Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Olapade, O. A. Articles by McLellan, S. L. Search for Related Content PubMed PubMed Citation Articles by Olapade, O. A. Articles by McLellan, S. L. Agricola Articles by Olapade, O. A. Articles by McLellan, S. L.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, March 2006, p. 1932-1938, Vol. 72, No. 3
0099-2240/06/$08.00+0     doi:10.1128/AEM.72.3.1932-1938.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Microbial Communities and Fecal Indicator Bacteria Associated with Cladophora Mats on Beach Sites along Lake Michigan Shores

Ola A. Olapade, Morgan M. Depas, Erika T. Jensen, and Sandra L. McLellan^*

Great Lakes WATER Institute, University of Wisconsin—Milwaukee, Milwaukee, Wisconsin 53204

Received 30 September 2005/ Accepted 3 January 2006

Top Abstract Introduction Materials and Methods Results Discussion References

 
A high biomasses of Cladophora, a filamentous green alga, is found mainly during the summer along the shores of Lake Michigan. In this study, the abundance and persistence of the fecal indicator bacterium Escherichia coli and sulfate-reducing bacteria (SRB) on Cladophora mats collected at Lake Michigan beaches were evaluated using both culture-based and molecular analyses. Additionally, 16S rRNA gene cloning and sequencing were used to examine the bacterial community composition. Overall, E. coli was detected in all 63 samples obtained from 11 sites, and the average levels at most beaches ranged from 2,700 CFU/100 g (wet weight) of Cladophora to 7,500 CFU/100 g of Cladophora. However, three beaches were found to have site average E. coli densities of 12,800, 21,130, and 27,950 CFU/100 g of Cladophora. The E. coli levels in the lake water collected at the same time from these three sites were less than the recommended U.S. Environmental Protection Agency limit, 235 CFU/100 ml. E. coli also persisted on Cladophora mats in microcosms at room temperature for more than 7 days, and in some experiments it persisted for as long as 28 days. The SRB densities on Cladophora mats were relatively high, ranging from 4.4 x 10⁶ cells/g (6.64 log CFU/g) to 5.73 x 10⁶ cells/g (6.76 log CFU/g) and accounting for between 20% and 27% of the total bacterial counts. Partial sequences of the 16S rRNA gene clones revealed a phylogenetically diverse community, in which the Cytophaga-Flavobacterium-Bacteroides cluster and the low-G+C-content gram-positive bacteria were the dominant organisms, accounting for 40% and 12.8%, respectively, of the total clone library. These results further reveal the potential public health and ecological significance of Cladophora mats that are commonly found along the shoreline of Lake Michigan, especially with regard to the potential to harbor microorganisms associated with fecal pollution and odor-causing bacteria.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cladophora spp. are filamentous green algae that commonly grow attached to hard substrates in the littoral zone of freshwater environments and are widely distributed throughout the Laurentian Great Lakes (7, 8, 11). The excessive growth of algae in the Great Lakes was previously linked to increases in phosphorus levels that resulted primarily from urban sewage inflow and agricultural runoff (21, 39). However, despite the fact that the external phosphorus load has decreased in the Great Lakes in recent years (4, 40), there has been a resurgence of Cladophora growth in the nearshore zone (13).

The occurrence of Cladophora in nearshore Lake Michigan habitats may have significant public health and ecological importance (18, 43) and could also potentially decrease recreational activities on beaches. There is evidence that the algae provide food and shelter for epiphytes, invertebrates, and small fish (7, 33, 40, 43) and could provide a niche for pathogenic bacteria from gull droppings, sewage overflow, or runoff from urban and agricultural sources (14, 43). The presence of Cladophora has been associated with high levels of Escherichia coli and enterococcal bacteria in beach sand and swimming waters of the Great Lakes (18, 43), which may diminish the relationship between indicator organisms and actual pollution and potentially complicate beach-monitoring efforts.

Cladophora mats that become stranded on beaches produce a noxious odor as the organic material decays. It has been suggested that activities of sulfate-reducing bacterial (SRB) populations on algae play a dominant role in the anaerobic processes in aquatic environments (15, 16), accounting for about 50% of the biomineralization of organic matter (17, 31). In general, the abundance and activities of SRB have been observed to increase with an increase in the supply of organic nutrients (34, 41). Sulfate-reducing bacteria belonging to the subdivision of the Proteobacteria have been shown to account for significant portions of bacterial populations on microbial mats in lakes (34, 35). In a study of Lake Cadagno (Switzerland), Tonolla et al. (35) found that 24% of the 4',6'-diamidino-2-phenylindole (DAPI)-stained cells were sulfate reducers by using fluorescent in situ hybridization, which corroborated the results of previous studies that documented the dominance of these bacterial groups in freshwater systems (12, 25).

