Applied and Environmental Microbiology, June 2006, p. 4044-4053, Vol. 72, No. 6
0099-2240/06/$08.00+0 doi:10.1128/AEM.00128-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
A Mutation in Flavobacterium psychrophilum tlpB Inhibits Gliding Motility and Induces Biofilm Formation
B. Álvarez,1
P. Secades,1
M. Prieto,2
M. J. McBride,3 and
J. A. Guijarro1*
Área de Microbiología, Departamento de Biología Funcional, Facultad de Medicina, IUBA, Universidad de Oviedo, 33006 Oviedo, Spain,1
Laboratorio de Sanidad Animal de Jove, SERIDA, 33299 Gijón, Spain,2
Department of Biological Sciences, University of Wisconsin, Milwaukee, Wisconsin 532013
Received 18 January 2006/
Accepted 14 March 2006
 |
ABSTRACT
|
|---|
Flavobacterium psychrophilum is a psychrotrophic, fish-pathogenic bacterium belonging to the Cytophaga-Flavobacterium-Bacteroides group. Tn4351-induced mutants deficient in gliding motility, growth on iron-depleted media, and extracellular proteolytic activity were isolated. Some of these mutants were affected in only one of these characteristics, whereas others had defects in two or more. FP523, a mutant deficient in all of these properties, was studied further. FP523 had a Tn4351 insertion in tlpB (thiol oxidoreductase-like protein gene), which encodes a 41.4-kDa protein whose sequence does not exhibit high levels of similar to the sequences of proteins having known functions. TlpB has two domains; the N-terminal domains has five transmembrane regions, whereas the C-terminal domains has the Cys-X-X-Cys motif and other conserved motifs characteristic of thiol:disulfide oxidoreductases. Quantitative analysis of the thiol groups of periplasmic proteins revealed that TlpB is required for reduction of these groups. The tlpB gene is part of the fpt (F. psychrophilum thiol oxidoreductase) operon that contains two other genes, tlpA and tpiA, which encode a thiol:disulfide oxidoreductase and a triosephosphate isomerase, respectively. FP523 exhibited enhanced biofilm formation and decreased virulence and cytotoxicity. Complementation with the tlpB loci restored the wild-type phenotype. Gliding motility and biofilm formation appear to be antagonistic properties, which are both affected by TlpB.
 |
INTRODUCTION
|
|---|
Flavobacterium psychrophilum is a gram-negative bacterium which is a member of the Cytophaga-Flavobacterium-Bacteroides (CFB) group. This microorganism is the etiological agent of the "cold water disease" that affects salmonids. This disease occurs at temperatures below 12°C and causes significant economic losses for salmonid fish farms worldwide. No vaccines are available; therefore, control of outbreaks is based on fish management strategies and the use of antimicrobial therapy (for a review see reference 38).
The psychrotrophic bacterium F. psychrophilum does not grow at temperatures above 20°C and is considered "fastidious" because it is difficult to isolate and culture (33, 38). This has hindered physiological, biochemical, and genetic studies of F. psychrophilum, and consequently, our knowledge concerning the mechanism of pathogenesis is limited. Nevertheless, in recent years advances in cultivation (33), diagnosis (11), and experimental infection techniques (14) and in genetic techniques for DNA transfer (3) have been reported.
Some mechanisms involved in the development of the disease have been studied. Adhesion is a prerequisite for colonization, and it has been found that highly virulent strains of F. psychrophilum attach more readily to host tissues than less virulent strains attach (39). Furthermore, a specific lectin, which is able to aggregate F. psychrophilum cells and erythrocytes, has been related to the adhesion of this bacterium (36). Several reports have correlated the presence of an extracellular proteolytic enzyme with virulence (6). Two F. psychrophilum metalloproteases, Fpp1 and Fpp2, have been purified and characterized (46, 47). Both of these proteins have a broad hydrolysis spectrum that includes matrix and muscle proteins. Fpp1 is maximally induced in the presence of calcium levels (10 mM) similar to those present in the fish (46). Recently, several putative virulence factors of F. psychrophilum have been identified by subtractive hybridization (50).
Bacterial motility is an important factor for rapid colonization. Motility has been linked to biofilm formation and production of virulence factors in different pathogenic gram-negative bacteria (7, 15, 17, 23, 42). Like many other members of the CFB group, F. psychrophilum crawls over surfaces by a process known as gliding motility (38). The mechanism of this form of movement is not known. Genetic analyses of the related bacterium Flavobacterium johnsoniae have identified Gld proteins required for gliding (27). Some Gld proteins exhibit sequence similarities to components of ABC transporters (2, 19) and lipoproteins (20, 21, 28, 29). Disruption of the gld genes results in a loss of gliding motility and pleiotropic effects, such as resistance to bacteriophages and loss of the ability to hydrolyze chitin (28, 29).
