This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Copp, J. N.
Right arrow Articles by Neilan, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Copp, J. N.
Right arrow Articles by Neilan, B. A.
Agricola
Right arrow Articles by Copp, J. N.
Right arrow Articles by Neilan, B. A.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, April 2006, p. 2298-2305, Vol. 72, No. 4
0099-2240/06/$08.00+0     doi:10.1128/AEM.72.4.2298-2305.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

The Phosphopantetheinyl Transferase Superfamily: Phylogenetic Analysis and Functional Implications in Cyanobacteria{dagger}

J. N. Copp and B. A. Neilan*

Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, New South Wales 2052, Australia

Received 9 August 2005/ Accepted 18 October 2005


arrow
ABSTRACT
 
Phosphopantetheinyl transferases (PPTs) are a superfamily of essential enzymes required for the synthesis of a wide range of compounds including fatty acid, polyketide, and nonribosomal peptide metabolites. These enzymes activate carrier proteins in specific biosynthetic pathways by the transfer of a phosphopantetheinyl moiety to an invariant serine residue. PPTs display low levels of sequence similarity but can be classified into two major families based on several short motifs. The prototype of the first family is the broad-substrate-range PPT Sfp, which is required for biosynthesis of surfactin in Bacillus subtilis. The second family is typified by the Escherichia coli acyl carrier protein synthase (AcpS). Facilitated by the growing number of genome sequences available for analyses, large-scale phylogenetic studies were utilized in this research to reveal novel subfamily groupings, including two subfamilies within the Sfp-like family. In the present study degenerate oligonucleotide primers were designed for amplification of cyanobacterial PPT gene fragments. Subsequent phylogenetic analyses suggested a unique, function-based PPT type, defined by the PPTs involved in heterocyst differentiation. Evidence supporting this hypothesis was obtained by sequencing the region surrounding the partial Nodularia spumigena PPT gene. The ability to genetically classify PPT function is critical for the engineering of novel compounds utilizing combinatorial biosynthesis techniques. Information regarding cyanobacterial PPTs has important ramifications for the ex situ production of cyanobacterial natural products.


arrow
INTRODUCTION
 
Fatty acid synthesis (FAS), type I polyketide synthesis (PK), and nonribosomal peptide synthesis (NRPS) utilize large multifunctional enzyme complexes (5). These complexes usually exist in modular form, with each individual module capable of the activation and incorporation of an appropriate substrate into a growing fatty acid, polyketide or peptide chain. An essential component of these unique biosynthetic complexes are small acyl- (ACP), aryl- (ArCP), or peptidyl- (PCP) carrier proteins, which exist as either integrated subunits or individual domains (18, 23, 27, 45). Each biosynthetic pathway may encode several carrier proteins, the number of which usually correlating with the length of the final product. The respective carrier domains must be converted from their inactive apo-forms to cofactor-bearing holo-forms and a specific phosphopantetheinyl transferase (PPT) is responsible for this conversion (Fig. 1) (26). This large superfamily of Mg2+-dependent enzymes transfer the essential prosthetic 4'phosphopantetheine moiety from coenzyme A (CoA) to an invariant serine residue contained within the conserved sequence motif Gx(D/H)S(L/I)(D/K) of all carrier proteins. The 4'phosphopantetheine arm, when incorporated into an appropriate carrier protein, has two main functions. First, the reactive thiol group of the phosphopantetheine acts as a covalent connection for the pathway intermediates. Second, the length and flexibility of this moiety assists the relocation of intermediates between the spatially distinct modules of the complex (28, 36).


Figure 1
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 1. PPT activation of apo-carrier proteins. A PPT catalyzes the nucleophilic attack (of the hydroxyl side chain of the conserved carrier protein serine residue) on the 5'-ß-pyrophosphate linkage of CoA. This causes the transfer of the phosphopantetheinyl moiety of CoA to the side chain of the conserved serine residue, converting the carrier protein from an inactive apo-form to an active holo-form (26).

The low overall sequence similarity of the PPT superfamily has hindered many attempts to isolate specific PPTs. Sequence analyses of conserved motifs revealed the division of the large superfamily of PPTs into two paralogous groups that correspond to substrate specificity (26).

The first family (designated "Sfp-like") is classified by the prototype PPT from Bacillus subtilis, Sfp. This PPT is required for the activation of carrier proteins incorporated within the biosynthetic pathway responsible for the production of surfactin (36). Members of this family are approximately 230 amino acids in length and are often found associated with a biosynthetic pathway. This family includes PPTs involved in cyanobacterial heterocyst differentiation (1), fungal lysine biosynthesis (33), ß-alanine conjugation (38), hybrid peptide synthetase/polyketide synthase complexes (43, 44), and other enzymes whose exact functions have not been elucidated. They display a broad range of specificity toward carrier protein substrates and have been used in diverse applications, such as Sfp catalyzed phagemid display and Sfp labeling of carrier proteins (25, 46, 50). The crystal structure of Sfp in complex with CoA revealed a novel alpha/beta-fold and twofold pseudo-symmetry (37).