Although the public health and ecological importance of microbial communities on Cladophora mats in freshwater environments have been documented, the structure and composition of such communities remain largely uncharacterized. Therefore, in this study, we employed both culture-based and molecular analyses to examine and characterize microbial communities associated with Cladophora mats collected along the shoreline of Lake Michigan. The primary objective of our study was to determine the abundance and persistence of the fecal indicator bacterium E. coli and the SRB phylogenetic group on Cladophora mats. Additionally, this study was also designed to examine the compositions of microbial communities associated with Cladophora mats using 16S rRNA gene sequencing.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Site description.
Cladophora was collected at 11 beach sites in Wisconsin along the western shore of Lake Michigan to determine the prevalence of E. coli on stranded mats (Fig. 1). The sites were predominately in highly urbanized areas (McKinley and Bradford) and suburban areas (Atwater, Big Bay, and Doctors Park), but they also included sites located in an agricultural watershed (Fischer Beach) and in less developed communities (Portage Park).

View larger version (27K): [in this window] [in a new window]

FIG. 1. Map of counties along Lake Michigan where Cladophora mats and water samples were collected from beaches from July to November 2004 and from June to September 2005.

Three of the beach sites in Milwaukee County (Fig. 1) chosen for Cladophora collection were used in microcosm studies and for characterization of the microbial community by sequencing of the 16S rRNA gene. McKinley Beach is located immediately north of Milwaukee Harbor and is characterized by a steep littoral zone and a relatively deep (3 to 4 m) benthic zone 30 m from shore. Bradford Beach is located 2 km north of McKinley Beach and, in general, experiences a higher occurrence of Cladophora strandings than McKinley Beach. Bradford Beach has a low sloping littoral zone and shallow benthic zone (<2 m) that extends 400 m from the shore. At both McKinley Beach and Bradford Beach there are multiple sources of fecal pollution, including stormwater discharged directly into beach areas and high numbers of ring-billed gulls (Larus delawarensis). Atwater Beach is located approximately 5 km north of Bradford Beach and is the beach that is least affected by pollution sources. The littoral zone is similar to that at Bradford Beach, and the benthic zone is 3 m deep within 100 m from the shore. Two jetties flank the beach site and act as catchments for Cladophora, potentially increasing the residence time of Cladophora stranded at the shoreline.

Sample collection.
Cladophora samples were collected on 10 sampling days from July through November 2004 and on six sampling days from June through September 2005 to determine the prevalence of E. coli on stranded mats along the shores of Lake Michigan. In all, 63 samples were collected at 11 beach sites. Cladophora mats were obtained from the waterline at each beach site and placed in sterile Whirl-Pak bags. At Bradford Beach, McKinley Beach, and Atwater Beach, the three beach sites used for microcosm studies, as well as several other beach sites, water samples were also collected using a 1-liter grab sampler and transferred to autoclaved sample bottles. Both the Cladophora mats and matching water samples were placed on ice and taken immediately to the laboratory, where they were stored at 4°C until they were analyzed.

Enumeration of E. coli on Cladophora mats from beaches.
E. coli densities on the Cladophora mats and in the matching water samples were determined by membrane filtration using a U.S. Environmental Protection Agency (USEPA) modified method (36). For Cladophora samples, 50 g of algal material was placed in a sterile 1-liter beaker with 600 ml of 0.85% sterile saline and vigorously stirred for 10 min to elute the bacteria from the mats. Then 1 and 10 ml of the supernatant were removed for membrane filtration; for samples in which colonies were too numerous to count, 1 ml of a 1:10 or 1:100 dilution was used. For analysis of water samples, 10 ml and 100 ml were filtered through 0.45-µm nitrocellulose membrane filters, placed on modified m-TEC medium (BD Diagnostics, Sparks, MD), and incubated at 44.5°C overnight. Colonies that exhibited ß-glucuronidase activity, as indicated by a purple color, were counted as E. coli colonies.

Determination of bacterial abundance and persistence on Cladophora mats in microcosm studies.
Microcosm experiments were carried out with freshly collected Cladophora mats to specifically evaluate the persistence of E. coli, sulfate-reducing bacterial, and total bacterial populations in microbial communities in the mats. Approximately 100-g (wet weight) portions of mats were placed in sterile beakers along with 800 ml of lake water collected at the site. Matching water samples that contained no Cladophora were analyzed concurrently to examine the persistence of E. coli over time. The beakers were kept in the dark at room temperature to reduce or prevent photosynthetic activity. Subsamples were collected and examined for the presence of different bacterial populations. For E. coli, microcosms were vigorously stirred, and aliquots were analyzed as described above. Approximately 1 g of algal mat from each sampling site was weighed and added to 5 ml of sterile deionized water. Bacterial cells on the Cladophora mats were detached by sonication (model 2210 sonicator; Branson, Danbury, CT) at 40 kHz for 5 min in 30 ml of 0.1% tetrasodium pyrophosphate (Na₄P₂O₇ · 10H₂O) before total bacteria and SRB were counted as described below.

