniae glycerol kinase in Escherichia coli (7). A second major problem is the lack of genetic systems that allow the efficient targeted generation of M. pneumoniae mutants. Therefore, genetic research with these bacteria depends on the use of mutant strains that have been isolated in conventional screens or even by chance (26, 29). Finally, transcription in M. pneumoniae can so far be studied by only RNA-based methods, such as transcriptome analyses, Northern blotting, reverse transcriptase PCR, or primer extension for the determination of 5' ends of transcripts (1, 6, 11, 12, 25, 27, 28). The molecular analysis of transcription regulatory mechanisms has so far not been possible due to the lack of appropriate reporter systems that can be used to study the activity of promoter fragments and their mutant derivatives in vivo. In this study, we report a system for the generation of fusions of M. pneumoniae promoters to a promoterless lacZ gene that can be integrated into the M. pneumoniae chromosome.
 |
Construction of the M. pneumoniae reporter system.
|
|---|
Since no genetic system allowing the targeted integration of DNA fragments into the M. pneumoniae chromosome is available, we made use of a derivative of Tn4001 (8), which lacks the transposase gene (mini-Tn4001). The mini-Tn4001 used here contains an origin of replication that functions in E. coli but not in M. pneumoniae and a aac-aphD gentamicin resistance gene which can be used to select for gentamicin or kanamycin resistance in M. pneumoniae or E. coli, respectively (22). Tn4001 is known to insert randomly into the chromosome of M. pneumoniae (10). The mini-Tn4001, together with the tnp gene encoding transposase, was present on plasmid pMT85 (30). As the reporter, we selected the lacZ gene of E. coli encoding ß-galactosidase, which is one of the most popular reporter enzymes, due to the possibility of getting a quick qualitative impression of the enzymatic activity in colonies using plates containing X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside), and the quantitative assay using o-nitrophenyl-ß-D-galactopyranoside as the chromogenic substrate (20). In addition, lacZ-based reporter systems were already established in other mollicutes, such as Acholeplasma oculi, Mycoplasma pulmonis, Mycoplasma arthritidis, and Mycoplasma capricolum (4, 16, 17). To facilitate cloning of the promoter fragments and their detection in E. coli, we made use of a lacZ gene devoid of a ribosomal binding site. With such a reporter, a Shine-Dalgarno sequence must be provided with the cloned promoter fragment to obtain a functional lacZ fusion. These requirements are met by the lacZ gene present in plasmid pAC5 (19). The lacZ gene of pAC5 was amplified using the primers SH44 (5' TATTTAAGTACTATAATAAGGGTAACTATTGCCG) and SH45 (5' GAACTAGTACATAATGGATTTCCTTAC). The resulting fragment was digested with BcuI and ScaI (these sites were introduced upon PCR and are underlined in the primer sequences) and cloned between the BcuI and OliI sites of pMT85. The resulting plasmid was pGP353 (Fig. 1).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1. Map of plasmid pGP353. The plasmid was constructed as described in the text. Abbreviations: IR, inverted repeats; tnp, transposase gene; aac-aphD, gentamicin/kanamycin resistance gene; lacZ, ß-galactosidase; ori colE1, gram-negative origin of replication. Restriction sites that were available for the construction of translational promoter lacZ fusions and the BcuI site used to construct pGP353 are indicated.
|
|
 |
Construction and analysis of an ldh-lacZ fusion.
|
|---|
We are interested in carbon metabolism in M. pneumoniae and its regulation. These bacteria catabolize a few sugars such as glucose, fructose, and glycerol via glycolysis but lack a citric acid cycle (6, 9). The NADH+ formed in glycolysis can be reoxidized by the formation of lactate from pyruvate. The ldh gene (MPN674) encoding lactate dehydrogenase is one of the few genes in M. pneumoniae which is transcribed in the opposite direction relative to the genes located up- and downstream. This suggests that ldh is transcribed monocistronically with a promoter upstream of the gene. Indeed, a primer extension assay revealed the presence of a promoter similar to the consensus sequence of the single M. pneumoniae
factor (our unpublished results; 27). To fuse the ldh promoter region to the promoterless lacZ gene present in pGP353, the region from 160 to +81 relative to the ldh transcription start point was amplified using the oligonucleotides SH46 (5' AGAATTCAAACTGCATCGTGGTATCTG) and SH47 (5' TAGGATCCGCGTAGAGAAAGCTGGTGC) and cloned between the EcoRI and BamHI sites of pGP353 (these sites are underlined in the primer sequences). In the resulting plasmid pGP354 (see Fig. 2), the lacZ gene was fused in frame to the 21st codon of the lactate dehydrogenase gene. The promoter fragment present in pGP354 contains two internal HindIII sites. These sites were used to delete the promoter resulting in plasmid pGP364 (see Fig. 2).