Members of the second PPT family are found in almost all organisms for the specific modification of fatty acid ACPs as an essential component of fatty acid synthesis (FAS) (26). They consist of approximately 115 amino acids and exist as trimers, with two monomers of the trimer mimicking the pseudo-dimer structure of the Sfp PPT (35). Designated AcpSs (acyl carrier protein synthases), these PPTs are also capable of activating polyketide synthase ACPs (48), and this family includes a separate subfamily of integrated PPTs involved in eukaryotic FAS (9, 47).

Many microorganisms possess multiple PPTs. For example, the genome of B. subtilis encodes an AcpS and also Sfp for surfactin biosynthesis (32). In comparison, the genome of Escherichia coli reveals three PPTs: AcpS; EntD, for synthesis of the siderophore enterobactin; and YhhU, an uncharacterized PPT (12, 26). These enzymes act independently in distinct pathways and display contrasting specificity for carrier proteins. The Sfp-like EntD is unable to complement an AcpS mutant in E. coli. In contrast, the B. subtilis Sfp displays a remarkable range of carrier protein activation (14, 22, 28). When an AcpS-like PPT is not present in an organism, an Sfp-like PPT will act in both primary and secondary metabolic pathways, displaying a preference for the carrier proteins of FAS (11). Sfp enzymes are proposed to have arisen via a gene duplication and subsequent divergence from an ancestral AcpS-like PPT (10, 11, 19).

The similarity of Sfp-like PPTs from different microorganisms can be reduced to three short peptide sequence motifs (Fig. 2) (26, 43). A conserved glutamic acid residue is also found between the two C-terminal motifs (37). Crystal structures of Sfp and multiple AcpSs has allowed the identification of important residues that are essential for the activity and structural stability within the conserved motifs (6, 35, 37, 43). These include P76 and H90 of motif 1; D107 and E109 of motif 2; and E127, W147, K150, E151, and K155 of motif 3 (Sfp numbering).


Figure 2
View larger version (83K):
[in this window]
[in a new window]
 
FIG. 2. Box shade alignment of "Sfp-like" PPT family representatives. Black shading displays identical residues, and gray shading depicts similar residues. Two subfamilies are shown. The F/KES (top alignment) and W/KEA (lower alignment) sequences are separated with a consensus (cons) line shown below each subfamily. Sequences include the following: Pse, Pseudomonas aeruginosa, AAG04554; Xan, Xanthomonas albicans, AAG28384; Vib, Vibrio cholerae, AAD48884; Pho, Photorhabdus luminescens, AAK16071; Bac, Bacillus subtilis, P39135; Syn, Synechocystis PCC6803, BAA10326; Cae, Caenorhabditis elegans, A89451; Dro, Drosophila melanogaster, AAM11059. PPT motifs are boxed and numbered, including 1A as described. Numbering for the Sfp PPT from Bacillus subtilis is shown in brackets, and an asterisk indicates residues implicated in stability or activity roles.

Despite the absolute requirement for PPTs in a wide range of important and fundamental biosynthetic pathways, these enzymes have remained elusive due to their low sequence identity and lack of proximity to their respective biosynthetic clusters. This has hampered many efforts to produce polyketide and nonribosomal peptide products in heterologous host systems utilizing E. coli, largely due to the inability of E. coli PPTs to activate foreign substrates (3, 39).

Cyanobacteria have proven to be a rich source of unique compounds that are functionally and structurally diverse with various pharmaceutical applications (2, 42). Characterization of cyanobacterial PPTs and the carrier proteins within cyanobacterial biosynthetic clusters is important for marine natural products research and their synthesis in heterologous hosts.

The aim of the present study was to complete the first large-scale phylogenetic analyses of the PPT superfamily in order to reveal new information regarding these small, essential enzymes involved in both primary and secondary metabolism.


arrow
MATERIALS AND METHODS
 
Creation of the Sfp-like PPT database.
Sequences were collected by word-based ENTREZ searches, using any combination of words relating to PPTs, e.g., acyl carrier protein synthetase, Sfp, or pantetheine. The output data of BLAST (Basic Local Alignment Search Tool) PSI-protein searches were used to extend the sequence set and identify sequences that were not recognized through word-based searches. Available (completed and partial) genomes from the National Center for Biotechnology Information, Joint Genome Institute, and Cyanobase (www.kazusa.or.jp/cyano/cyano.html) were subjected to multiple BLAST screens with a variety of known PPT sequences from different bacterial genera.

Multiple alignments and phylogenetics.
PILEUP from GCG and the multiple-sequence alignment tool from CLUSTAL X (8) were utilized for the alignment of sequences. The neighbor-joining method of Saitou and Nei (41) was used to generate trees in CLUSTAL X. The data sets were bootstrapped (1,000 resampling events) (7), and the resulting trees were visualized by using NJ Plot and Treeview X. Alignments were created for publication via boxshade (17).