DAPI staining.
The total number of bacteria was determined by concentrating samples under a 15-kPa vacuum onto 0.2-µm-pore-size, black polycarbonate filters (GE Osmonics, Minnetonka, MN), which were stained with 200 µl of 15-µg/µl DAPI for 3 min, rinsed with sterile water, and mounted on glass slides with type FF immersion oil (28). Cells in 10 fields were counted using epifluorescence microscopy (model BX60 microscope; Olympus, Melville, NY).

Fluorescent in situ hybridization.
The abundance of SRB on the Cladophora mats was determined using fluorescent in situ hybridization as described by Manz et al. (20) and Olapade and Leff (23). SRB populations were detected using the SRB385 probe designed to specifically target the subdivision of the Proteobacteria, as described by Amann et al. (2), which is the phylogenetic group containing most sulfur-reducing bacteria (6, 31, 35); however, this probe also hybridizes with several gram-positive bacteria, such as Clostridium (30). Briefly, samples were concentrated onto 0.2-µm-pore-size polycarbonate filters, rinsed with deionized water, and treated with 1 ml of 0.1% Nonidet P-40 (Sigma-Aldrich, St. Louis, MO). The filters were placed in petri plates and treated with 40 µl of the Texas Red-labeled probe, which was used at a concentration of 5 ng/µl in hybridization buffer consisting of 6x SSC, 0.02 M TRIZMA base (pH 7.0), 0.1% sodium dodecyl sulfate, and 0.01% poly(A) (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate). The filters and probe were incubated at 53°C for 4 h. The sequence of the SRB385 probe was 5'CGGCGTCGCTGCGTCAGG3' (Sigma Genosys, The Woodlands, TX). After incubation, the filters were washed twice with 400 µl of wash buffer, incubated with 80 µl of wash buffer for 10 min at the hybridization temperature, and then rinsed twice with 400 µl sterile deionized water. Cells that hybridized to the SRB385 probe were enumerated using epifluorescence microscopy by counting between 50 and 100 fields on duplicate slides.

DNA extraction and PCR amplification.
Total DNA was extracted from the Cladophora samples in microcosm studies using a QIAamp DNA extraction kit, as described by the manufacturer (QIAGEN, Valencia, CA). DNA was extracted from multiple beakers representing the three beach sites at the start of the experiments. DNA was eluted in 75 µl of sterile, deionized water before the concentration was determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). Bacterial DNA in a sample was amplified by PCR by targeting the (approximately) full-length 16S rRNA gene with the universal bacterial primers 8F (5'AGAGTTTGATCCTGGCTCAG3') and 1492R (5' GGTTACCTTGTTACGACTT 3') (Sigma Genosys, The Woodlands, TX). The PCR amplification protocol included DNA denaturation at 95°C for 1 min, annealing at 50°C for 1 min, and extension 72°C for 1 min for 30 cycles and a final extension for 5 min at 72°C, using a thermal cycler from MJ Research (Watertown, MA). The amplification products were evaluated on a 1.5% agarose gel. The PCR products were purified with a QIAquick PCR purification kit (QIAGEN, Valencia, CA) before they were utilized for cloning and sequencing assays.

Cloning and sequencing.
Clone libraries from 16S rRNA gene amplification were constructed using a TOPO TA cloning kit (Invitrogen, Carlsbad, CA). Plasmid DNA was isolated using a QIAGEN plasmid mini kit (QIAGEN, Valencia, CA). Sequencing of the 16S rRNA gene was performed with a CEQ 8000 automated sequencer, using the chain terminator technique with dye-labeled dideoxynucleotides, according to the manufacturer's instructions (Beckman Coulter, Fullerton, CA).

Phylogenetic analysis.
Approximately 200 clones from three 16S rRNA clone libraries were randomly chosen for sequencing. The sequences obtained were trimmed for quality before alignment, using the Vector NTI software (Invitrogen, Carlsbad, CA). Neighbor-joining trees were constructed using ClustalW with 1,000 bootstrap iterations and NJ plot (27). The clone sequences were compared with previously published GenBank sequences using the BLAST system (1) in order to determine close relatives.

Statistical analyses.
Statistical analyses were carried out using SPSS, version 10.01 (SPSS Inc., Chicago, IL). Differences between numbers of bacteria were determined by Student t test analysis after normalization of all data sets by log₁₀ transformation.

Nucleotide sequence accession numbers.
The partial 16S rRNA gene sequences have been deposited in the GenBank database under accession numbers DQ228212 to DQ228252.