View larger version (6K):
[in this window]
[in a new window]
|
FIG. 2. Scheme of the ldh promoter fragments of M. pneumoniae that have been used for the construction of pGP354 and pGP364. Putative 10 and 35-boxes of the ldh gene (MPN674) and the MPN673 gene (conserved hypothetical gene) are indicated (27). Numbering is relative to the transcriptional start point of the ldh gene.
|
|
The plasmids pGP353, pGP354, and pGP364 were used to electroporate M. pneumoniae M129 according to the protocol described previously (2). Transformants were selected on plates containing gentamicin with or without X-Gal. On X-Gal-containing plates, all transformants that were obtained with pGP354 formed blue colonies, whereas transformants that were obtained with pGP353 and pGP364 formed white colonies (see Fig. 3A). This was the first indication that the promoter fragment was present in the original fragment and that promoter activity was lost upon deletion of the internal HindIII fragment. To be unbiased in the further analysis, five colonies of each transformation were reisolated from plates that did not contain X-Gal. These colonies were cultivated in order to obtain DNA for the verification of the presence of the fusion in the M. pneumoniae cells and to prepare cell extracts for the quantitative determination of ß-galactosidase activity. As shown in Fig. 4, the presence of all three fusions was demonstrated and the M. pneumoniae strains were designated GPM53, GPM54, and GPM64 (transformations with pGP353, pGP354, and pGP364, respectively). To eliminate positional effects of transposon integration at random sites in the chromosome, five individual clones per plasmid were chosen and their ß-galactosidase activities were determined (20) in cell extracts that were prepared as described previously (6). These individual clones were designated GPM53/1 through GPM53/5. As shown in Fig. 3B, no ß-galactosidase was detectable in the five GPM53 clones. This confirms that the "empty" reporter cloning vector does not confer any expression of the promoterless lacZ gene. In contrast, a high activity was observed in all GPM54 clones containing the ldh promoter and Shine-Dalgarno sequence upstream of the lacZ gene. This finding demonstrates that the E. coli lacZ gene can be efficiently translated in M. pneumoniae. In the M. pneumoniae GPM64 clones, the core of the ldh promoter is deleted from the fragment upstream of lacZ. This resulted in a 7.5-fold reduction of ß-galactosidase activity compared to that for the GPM54 clones containing the complete promoter fragment. Even though the transposons inserted at different positions, the ß-galactosidase activities driven by the two DNA fragments were quite consistent as indicated by the standard deviations.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3. ß-Galactosidase activity of the promoterless lacZ gene and two different ldh-lacZ fusions in M. pneumoniae. (A) Single colonies of M. pneumoniae after transformation with pGP353, pGP354, or pGP364 on M. pneumoniae agar plates containing 150 µg/ml X-Gal and 80 µg/ml gentamicin. (B) ß-Galactosidase activity in crude extracts of M. pneumoniae that had been transformed with either pGP353, pGP354, or pGP364. Cultures were grown in 10 ml of modified Hayflick medium with 80 µg/ml gentamicin for 7 days at 37°C and assayed for ß-galactosidase activity. ß-Galactosidase activities were determined at 28°C for five individual clones (GPM53/1 through GPM53/5) that were obtained for each plasmid, and average values are shown as bars. Error bars indicate standard deviations.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 4. Agarose gel electrophoresis to confirm the presence of the promoterless lacZ gene in strain GPM53/1 (lane 1) and of the ldh-lacZ fusions of pGP354 and pGP364 in strains GPM54/1 (lane 3) and GPM64/1 (lane 5) by colony PCR. Oligonucleotides for the detection of the promoterless lacZ gene in strain GPM53/1 were SH44 and SH45; for the detection of the ldh promoter lacZ fusions in strains GPM54/1 and GPM64/1, the oligonucleotides SH45 and SH46 were used. PCRs with the plasmid pGP353 (lane 2), pGP354 (lane 4), or pGP364 (lane 6) as template using the respective oligonucleotides served as controls. The colony PCR was performed with all five individual clones from each transformation and gave the same results as those shown here.
|
|
This study demonstrates that lacZ fusions can be a useful tool for the analysis of promoter fragments of M. pneumoniae genes in vivo. They will help to study regulatory events at the molecular level using promoter mutants. Moreover, the blue-white screen can be helpful in the isolation of trans-acting transposon mutants that affect the expression of the gene of interest.