Cyanobacterial strains.
Cyanobacterial strains (Table 1) were obtained from the UNSW Cyanobacterial Culture Collection. Anabaena cylindrica CENA33 and Nostoc piscale CENA21 were a gift from Marli Fiore (CENA, Piracicaba, Brazil).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Cyanobacterial species utilized within this studya

DNA extraction, amplification, and sequencing.
Genomic DNA was extracted from cyanobacterial cultures as previously published (34). Amplification of cyanobacterial PPT fragments was performed by using the primers PPTF (CAGGAGTAYGGNAARCC) and PPTR (TTCTCGATRTCDATNCC) that were specifically designed to correspond to motifs 2 and 3, respectively (Fig. 2). Heterocyst PPT sequences were amplified by utilizing PPT2F (GCCCGTGGTAAACAAATATTAG) and PPT2R (GCCTCTTTACAAGTCCA). Thermal cycling was performed in a GeneAmp PCR 2400 thermocycler (Perkin-Elmer, Norwalk, CT) as previously published (34) with an annealing temperature of 45 to 55°C dependent on the primer pair utilized. Amplification of unknown sequences was performed as previously published (29). Automated sequencing was performed by using the Prism BigDye cycle sequencing system and a model 373 sequencer (Applied Biosystems, Inc.). Sequence analysis was performed by using Applied Biosystems Autoassembler software.


arrow
RESULTS
 
Creation of an Sfp-like PPT database.
A database of more than 140 Sfp-like PPT sequences from a wide range of genera was constructed for the present study (see supplementary data). These sequences include functionally characterized PPTs, putative PPTs, and hypothetical proteins. Several novel sequences were identified. Sfp-like PPT sequences could be obtained from the majority of genomes and displayed a diverse range of characterized and hypothetical proteins from organisms including Homo sapiens (XP_040785), Arabidopsis thaliana (AAM10295), Saccharomyces cerevisiae (NP_011361), Drosophila melanogaster (AAM11059), E. coli (Q8XA39), Methanosarcina acetivorans (NP_618592), and Xenopus laevis (AAH75207).

Archaeal PPT enzymes.
Three PPT sequences from archaea genomes were also found. These sequences were only observed in Methanosarcina species, namely, M. acetivorans, M. barkeri, and M. mazei Goe1 (accession numbers NP_618592, ZP_00078565, and NP_632640, respectively). These PPTs clustered with the Sfp-like family (Fig. 3). P76 (Sfp numbering), involved in associations with the adenine base of CoA, and H90, involved in binding with the 3'-phosphate of CoA (37), were absent in all Methanosarcina sp. PPTs.


Figure 3
View larger version (44K):
[in this window]
[in a new window]
 
FIG. 3. Phylogenetic analysis of a selection of Sfp-like PPTs. A phylogenetic tree representing Sfp-like family is displayed, with accession numbers given in parenthesis. Significant bootstrap data (over 500 of 1,000 repeats) are shown. The E. coli AcpS was chosen as an outgroup for the Sfp-like PPT clade. Two subgroups are observed and distinguished as the W/KEA and F/KES subfamilies, respectively. Letters in superscript refer to PKS biosynthesis (P), NRPS biosynthesis (N), hybrid PKS/NRPS biosynthesis (H), siderophore biosynthesis (S), sequences obtained through the translation of contiguous sequences from unfinished genome projects (Figure 3) (see the supplemental material), Sfp-like PPTs found in genomes without an AcpS (A-), cyanobacterial PPTs associated with heterocyst glycolipid synthesis (HET), and PPTs associated with lysine biosynthesis (L).

Integrated Sfp-like PPTs.
During the present study several novel examples were observed of integrated Sfp-like PPTs (49). An integrated PPT was observed in Gloeobacter violaceus (BAC92166) and Azotobacter vinelandii (ZP_00089517), where an Sfp-like domain was located at the C terminus of a large PKS. In Arabidopsis thaliana (AAC05345), an Sfp-like PPT was found at the C terminus of a CIP4-like (named for COP1 interactive partner 4) domain.

Sequence conservation within the Sfp-like family.
Alignments in the present study revealed additional examples of sequences diverging from the amino acids considered critical for PPT function. Examples include H90 from motif 1, which was absent in several sequences including all Methanosarcina spp., some Staphylococcus spp., and a Streptomyces sp. In the Fig. 2 alignment of Sfp-like PPTs two distinct subfamilies were observed. Motif 3 of the first subfamily [F(S/C)KES], from now on referred to as the F/KES subfamily, includes a conserved region [KR(K/Q/R)AE(F/Y/H)(L/V)AGR], which is designated motif 1A. This motif is situated 32 residues upstream of motif 1 [PXWPXGX2GS(M/L)THCXGY]. The second subfamily included the Sfp sequence from B. subtilis. This group displayed the peptide sequence GKP11-17SH as motif 1, displayed W(T/C)KEA as motif 3, and is referred to as the W/KEA subfamily.