Top Abstract Introduction Materials and Methods Results Discussion References

 
E. coli abundance on Cladophora mats and in water samples at beach sites.
The E. coli levels on the Cladophora mats collected from 11 beach sites far exceeded the USEPA threshold for E. coli in recreational water for more than 97% of the mats. The average E. coli level found on Cladophora mats at each site is shown in Table 1. The average values for several sites were between 2,700 and 7,500 CFU/100 g (wet weight) of Cladophora. However, E. coli levels that were almost 1 order of magnitude higher were detected at McKinley Beach (27,950 CFU/100 g of Cladophora), Bradford Beach (21,130 CFU/100 g of Cladophora), and Atwater Beach (12,800 CFU/100 g of Cladophora). The Cladophora mats from the Beach Drive site had the highest density of E. coli, more than 38,000 CFU/100 g; however, only one sample was collected at this site. Water samples (n = 29) collected from a subset of the beach sites contained levels of E. coli ranging from 0 to 6,900 CFU/100 ml. The E. coli levels in the majority of the samples (more than 87%) were below the recommended USEPA limit, 235 CFU/100 ml. Overall, the E. coli levels on the Cladophora mats were significantly higher than the levels in the adjacent water (P < 0.001).

View this table: [in this window] [in a new window]

TABLE 1. E. coli densities on Cladophora mats collected from beach sites on Lake Michigan

E. coli persistence on Cladophora mats in microcosm studies.
The results of microcosm studies demonstrated that the initial E. coli levels on the Cladophora mats (Fig. 2A) were higher than the levels in the matching water samples collected at the same beach sites (Fig. 2B). The E. coli levels on Cladophora mats in microcosms were similar for the first 4 days of the survival experiment, and slight decreases in density were observed on day 5. Also, it appeared that the persistence of E. coli on the Cladophora mats was similar for the three beach sites examined. For the lake water samples from the three sites, the E. coli levels decreased to levels below the detection level by day 4. These results indicate that E. coli populations could potentially survive on algal mats far longer than the 4- to 6 day die-off period observed in water samples containing no Cladophora.

View larger version (16K): [in this window] [in a new window]

FIG. 2. Numbers of E. coli (log transformed) on Cladophora mats (A) and in lake water samples (B) collected from beach sites (McKinley Beach, Bradford Beach, and Atwater Beach) along the Lake Michigan shore. The values are averages for replicate samples from each microcosm. The standard errors were less than 6% of the E. coli values for Cladophora samples and less than 10% of the E. coli values for water samples.

In experiments performed for 28 days a similar trend was observed; the E. coli concentrations in microcosms containing only lake water decreased from 240 CFU/100 ml to 20 CFU/100 ml within 4 days, but the E. coli densities in microcosms with water and Cladophora remained steady for the first 7 days, and this was followed by gradual decreases in the number of E. coli until day 28, when the E. coli levels were found to be approximately 10% of the original concentration.

Numbers of total and sulfate-reducing bacteria.
In general, the numbers of total and sulfate-reducing bacteria on the Cladophora mats in microcosms were fairly similar for the three sites (Fig. 3A and 3B). The numbers of sulfate-reducing bacteria that hybridized to the SRB385 probe on freshly collected Cladophora mats ranged from 4.4 x 10⁶ cells/g (6.64 log CFU/g) to 5.73 x 10⁶ cells/g (6.76 log CFU/g) and remained consistently high after 7 days in microcosms (Fig. 3B). The SRB in the microbial communities accounted for between 20% and 27% of the total bacteria at the three sites.

View larger version (17K): [in this window] [in a new window]

FIG. 3. Numbers of SRB (A) and percentages of DAPI-stained cells positive for the SRB385 probe (B) on Cladophora mats collected from McKinley Beach, Bradford Beach, and Atwater Beach in Wisconsin during survival studies conducted in microcosms. The values are averages for replicate samples from each microcosm.

Phylogenetic diversity of phylotypes on Cladophora mats.
Approximately 200 clone sequences were obtained from 16S rRNA gene libraries constructed from the microcosm experiment and used for phylogenetic analysis. The phylogenetic tree could be divided into seven clusters based on similarities to previously published sequences (Fig. 4). Clusters 1 and 2 consisted of bacteria belonging to the - and ß-Proteobacteria and accounted for 2.4% and 6.4% of the clone libraries (Table 2). Cluster 3 contained only three clones belonging to the -Proteobacteria, representing <1.0% of the clone libraries, while the subdivision of the Proteobacteria (cluster 4) accounted for 3.2% of the clone libraries. Clusters 5 and 6 accounted for 12.8% and 4.8% of the clone library and belonged to the low-G+C-content and high-G+C-content gram-positive bacteria, respectively. The largest cluster was the Cytophaga-Flavobacterium-Bacteroides (CFB) bacterial group, which accounted for about 40% of the total clone library.