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to Richard Herrmann for the generous gift of plasmid pMT85 and to Julia Busse for excellent technical assistance. Stephan Seiler is acknowledged for his help with photographing of Mycoplasma colonies.
This work was supported by the Fonds der Chemischen Industrie. S.H. was supported by a personal grant from the Fonds der Chemischen Industrie.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Department of General Microbiology, Institute of Microbiology and Genetics, Georg-August University Göttingen, Grisebachstr. 8, D-37077 Göttingen, Germany. Phone: 49-551-393781. Fax: 49-551-393808. E-mail: jstuelk{at}gwdg.de. 
 |
REFERENCES
|
|---|
- Benders, G. A., B. C. Powell, and C. A. Hutchison III. 2005. Transcriptional analysis of the conserved ftsZ gene cluster in Mycoplasma genitalium and Mycoplasma pneumoniae. J. Bacteriol. 187:4542-4551.[Abstract/Free Full Text]
- Catrein, I., R. Dumke, J. Weiner III, E. Jacobs, and R. Herrmann. 2004. Cross-complementation between the products of the genes P1 and ORF6 of Mycoplasma pneumoniae subtypes 1 and 2. Microbiology 150:3989-4000.[Abstract/Free Full Text]
- Chaudhry, R., N. Nisar, B. Hora, S. Reddy, and P. Malhotra. 2004. Expression and immunological characterization of carboxy terminal region of P1 adhesin protein of Mycoplasma pneumoniae. J. Clin. Microbiol. 43:321-325.
- Dybvig, K., C. T. French, and L. L. Voelker. 2000. Construction and use of derivatives of transposon Tn4001 that function in Mycoplasma pulmonis and Mycoplasma arthritidis. J. Bacteriol. 182:4343-4347.[Abstract/Free Full Text]
- Gil, R., F. J. Silva, J. Peretó, and A. Moya. 2004. Determination of the core of a minimal bacterial gene set. Microbiol. Mol. Biol. Rev. 68:518-537.[Abstract/Free Full Text]
- Halbedel, S., C. Hames, and J. Stülke. 2004. In vivo activity of enzymatic and regulatory components of the phosphoenolpyruvate:sugar phosphotransferase system in Mycoplasma pneumoniae. J. Bacteriol. 186:7936-7943.[Abstract/Free Full Text]
- Hames, C., S. Halbedel, O. Schilling, and J. Stülke. 2005. MMR: a method for the simultaneous introduction of multiple mutations into the glpK gene of Mycoplasma pneumoniae. Appl. Environ. Microbiol. 71:4097-4100.[Abstract/Free Full Text]
- Hedreyda, C. T., K. K. Lee, and D. C. Krause. 1993. Transformation of Mycoplasma pneumoniae with Tn4001 by electroporation. Plasmid 30:170-175.[CrossRef][Medline]
- Himmelreich, R., H. Hilbert, H. Plagens, E. Pirkl, B.-C. Li, and R. Herrmann. 1996. Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24:4420-4449.[Abstract/Free Full Text]
- Hutchison, C. A., III, S. C. Peterson, S. R. Gill, R. T. Cline, O. White, C. M. Fraser, H. O. Smith, and J. C. Venter. 1999. Global transposon mutagenesis and a minimal Mycoplasma genome. Science 286:2165-2169.[Abstract/Free Full Text]
- Hyman, H. C., R. Gafny, G. Glaser, and S. Razin. 1988. Promoter of the Mycoplasma pneumoniae rRNA operon. J. Bacteriol. 170:3262-3268.[Abstract/Free Full Text]
- Inamine, J. M., S. Loechel, and P. C. Hu. 1988. Analysis of the nucleotide sequence of the P1 operon of Mycoplasma pneumoniae. Gene 73:175-183.[CrossRef][Medline]
- Inamine, J. M., K. C. Ho, S. Loechel, and P. C. Hu. 1990. Evidence that UGA is read as tryptophan codon rather than as a stop codon by Mycoplasma pneumoniae, Mycoplasma genitalium, and Mycoplasma gallisepticum. J. Bacteriol. 172:504-506.[Abstract/Free Full Text]
- Jacobs, E. 1997. Mycoplasma infections of the human respiratory tract. Wien. Klin. Wochenschr. 109:574-577.[Medline]