Phylogenetic analysis of Sfp-like PPTs.
Phylogenetic trees support the subfamilies observed in motif alignment analyses. The Sfp-like PPT subfamilies were delineated and supported by bootstrap data (Fig. 3) with the AcpS PPT as an outgroup.

Microorganisms that have multiple Sfp-like PPTs were shown to have PPTs falling within both F/KES and W/KEA branches of the phylogeny, including Streptomyces antibioticus, Streptomyces avermitilis, and Pseudomonas fluorescens (Fig. 3). Sfp-like PPTs from organisms without an AcpS-like PPT were also present on both branches. For example, Pseudomonas aeruginosa (11) and Haemophilus influenzae (AAC21831) were observed in the F/KES and W/KEA subfamilies, respectively. PPTs found in hybrid (PKS/NRPS) biosynthetic clusters were also present in both subfamilies.

The F/KES subfamily included the majority of PPTs associated with peptide synthetases and siderophore synthesis, including all enterobactin EntD enzymes. The W/KEA subfamily included the B. subtilis PPT Sfp, heterocyst glycolipid biosynthetic PPTs, lysine biosynthesis PPTs, and eukaryotic PPT sequences from organisms including Drosophila melanogaster and Caenorhabditis elegans. PPT enzymes involved in PK biosynthesis are predominant in the W/KEA group, such as MupN (AAM12928) associated with mupirocin production in Pseudomonas fluorescens.

Cyanobacterial PPT screening.
A screen for cyanobacterial PPT enzymes was performed utilizing the available sequence data from published genomes (Table 1). Conserved motif alignments (motifs 2 and 3) were targeted from Sfp-like PPTs for the design of degenerate PCR primers. Eleven novel cyanobacterial PPT genes were subsequently isolated from toxic, nontoxic, unicellular, filamentous, or heterocyst-forming cyanobacterial species. A phylogenetic tree was constructed from published and partial cyanobacterial PPT sequences (Fig. 4) and revealed two novel phylotypes designated A and B. All cyanobacterial PPTs fell within the W/KEA subfamily of Sfp-like PPTs.


Figure 4
View larger version (32K):
[in this window]
[in a new window]
 
FIG. 4. A phylogenetic tree of cyanobacterial PPTs. Accession numbers are given in parenthesis, and underlined sequences indicate those isolated during the present study. Heterocyst forming cyanobacteria are indicated in bold type. Significant bootstrap data (greater than 500 out of 1,000 repeats) are shown. The PPT from the photosynthetic green sulfur bacterium Chlorobium tepidium was chosen as an outgroup. Distinct phylotypes are observed and depicted as subgroup A (associated with heterocyst glycolipid synthesis) and B, respectively.

One of the phylotypes (A) contained PPTs from known heterocyst-forming cyanobacteria and formed a distinct clade supported by bootstrap data. The genome of the heterocyst-forming Nostoc punctiforme PCC73102 species contained three PPTs of the W/KEA subfamily. The N. punctiforme PPT associated with the HetMNI gene locus was placed within the heterocyst-associated clade, whereas the two remaining PPTs were in alternative clades.

The second phylotype (B) included PPTs from Prochlorococcus, Synechococcus, Gloeobacter, and N. punctiforme species. Several of the sequences within this group were located adjacent to an ATPase gene. The G. violaceus and N. punctiforme PPTs in this group were both associated with PKS biosynthetic clusters.

Partial sequencing of the N. spumigena HetMNI gene cluster.
The N. spumigena PPT fragment identified by phylogenetic analysis for potential association with heterocyst synthesis was subsequently selected for characterization. A flanking region of 3,450 bp (AY836561) was identified that encoded a heterocyst related HetMNI gene cluster. The N. spumigena 720-bp HetI displayed 71% similarity to hetI of N. punctiforme PCC73102. This PPT is encoded in reverse orientation to hetM and hetN, which, respectively, display 83 and 85% similarity to corresponding genes in N. punctiforme PCC73102.


arrow
DISCUSSION
 
The observation of two distinct subfamilies within the Sfp-like PPT family highlights the complex evolution of these enzymes and proposes interesting questions of reaction specificity and complementation. For example, Streptomyces antibioticus has two PPTs found within a single biosynthetic cluster responsible for the production of the antibiotic simocyclinone (13). These two PPTs differ in their peptide sequence and group with the F/KES (Sim19, accession AAL15597) and W/KEA (Sim10, accession AAL15588) subfamilies, respectively.