View larger version (20K): [in this window] [in a new window]

FIG. 4. Phylogenetic consensus tree based on neighbor-joining analyses of partial 16S rRNA gene sequences, showing the representative clones of predominant bacterial taxa.

View this table: [in this window] [in a new window]

TABLE 2. Distribution of 200 cloned 16S rRNA gene sequences obtained from the epiphytic bacterial communities on Cladophora mats collected from three beach sites along Lake Michigan shores

Top Abstract Introduction Materials and Methods Results Discussion References

 
E. coli abundance and persistence on Cladophora mats.
Our findings revealed that E. coli was frequently present at extremely high densities on Cladophora mats stranded at the shoreline of beach sites and that the levels far exceeded the level that is acceptable for recreational water (37). The widespread occurrence at the 11 beach sites further supports the hypothesis that this might be common at Great Lakes beaches, as documented previously (43). Furthermore, microcosm experiments suggested that Cladophora prolongs the survival of E. coli. These findings highlight the public health significance of conditions that could prolong the survival of nonindigenous bacteria (18, 43), including pathogens that might be carried with fecal pollution. Both of the previous studies (18, 43) cautioned against the sole use of either E. coli or enteroccoci as indicators of the quality of recreational freshwater, since the origin of these organisms might be not only fecal but also associated with drifts of Cladophora mats that potentially serve as secondary habitats and therefore affect the water quality at affected Lake Michigan beaches.

Abundance and persistence of sulfate-reducing bacteria on Cladophora mats.
Quantitative analysis of the microbial communities on the Cladophora mats using the SRB385 fluorescently labeled probe indicated that the numbers of sulfate-reducing bacteria were relatively high, perhaps higher than the numbers based on results obtained from clone libraries. The obvious disparity between the two methodological approaches could be attributed to the comparatively low coverage of this phylogenetic group by the sequencing approach. Overall, the sizes of the populations of bacteria belonging to the SRB functional group in the microbial communities examined in our study fell in the range that was previously documented in similar studies (31, 34). In a study in which a traditional most-probable-number approach was used, Teske et al. (34) found an average of 4.5 x 10⁶ SRB cells/ml on the surface layer of cyanobacterial mats of Solar Lake (Sinai, Egypt). Also, Santegoeds et al. (31), using the same SRB385 probe that was used in our study, found an average of 64 x 10⁶ SRB cells/ml on the surface of a 2-week-old artificially constructed bacterial biofilm. Cross-hybridization of the SRB385 probe with non-SRB members of the community also should be considered, as this probe has been shown to detect gram-positive bacteria, such as Clostridium spp. (30). The occurrence of bacteria belonging to the SRB functional group on Cladophora mats examined in this study may further corroborate the well-documented alga-bacterium association found in previous studies, based in part on the reliance of heterotrophic bacterial populations on alga-released dissolved organic carbon in surface-associated microbial communities (10, 23).

Bacterial community composition on the Cladophora mats.
The cloned sequences obtained from the epiphytic bacterial communities on Cladophora mats belonged to various phylogenetic groups in the domain Bacteria, including the CFB cluster, the high- and low-G+C-content gram-positive bacteria, and the , ß, , and subdivisions of the Proteobacteria. Several of the clones used in this study were most closely related to sequences that were characterized as previously unclassified or uncultured bacteria based on sequences in the GenBank database, suggesting that a high number of phenotypically undescribed bacterial species were present in the community, as observed in other studies of bacterium-alga interactions (9).

The CFB phylogenetic group was the most abundant clone group obtained from the Cladophora mats, which corroborated the results of previous studies that documented that there were high levels of bacterial species belonging to the CFB cluster in similar alga-bacterium associations in aquatic systems (9, 42). In general, bacterial species belonging to the CFB cluster have been reported to account for a high percentage of biofilm bacteria in aquatic systems (24) because they possess unique phenotypic characteristics that enable them to attach to particles, exhibit surface-dependent gliding motility, and utilize various complex macromolecules (44). The high percentage of clones in this phylogenetic group perhaps reflects the active degradation of high-molecular-weight organic carbon (i.e., cellulose) and various other macromolecules on the Cladophora mats.

The relatively high numbers of bacteria belonging to the high-G+C-content gram-positive group in the microbial communities on the algal mats were not too surprising, despite the fact that this group usually occurs at fairly low levels in aquatic systems (3). We expected high levels of bacteria belonging to both the CFB cluster and the gram-positive bacteria in the microbial communities on the Cladophora mats, since both of these bacterial groups typically comprise species that can thrive under both the oxic and anoxic conditions (29) commonly found on cyanobacterial mats located in freshwater environments (34).