- Jaffe, J. D., H. C. Berg, and G. M. Church. 2004. Proteogenomic mapping as a complementary method to perform genome annotation. Proteomics 4:59-77.[CrossRef][Medline]
- Janis, C., C. Lartigue, J. Frey, H. Wróblewski, F. Thiaucourt, A. Blanchard, and P. Sirand-Pugnet. 2005. Versatile use of oriC plasmids for functional genomics of Mycoplasma capricolum subsp. capricolum. Appl. Environ. Microbiol. 71:2888-2893.[Abstract/Free Full Text]
- Knudtson, K. L., and F. C. Minion. 1994. Use of lac gene fusions in the analysis of Acholeplasma upstream gene regulatory sequences. J. Bacteriol. 176:2763-2766.[Abstract/Free Full Text]
- Lind, K. 1983. Manifestations and complications of Mycoplasma pneumoniae disease: a review. Yale J. Biol. Med. 56:461-468.[Medline]
- Martin-Verstraete, I., M. Débarbouillé, A. Klier, and G. Rapoport. 1992. Mutagenesis of the Bacillus subtilis "-12, -24" promoter of the levanase operon and evidence for the existence of an upstream activating sequence. J. Mol. Biol. 226:85-99.[CrossRef][Medline]
- Miller, J. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
- Regula, J. T., B. Ueberle, G. Boguth, A. Görg, M. Schnölzer, R. Herrmann, and R. Frank. 2000. Towards a two-dimensional proteome map of Mycoplasma pneumoniae. Electrophoresis 21:3765-3780.[CrossRef][Medline]
- Rouch, D. A., M. E. Byrne, Y. C. Kong, and R. A. Skurray. 1987. The aac-aphD gentamicin and kanamycin resistance determinant of Tn4001 from Staphylococcus aureus: expression and nucleotide sequence analysis. J. Gen. Microbiol. 133:3039-3052.[Medline]
- Ueberle, B., R. Frank, and R. Herrmann. 2002. The proteome of the bacterium Mycoplasma pneumoniae: comparing predicted open reading frames to identified gene products. Proteomics 2:754-764.[CrossRef][Medline]
- Waites, K. B., and D. F. Talkington. 2004. Mycoplasma pneumoniae and its role as human pathogen. Clin. Microbiol. Rev. 17:697-728.[Abstract/Free Full Text]
- Waldo, R. H., III, P. L. Popham, C. E. Romero-Arroyo, E. A. Mothershed, K. K. Lee, and D. C. Krause. 1999. Transcriptional analysis of the hmw gene cluster of Mycoplasma pneumoniae. J. Bacteriol. 181:4978-4985.[Abstract/Free Full Text]
- Waldo, R. H., III, J. L. Jordan, and D. C. Krause. 2005. Identification and complementation of a mutation associated with loss of Mycoplasma pneumoniae virulence-specific proteins B and C. J. Bacteriol. 187:747-751.[Abstract/Free Full Text]
- Weiner, J., III, R. Herrmann, and G. F. Browning. 2000. Transcription in Mycoplasma pneumoniae. Nucleic Acids Res. 28:4488-4496.[Abstract/Free Full Text]
- Weiner, J., III, C. U. Zimmerman, H. W. H. Göhlmann, and R. Herrmann. 2003. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res. 31:6306-6320.[Abstract/Free Full Text]
- Willby, M. J., and D. C. Krause. 2002. Characterization of a Mycoplasma pneumoniae hmw3 mutant: implications for attachment organelle assembly. J. Bacteriol. 184:3061-3068.[Abstract/Free Full Text]
- Zimmerman, C.-U., and R. Herrmann. 2005. Synthesis of a small, cysteine-rich, 29 amino acids long peptide in Mycoplasma pneumoniae. FEMS Microbiol. Lett. 253:315-321 [Online.] doi:10.1016/j.femsle.2005.09.054.[CrossRef][Medline]
Applied and Environmental Microbiology, February 2006, p. 1696-1699, Vol. 72, No. 2
0099-2240/06/$08.00+0 doi:10.1128/AEM.72.2.1696-1699.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Lluch-Senar, M., Vallmitjana, M., Querol, E., Pinol, J.
(2007). A new promoterless reporter vector reveals antisense transcription in Mycoplasma genitalium. Microbiology
153: 2743-2752
[Abstract]
[Full Text]