The PPT Sfp is commonly used to overcome problems associated with carrier protein modification in heterologous hosts (21, 24), but modification is often incomplete (15). Researchers are now focusing on PPTs within alternative heterologous hosts, such as Pseudomonas (16) and Streptomyces (20, 40) species. The ability to distinguish between the Sfp-like PPT subfamilies and the likelihood of association with either PK or NRPS biosynthetic pathways has important implications in heterologous expression.

Cyanobacterial PPTs are an interesting group of enzymes due to the presence of: multiple secondary metabolites including PK, NRPS, and hybrid (NRPS/PKS) biosynthesis; PPTs associated with development of specialist cells for nitrogen fixation (heterocysts); Sfp-like PPTs with the notable absence of an AcpS-like PPT; and integrated Sfp-like PPTs within PK clusters. The majority of sequenced cyanobacterial genomes contain a singular Sfp-like PPT. The lack of multiple cyanobacterial PPTs in the majority of genomes analyzed was surprising, especially when the vast range of secondary metabolites produced by these organisms is considered. Single Sfp-like PPT enzymes must therefore act in both primary and secondary metabolism pathways to activate multiple carrier proteins. Showing alternative architecture, the genomes of G. violaceus and N. punctiforme harbor three distinct Sfp-like PPTs.

The Sfp family may have evolved from the AcpS family by a gene duplication event with subsequent diversification into the two families. The degree of divergence is apparent, with each PPT family utilizing distinctly different modes of carrier protein recognition (31). The observations of distinct subfamilies within the Sfp-like PPT family, the general absence of AcpS-like PPTs in cyanobacteria, and the integration of Sfp-type PPTs highlights the complexity of genetic divergence that followed the proposed duplication event. Presumably, with the absence of AcpS-like PPTs in cyanobacteria, an early, common cyanobacterial ancestor must have lost the AcpS type after the functional Sfp-like gene evolved from a duplication event. A similar case was seen in the analysis of archaeal PPTs. An alternative proposal to the evolution of PPTs could be hypothesized with the Sfp-like PPT as the ancestral prototype. The increasing complexity of biosynthetic pathways, in combination with the requirement of a defined CoA pool, may have led to the evolution of a duplicated, truncated Sfp-like PPT dedicated to primary metabolism. The latter enzyme now observed as the AcpS-like PPT in genomes with multiple PPTs.

Functional classification has not previously been observed in PPT phylogenetics. Analysis of the divergent range of cyanobacterial PPTs allowed the designation of PPTs associated with heterocyst formation. Several heterocyst associated gene loci have been identified, one of which is the HetMNI locus harboring a PKS for the biosynthesis of glycolipids (4). HetI is the PPT associated with this locus required for the pantetheinylation of HetM, which is a fused ArCP domain.

Utilizing gene alignments to screen PPT sequences has allowed the detection of heterocyst-associated PPTs within cyanobacterial genomes and the subsequent characterization of a heterocyst biosynthesis locus in N. spumigena NSOR10. Phylogenetic studies of PKS ketosynthase domains have also implicated heterocyst-association (30). The sequence alignments also identified PPT sequences that did not group with heterocyst-associated PPTs and therefore these PPTs could be connected with unknown biosynthetic gene clusters.

PPT characterization is vital for the production and manipulation of natural products due to the essential nature of these enzymes in complex biosynthesis. Detection and functional classification of PPTs allows targeting of appropriate enzymes for specific carrier proteins within a biosynthetic pathway.


arrow
ACKNOWLEDGMENTS
 
This study was financially supported by the Australian Research Council and Diagnostic Technology P/L.

We thank one of the anonymous reviewers for constructive and extensive comments during the review process.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia. Phone: 612 9385 3235. Fax: 612 9385 1591. E-mail: b.neilan{at}unsw.edu.au. Back