The four subdivisions of Proteobacteria (i.e., , ß, , and subdivisions) that were found in this study accounted for a relatively high proportion of the total cloned sequences in the microbial communities on the algal mats. Among these bacterial groups, bacteria belonging to the ß-Proteobacteria generally predominated; this finding is consistent with the results of previous studies that showed that there were high proportions of ß-Proteobacteria in aquatic biofilms (5, 22, 32). Although bacteria belonging to the -Proteobacteria accounted for the lowest proportion of sequences in our study, a high number of bacterial species with the ability to reduce sulfate belong to this subdivision and have been found previously in bacterial biofilms in other studies (31, 34).

Ecological and public health significance and future directions.
There has been increased emphasis on beach water quality in recent years by both the USEPA and the public health sector, and as a result, more beaches are being monitored for fecal pollution (38). Cladophora accumulation at the shoreline, a common occurrence at Great Lakes beach sites, might be a major complicating factor in assessing beach sites for fecal pollution. The potential for Cladophora mats to harbor pathogens, as well as indicator bacteria, warrants further study.

Typically, a person's initial perception of water quality is based entirely on the esthetic characteristics of the water and the surrounding environment (26). Decaying Cladophora emits a noxious odor which frequently can be mistaken for sewage contamination. The bacteria belonging to the CFB cluster in the microbial communities are most likely responsible for the majority of cell material breakdown on the algal mats and may produce the anoxic environment required for SRB, which are mainly obligate anaerobes (19). The metabolic activity of members of the SRB functional group, especially organisms belonging to the -Proteobacteria, may contribute the most to the noxious odor that is characteristic of the beach sites along Lake Michigan. Additionally, the presence of SRB on the Cladophora mats suggests that the availability of sulfate is high and that the sulfate is metabolized, releasing hydrogen sulfide gas, which has a characteristic pungent odor. There is a need for studies examining this and establishing a direct correlation between populations of bacteria belonging to the SRB group on Cladophora mats and hydrogen sulfide production in order to further understand the ecological importance of the mats.

 
This study was supported in part by a grant from the Wisconsin Coastal Management Program. We acknowledge support provided by the NIEHS Center for Marine and Freshwater Biomedical Sciences (NIH grant ES04184) for use of the microscopy facility.

We thank Meredith Van Dyke, Joshua Harris, Marcia Silva, and Pat Bower for their assistance with various laboratory assays and Kiara Caldwell for assistance with fieldwork. We also appreciate the contributions to the sequence analysis made by Giles Goetz. We especially thank Harvey Bootsma for providing expertise and discussions concerning Cladophora in the Great Lakes environment.