{dagger} Supplemental material for this article may be found at http://aem.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Black, T. A., and C. P. Wolk. 1994. Analysis of a Het mutation in Anabaena sp. strain PCC 7120 implicates a secondary metabolite in the regulation of heterocyst spacing. J. Bacteriol. 176:2282-2292.[Abstract/Free Full Text]
  2. 2
  3. Burja, A. M., B. Banaigs, E. Abou-Mansour, J. G. Burgess, and P. C. Wright. 2001. Marine cyanobacteria: a prolific source of natural products. Tetrahedron 57:9347-9377.[CrossRef]
  4. 3
  5. Caffrey, P., B. Green, L. C. Packman, B. J. Rawlings, J. Staunton, and P. F. Leadlay. 1991. An acyl-carrier-protein-thioesterase domain from the 6-deoxyerythronolide B synthase of Saccharopolyspora erythraea: high-level production, purification and characterisation in Escherichia coli. Eur. J. Biochem. 195:823-830.[Medline]
  6. 4
  7. Campbell, E. L., M. F. Cohen, and J. C. Meeks. 1997. A polyketide-synthase-like gene is involved in the synthesis of heterocyst glycolipids in Nostoc punctiforme strain ATCC 29133. Arch. Microbiol. 167:251-258.[CrossRef][Medline]
  8. 5
  9. Cane, D. E., C. T. Walsh, and C. Khosla. 1998. Harnessing the biosynthetic code: combinations, permutations, and mutations. Science 282:63-68.[Abstract/Free Full Text]
  10. 6
  11. Chirgadze, N. Y., S. L. Briggs, K. A. McAllister, A. S. Fischl, and G. Zhao. 2000. Crystal structure of Streptococcus pneumoniae acyl carrier protein synthase: an essential enzyme in bacterial fatty acid biosynthesis. EMBO J. 19:5281-5287.[CrossRef][Medline]
  12. 7
  13. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:166-170.
  14. 8
  15. Felsenstein, J. 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol. 17:368-376.[CrossRef][Medline]
  16. 9
  17. Fichtlscherer, F., C. Wellein, M. Mittag, and E. Schweizer. 2000. A novel function of yeast fatty acid synthase: subunit alpha is capable of self-pantetheinylation. Eur. J. Biochem. 267:2666-2671.[Medline]
  18. 10
  19. Finking, R., M. R. Mofid, and M. A. Marahiel. 2004. Mutational analysis of peptidyl carrier protein and acyl carrier protein synthase unveils residues involved in protein-protein recognition. Biochemistry 43:8946-8956.[CrossRef][Medline]
  20. 11
  21. Finking, R., J. Solsbacher, D. Konz, M. Schobert, A. Schafer, D. Jahn, and M. A. Marahiel. 2002. Characterization of a new type of phosphopantetheinyl transferase for fatty acid and siderophore synthesis in Pseudomonas aeruginosa. J. Biol. Chem. 277:50293-50302.[Abstract/Free Full Text]
  22. 12
  23. Flugel, R. S., Y. Hwangbo, R. H. Lambalot, J. E. Cronan, Jr., and C. T. Walsh. 2000. Holo-(acyl carrier protein) synthase and phosphopantetheinyl transfer in Escherichia coli. J. Biol. Chem. 275:959-968.[Abstract/Free Full Text]
  24. 13
  25. Galm, U., J. Schimana, H. P. Fiedler, J. Schmidt, S. M. Li, and L. Heide. 2002. Cloning and analysis of the simocyclinone biosynthetic gene cluster of Streptomyces antibioticus Tu 6040. Arch. Microbiol. 178:102-114.[CrossRef][Medline]
  26. 14
  27. Gehring, A. M., I. Mori, R. D. Perry, and C. T. Walsh. 1998. The nonribosomal peptide synthetase HMWP2 forms a thiazoline ring during biogenesis of yersiniabactin, an iron-chelating virulence factor of Yersinia pestis. Biochemistry 37:11637-11650.[CrossRef][Medline]
  28. 15
  29. Gokhale, R. S., S. Y. Tsuji, D. E. Cane, and C. Khosla. 1999. Dissecting and exploiting intermodular communication in polyketide synthases. Science 284:482-485.[Abstract/Free Full Text]
  30. 16
  31. Gross, F., D. Gottschalk, and R. Muller. 2005. Posttranslational modification of myxobacterial carrier protein domains in Pseudomonas sp. by an intrinsic phosphopantetheinyl transferase. Appl. Microbiol. Biotechnol.
  32. 17
  33. Hofmann, K. January 2004, revision date. Biomanager 2.0 by ANGIS. [Online.] http://www.angis.org.au.
  34. 18
  35. Hopwood, D. A., and D. H. Sherman. 1990. Molecular genetics of polyketides and its comparison to fatty acid biosynthesis. Annu. Rev. Genet. 24:37-66.[CrossRef][Medline]
  36. 19
  37. Joshi, A. K., L. Zhang, V. S. Rangan, and S. Smith. 2003. Cloning, expression, and characterization of a human 4'-phosphopantetheinyl transferase with broad substrate specificity. J. Biol. Chem. 278:33142-33149.[Abstract/Free Full Text]
  38. 20
  39. Kalaitzis, J. A., and B. S. Moore. 2004. Heterologous biosynthesis of truncated hexaketides derived from the actinorhodin polyketide synthase. J. Nat. Prod. 67:1419-1422.[CrossRef][Medline]
  40. 21
  41. Kealey, J. T., L. Liu, D. V. Santi, M. C. Betlach, and P. J. Barr. 1998. Production of a polyketide natural product in nonpolyketide-producing prokaryotic and eukaryotic hosts. Proc. Natl. Acad. Sci. USA 95:505-509.[Abstract/Free Full Text]
  42. 22
  43. Keating, T. A., and C. T. Walsh. 1999. Initiation, elongation, and termination strategies in polyketide and polypeptide antibiotic biosynthesis. Curr. Opin. Chem. Biol. 3:598-606.[CrossRef][Medline]
  44. 23
  45. Kleinkauf, H., and H. Von Dohren. 1996. A nonribosomal system of peptide biosynthesis. Eur. J. Biochem. 236:335-351.[Medline]
  46. 24
  47. Ku, J., R. G. Mirmira, L. Liu, and D. V. Santi. 1997. Expression of a functional non-ribosomal peptide synthetase module in Escherichia coli by coexpression with a phosphopantetheinyl transferase. Chem. Biol. 4:203-207.[CrossRef][Medline]
  48. 25
  49. La Clair, J. J., T. L. Foley, T. R. Schegg, C. M. Regan, and M. D. Burkart. 2004. Manipulation of carrier proteins in antibiotic biosynthesis. Chem. Biol. 11:195-201.[CrossRef][Medline]
  50. 26
  51. Lambalot, R. H., A. M. Gehring, R. S. Flugel, P. Zuber, M. LaCelle, M. A. Marahiel, R. Reid, C. Khosla, and C. T. Walsh. 1996. A new enzyme superfamily: the phosphopantetheinyl transferases. Chem. Biol. 3:923-936.[CrossRef][Medline]
  52. 27
  53. Lynen, F. 1980. On the structure of fatty acid synthetase of yeast. Eur. J. Biochem. 112:431-432.[Medline]
  54. 28
  55. Marahiel, M. A., T. Stachelhaus, and H. D. Mootz. 1997. Modular peptide synthetases involved in nonribosomal peptide synthesis. Chem. Rev. 97:2651-2674.[CrossRef][Medline]
  56. 29
  57. Moffitt, M. C., and B. A. Neilan. 2004. Characterization of the nodularin synthetase gene cluster and proposed theory of the evolution of cyanobacterial hepatotoxins. Appl. Environ. Microbiol. 70:6353-6362.[Abstract/Free Full Text]
  58. 30
  59. Moffitt, M. C., and B. A. Neilan. 2003. Evolutionary affiliations within the superfamily of ketosynthases reflect complex pathway associations. J. Mol. Evol. 56:446-457.[CrossRef][Medline]
  60. 31
  61. Mofid, M. R., R. Finking, and M. A. Marahiel. 2002. Recognition of hybrid peptidyl carrier proteins/acyl carrier proteins in nonribosomal peptide synthetase modules by the 4'-phosphopantetheinyl transferases AcpS and Sfp. J. Biol. Chem. 277:17023-17031.[Abstract/Free Full Text]
  62. 32
  63. Mootz, H. D., R. Finking, and M. A. Marahiel. 2001. 4'-Phosphopantetheine transfer in primary and secondary metabolism of Bacillus subtilis. J. Biol. Chem. 276:37289-37298.[Abstract/Free Full Text]
  64. 33
  65. Mootz, H. D., K. Schorgendorfer, and M. A. Marahiel. 2002. Functional characterization of 4'-phosphopantetheinyl transferase genes of bacterial and fungal origin by complementation of Saccharomyces cerevisiae lys5. FEMS Microbiol. Lett. 213:51-57.[Medline]
  66. 34
  67. Neilan, B. A., D. Jacobs, and A. E. Goodman. 1995. Genetic diversity and phylogeny of toxic cyanobacteria determined by DNA polymorphisms within the phycocyanin locus. Appl. Environ. Microbiol. 61:3875-3883.[Abstract]
  68. 35
  69. Parris, K. D., L. Lin, A. Tam, R. Mathew, J. Hixon, M. Stahl, C. C. Fritz, J. Seehra, and W. S. Somers. 2000. Crystal structures of substrate binding to Bacillus subtilis holo-(acyl carrier protein) synthase reveal a novel trimeric arrangement of molecules resulting in three active sites. Structure Fold Des. 8:883-895.[Medline]
  70. 36
  71. Quadri, L. E., P. H. Weinreb, M. Lei, M. M. Nakano, P. Zuber, and C. T. Walsh. 1998. Characterization of Sfp, a Bacillus subtilis phosphopantetheinyl transferase for peptidyl carrier protein domains in peptide synthetases. Biochemistry 37:1585-1595.[CrossRef][Medline]
  72. 37
  73. Reuter, K., M. R. Mofid, M. A. Marahiel, and R. Ficner. 1999. Crystal structure of the surfactin synthetase-activating enzyme sfp: a prototype of the 4'-phosphopantetheinyl transferase superfamily. EMBO J. 18:6823-6831.[CrossRef][Medline]
  74. 38
  75. Richardt, A., T. Kemme, S. Wagner, D. Schwarzer, M. A. Marahiel, and B. T. Hovemann. 2003. Ebony, a novel nonribosomal peptide synthetase for beta-alanine conjugation with biogenic amines in Drosophila. J. Biol. Chem. 278:41160-41166.[Abstract/Free Full Text]
  76. 39
  77. Roberts, G. A., J. Staunton, and P. F. Leadlay. 1993. Heterologous expression in Escherichia coli of an intact multienzyme component of the erythromycin-producing polyketide synthase. Eur. J. Biochem. 214:305-311.[Medline]
  78. 40
  79. Rodriguez, E., S. Ward, H. Fu, W. P. Revill, R. McDaniel, and L. Katz. 2004. Engineered biosynthesis of 16-membered macrolides that require methoxymalonyl-ACP precursors in Streptomyces fradiae. Appl. Microbiol. Biotechnol. 66:85-91.[CrossRef][Medline]
  80. 41
  81. Saitou, N., and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.[Abstract]
  82. 42
  83. Salomon, C. E., N. A. Magarvey, and D. H. Sherman. 2004. Merging the potential of microbial genetics with biological and chemical diversity: an even brighter future for marine natural product drug discovery. Nat. Prod. Rep. 21:105-121.[CrossRef][Medline]
  84. 43
  85. Sanchez, C., L. Du, D. J. Edwards, M. D. Toney, and B. Shen. 2001. Cloning and characterization of a phosphopantetheinyl transferase from Streptomyces verticillus ATCC 15003, the producer of the hybrid peptide-polyketide antitumor drug bleomycin. Chem. Biol. 8:725-738.[CrossRef][Medline]
  86. 44
  87. Shen, B., L. Du, C. Sanchez, D. J. Edwards, M. Chen, and J. M. Murrell. 2001. The biosynthetic gene cluster for the anticancer drug bleomycin from Streptomyces verticillus ATCC 15003 as a model for hybrid peptide-polyketide natural product biosynthesis. J. Ind. Microbiol. Biotechnol. 27:378-385.[CrossRef][Medline]
  88. 45
  89. Shen, B., R. G. Summers, H. Gramajo, M. J. Bibb, and C. R. Hutchinson. 1992. Purification and characterization of the acyl carrier protein of the Streptomyces glaucescens tetracenomycin C polyketide synthase. J. Bacteriol. 174:3818-3821.[Abstract/Free Full Text]
  90. 46
  91. Sieber, S. A., C. T. Walsh, and M. A. Marahiel. 2003. Loading peptidyl-coenzyme A onto peptidyl carrier proteins: a novel approach in characterizing macrocyclization by thioesterase domains. J. Am. Chem. Soc. 125:10862-10866.[CrossRef][Medline]
  92. 47
  93. Stuible, H. P., S. Meier, and E. Schweizer. 1997. Identification, isolation and biochemical characterization of a phosphopantetheine:protein transferase that activates the two type-I fatty acid synthases of Brevibacterium ammoniagenes. Eur. J. Biochem. 248:481-487.[Medline]
  94. 48
  95. Suo, Z., C. C. Tseng, and C. T. Walsh. 2001. Purification, priming, and catalytic acylation of carrier protein domains in the polyketide synthase and nonribosomal peptidyl synthetase modules of the HMWP1 subunit of yersiniabactin synthetase. Proc. Natl. Acad. Sci. USA 98:99-104.[Abstract/Free Full Text]
  96. 49
  97. Weissman, K. J., H. Hong, M. Oliynyk, A. P. Siskos, and P. F. Leadlay. 2004. Identification of a phosphopantetheinyl transferase for erythromycin biosynthesis in Saccharopolyspora erythraea. Chembiochem 5:116-125.[CrossRef][Medline]
  98. 50
  99. Yin, J., F. Liu, M. Schinke, C. Daly, and C. T. Walsh. 2004. Phagemid encoded small molecules for high throughput screening of chemical libraries. J. Am. Chem. Soc. 126:13570-13571.[CrossRef][Medline]