 
* Corresponding author. Mailing address: Great Lakes WATER Institute, University of Wisconsin—Milwaukee, 600 E. Greenfield Avenue, Milwaukee, WI 53204. Phone: (414) 382-1700. Fax: (414) 382-1705. E-mail: mclellan{at}uwm.edu.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
2
2. Amann, R. I., B. J. Binder, R. J. Olson, S. W. Chisholm, R. Devereux, and D. A. Stahl. 1990. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56:1919-1925.[Abstract/Free Full Text]
3
3. Araya, R., K. Tani, T. Takagi, N. Tamaguchi, and M. Nasu. 2003. Bacterial activity and community composition in stream water and biofilms from an urban river determined by fluorescent in situ hybridization and DGGE analysis. FEMS Microbiol. Ecol. 43:111-119.[CrossRef]
4
4. Barbiero, R. P., M. L. Tuchman, G. J. Warren, and D. C. Rockwell. 2002. Evidence of recovery from phosphorus enrichment in Lake Michigan. Can. J. Fish Aquat. Sci. 59:1639-1647.[CrossRef]
5
5. Brummer, I. H., W. Fehr, and I. Wagner-Dobler. 2000. Biofilm community structure in polluted rivers: abundance of dominant phylogenetic groups over a complete annual cycle. Appl. Environ. Microbiol. 66:3078-3082.[Abstract/Free Full Text]
6
6. Castro, H. F., N. H. Williams, and A. Ogram. 2000. Phylogeny of sulfate-reducing bacteria (1). FEMS Microbiol. Ecol. 31:1-9.[Medline]
7
7. Chilton, E. W., R. L. Lowe, and K. M. Schurr. 1986. Invertebrate communities associated with Bangia atropurpurea and Cladophora glomerata in western Lake Erie. J. Great Lakes Res. 12:149-153.
8
8. Dodds, W. K., and D. A. Gudder. 1992. The ecology of Cladophora. J. Phycol. 28:415-427.[CrossRef]
9
9. Fisher, M. M., L. W. Wilcox, and L. E. Graham. 1998. Molecular characterization of epiphytic bacterial communities on charophycean green algae. Appl. Environ. Microbiol. 64:4384-4389.[Abstract/Free Full Text]
10
10. Fogg, G. E. 1983. The ecological significance of extracellular products of phytoplankton photosythensis. Bot. Mar. 26:3-14.
11
11. Graham, L. E. 1982. Cytology, ultrastructure, taxonomy, and phylogenetic relationships of Great Lakes filamentous algae. J. Great Lakes Res. 8:54-60.
12
12. Guerrero, R., E. Montesinos, C. Pedros-Alio, I. Esteve, J. Mas, H. van Gemerden, P. A. G. Hofman, and J. F. Bakker. 1985. Phototropic sulfur bacteria in two Spanish lakes: vertical distribution and limiting factors. Limnol. Oceanogr. 30:919-931.
13
13. Hecky, R. E., R. E. H. Smith, D. R. Barton, S. J. Guildford, W. D. Taylor, M. N. Charlton, and T. Howell. 2004. The nearshore phosphorus shunt: a consequence of ecosystem engineering by dreissenids in the Laurentia Great Lakes. Can. J. Fish Aquat. Sci. 61:1285-1293.[CrossRef]
14
14. Islam, M. S., B. S. Drasar, and D. J. Bradley. 1989. Attachment of toxigenic Vibrio cholerae O1 to various freshwater plants and survival with filamentous green alga Rhizoclonium fontanum. J. Trop. Med. Hyg. 92:396-401.[Medline]
15
15. Jorgensen, B. B. 1982. Mineralization of organic matter in the sea bed—the role of sulphate reduction. Nature 296:642-645.[CrossRef]
16
16. Jorgensen, B. B. 1994. Sulfate reduction and thiosulfate transformations in a cyanobacterial mat during a diel oxygen cycle. FEMS Microbiol. Ecol. 13:303-312.
17
17. Jorgensen, B. B., and F. Bak. 1991. Pathways and microbiology of thiosulfate transformations and sulfate reduction in a marine sediment (Kattegat, Denmark). Appl. Environ. Microbiol. 57:847-856.[Abstract/Free Full Text]
18
18. Kinzelman, J., C. Ng, E. Jackson, S. Gradus, and R. Bagley. 2003. Enterococci as indicators of Lake Michigan recreational water quality: comparison of two methodologies and their impacts on public health regulatory events. Appl. Environ. Microbiol. 69:92-96.[Abstract/Free Full Text]
19
19. Madigan, M. T., and J. M. Martinko. 2006. Sulfate- and sulfur-reducing Proteobacteria, p. 371-373. In Brock biology of microorganisms, 11th ed. Pearson Prentice Hall, Upper Saddle River, N.J.
20
20. Manz, W., R. I. Amann, W. Ludwig, M. Wagner, and K.-H. Schleifer. 1992. Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst. Appl. Microbiol. 15:593-600.
21
21. Neil, J. H., and M. B. Jackson. 1982. Monitoring Cladophora growth conditions and the effect of phosphorus additions at a shoreline site in northeastern Lake Erie. J. Great Lakes Res. 8:30-34.
22
22. Olapade, O. A., and L. G. Leff. 2004. Seasonal dynamics of bacterial assemblages in epilithic biofilms in a northeastern Ohio stream. J. N. Am. Benthol. Soc. 23:686-700.[CrossRef]
23
23. Olapade, O. A., and L. G. Leff. 2005. Seasonal response of stream biofilm communities to dissolved organic matter and nutrient enrichments. Appl. Environ. Microbiol. 71:2278-2287.[Abstract/Free Full Text]
24
24. O'Sullivan, L. A., A. J. Weightman, and J. C. Fry. 2002. New degenerate Cytophaga-Flexibacter-Bacteroides-specific 16S ribosomal DNA-targeted oligonucleotide probes reveal high bacterial diversity in River Taff epilithon. Appl. Environ. Microbiol. 68:201-210.[Abstract/Free Full Text]
25
25. Overmann, J., T. Beatty, K. J. Hall, N. Pfennig, and T. G. Northcote. 1991. Characterization of a dense, purple sulfur bacterial layer in a meromictic lake. Limnol. Oceanogr. 36:846-859.
26
26. Pendleton, L., N. Martin, and D. G. Webster. 2001. Public perceptions of environmental quality: a survey study of beach use and perceptions in Los Angeles County. Mar. Pollut. Bull. 42:1155-1160.[CrossRef][Medline]
27
27. Perriere, G., and M. Gouy. 1996. WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 78:364-369.[Medline]
28
28. Porter, K. G., and Y. S. Feig. 1980. The use of DAPI for identifying and counting aquatic microflora. Limnol. Oceanogr. 25:943-948.
29
29. Prescott, L. M., J. P. Harley, and D. A. Klein. 1999. Microbiology, 4th ed. McGraw-Hill, New York, N.Y.
30
30. Ramsing, N. B., H. Fossing, T. G. Ferdelman, F. Andersen, and B. Thamdrup. 1996. Distribution of bacterial populations in a stratified fjord (Mariager Fjord, Denmark) quantified by in situ hybridization and related to chemical gradients in the water column. Appl. Environ. Microbiol. 62:1391-1404.[Abstract]
31
31. Santegoeds, C. M., T. G. Ferdelman, G. Muyzer, and D. de Beer. 1998. Structural and functional dynamics of sulfate-reducing populations in bacterial biofilms. Appl. Environ. Microbiol. 64:3731-3739.[Abstract/Free Full Text]
32
32. Simon, M., H. P. Grossart, B. Schwetzer, and H. Ploug. 2002. Microbial ecology of organic aggregates in aquatic systems. Aquat. Microb. Ecol. 28:175-211.
33
33. Stevenson, R. J., and E. F. Stoermer. 1982. Seasonal abundance patterns of diatoms on Cladophora in Lake Huron. J. Great Lakes Res. 8:169-183.
34
34. Teske, A., N. B. Ramsing, K. Habicht, M. Fukui, J. Kuver, B. B. Jorgensen, and Y. Cohen. 1998. Sulfate-reducing bacteria and their activities in cyanobacterial mats of Solar Lake (Sinai, Egypt). Appl. Environ. Microbiol. 64:2943-2951.[Abstract/Free Full Text]
35
35. Tonolla, M., A. Demarta, S. Peduzzi, D. Hahn, and R. Peduzzi. 2000. In situ analysis of sulfate-reducing bacteria related to Desulfocapsa thiozymogenes in the chemocline of meromictic Lake Cadagno (Switzerland). Appl. Environ. Microbiol. 66:820-824.[Abstract/Free Full Text]
36
36. U.S. Environmental Protection Agency. 2000. Improved enumeration methods for recreational water quality indicators: enterococci and Escherichia coli. EPA-821-R-97-004. U.S. Environmental Protection Agency, Washington, D.C.
37
37. U.S. Environmental Protection Agency. 2003. Bacterial water quality standards for recreational waters. EPA-823-R-03-008. U.S. Environmental Protection Agency Office of Water, Washington, D.C.
38
38. U.S. Environmental Protection Agency. 2003. EPA's BEACH watch program: 2002 swimming season. EPA 823-F-03-007. U.S. Environmental Protection Agency Office of Water, Washington, D.C.
39
39. Verduin, J. 1969. Man's influence on Lake Erie. Ohio J. Sci. 69:65-70.
40
40. Vis, C., A. Cattaneo, and C. Hudon. 1998. Periphyton in the clear and colored water masses of the St. Lawrence River (Quebec, Canada): a 20-year overview. J. Great Lakes Res. 24:105-117.
41
41. Visscher, P. T., R. A. Prins, and H. van Gemerden. 1992. Rates of sulfate reduction and thiosulfate consumption in a marine microbial mat. FEMS Microbiol. Ecol. 86:283-294.[CrossRef]
42
42. Werner, D. 1992. Symbiosis of plants and microbes. Chapman and Hall, London, United Kingdom.
43
43. Whitman, R. L., D. A. Shively, H. Pawlik, M. B. Nevers, and M. N. Byappanahalli. 2003. Occurrence of Escherichia coli and enterococci in Cladophora (Chlorophyta) in nearshore water and beach sand of Lake Michigan. Appl. Environ. Microbiol. 69:4714-4719.[Abstract/Free Full Text]
44
44. Woese, C. R., D. Yang, L. Mandelco, and K. O. Stetter. 1990. The Flexibacter-Flavobacter connection. Syst. Appl. Microbiol. 13:161-165.

---

Applied and Environmental Microbiology, March 2006, p. 1932-1938, Vol. 72, No. 3
0099-2240/06/$08.00+0     doi:10.1128/AEM.72.3.1932-1938.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Moriarty, E., Nourozi, F., Robson, B., Wood, D., Gilpin, B. (2008). Evidence for Growth of Enterococci in Municipal Oxidation Ponds, Obtained Using Antibiotic Resistance Analysis. Appl. Environ. Microbiol. 74: 7204-7210 [Abstract] [Full Text]  
• Ishii, S., Yan, T., Shively, D. A., Byappanahalli, M. N., Whitman, R. L., Sadowsky, M. J. (2006). Cladophora (Chlorophyta) spp. Harbor Human Bacterial Pathogens in Nearshore Water of Lake Michigan.. Appl. Environ. Microbiol. 72: 4545-4553 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Olapade, O. A. Articles by McLellan, S. L. Search for Related Content PubMed PubMed Citation Articles by Olapade, O. A. Articles by McLellan, S. L. Agricola Articles by Olapade, O. A. Articles by McLellan, S. L.