Applied and Environmental Microbiology, April 2006, p. 2298-2305, Vol. 72, No. 4
0099-2240/06/$08.00+0     doi:10.1128/AEM.72.4.2298-2305.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Kaneko, T., Nakajima, N., Okamoto, S., Suzuki, I., Tanabe, Y., Tamaoki, M., Nakamura, Y., Kasai, F., Watanabe, A., Kawashima, K., Kishida, Y., Ono, A., Shimizu, Y., Takahashi, C., Minami, C., Fujishiro, T., Kohara, M., Katoh, M., Nakazaki, N., Nakayama, S., Yamada, M., Tabata, S., Watanabe, M. M. (2008). Complete Genomic Structure of the Bloom-forming Toxic Cyanobacterium Microcystis aeruginosa NIES-843. DNA Res 0: dsm026v1-10 [Abstract] [Full Text]  
  • Copp, J. N., Roberts, A. A., Marahiel, M. A., Neilan, B. A. (2007). Characterization of PPTNs, a Cyanobacterial Phosphopantetheinyl Transferase from Nodularia spumigena NSOR10. J. Bacteriol. 189: 3133-3139 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Copp, J. N.
Right arrow Articles by Neilan, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Copp, J. N.
Right arrow Articles by Neilan, B. A.
Agricola
Right arrow Articles by Copp, J. N.
Right arrow Articles by Neilan, B. A.