In this study, we isolated Tn4351-induced mutants of F. psychrophilum that are deficient in proteolytic activity, motility, and iron uptake. One of these mutants, designated FP523, had an insertion in tlpB, which encodes a putative thiol:disulfide oxidoreductase. Periplasmic thiol:disulfide oxidoreductases are part of the folding pathway of many secreted proteins (for reviews see references 13 and 37). These enzymes have an active site containing two cysteines in the motif C-X-X-C and an overall tertiary structure known as the thioredoxin-like fold (34). They facilitate the formation of disulfide bridges (Dsb proteins) and are essential for correct folding or assembly of many proteins, including toxins, adhesins, and components of the type III secretion system (17, 40, 51, 54). FP523 was deficient in gliding motility, extracellular proteolytic activity, cytotoxicity, and virulence and exhibited an enhanced ability to form biofilms.
 |
MATERIALS AND METHODS
|
|---|
Bacterial strains, plasmids, and growth conditions.
Wild-type strain F. psychrophilum THC02-90 was used in this study. Escherichia coli strains S17-1
pir (48) and BW19851 (32) were used to transfer DNA into F. psychrophilum. E. coli strains were grown at 37°C in 2x TY medium (10 g of tryptone per liter, 10 g of yeast extract per liter, 5 g of NaCl per liter) with 20 g of agar per liter added for solid medium. F. psychrophilum strains were grown at 20°C on solid EAOS medium (33) or at 12°C and 18°C in nutrient broth (NB) (Pronadisa) as previously described (3). To observe colony spreading, F. psychrophilum was grown on gliding nutrient agar (GNA), which consisted of half-strength NB containing 7.5 g of agar per liter. To test the extracellular proteolytic activity of F. psychrophilum strains, 0.5% (wt/vol) gelatin was added to nutrient agar (NA). NA consisted of NB with 1.5% (wt/vol) agar. To identify mutants which had defects in iron uptake, the iron chelator 2,2'-dipyridyl was added to NA at a final concentration of 50 µM. For selection of F. psychrophilum transconjugants or transformants, erythromycin or tetracycline was used at a concentration of 10 µg per ml. For selective growth of E. coli strains, antibiotics were added when needed at the following concentrations: ampicillin, 100 µg/ml; chloramphenicol, 30 µg/ml; streptomycin, 50 µg/ml; and tetracycline, 15 µg/ml. The plasmids and primers used are listed in Table 1.
Tn4351 mutagenesis of F. psychrophilum.
Tn4351 was introduced into F. psychrophilum THC02-90 by conjugation from E. coli BW19851, as previously described (3). Erythromycin-resistant colonies of F. psychrophilum appeared after 7 to 10 days of incubation at 20°C. The colonies were grown on GNA, NA with gelatin, and NA with 2,2'-dipyridyl to select mutants defective in gliding motility, proteolytic activity, and iron uptake, respectively.
Southern blot analysis of Tn4351 insertions in F. psychrophilum mutants.
Genomic DNA of the mutants was isolated, digested with XbaI, separated by gel electrophoresis, and transferred to nylon membranes essentially as previously described (3). A DIG DNA labeling and detection kit (Roche, Basel, Switzerland) was used to prepare the probes and to perform hybridization. Two probes were used, a 6.2-kb SalI fragment from pEP4351 containing transposon Tn4351 and the chloramphenicol acetyltransferase gene (cat), which is also present in pEP4351. The cat gene was amplified from pIVET8 as a 633-bp PCR product using primers CAT-1 and CAT-2 (Table 1).
Identification of the insertion site of Tn4351 in FP523 and amplification of the DNA surrounding F. psychrophilum tlpB by inverse PCR.
Chromosomal DNA of the mutant was digested with HindIII and religated, which resulted in the formation of circular molecules. Tn4351-specific pairs of primers (primers 340 and 341 and primers TN-1 and IS4351-F) (Table 1) were used to amplify the sequences adjacent to the insertion site using a Certamp long amplification kit (BIOTOOLS B&M Labs, S.A.). DNA isolated from wild-type strain THC02-90 was digested with XbaI and religated to amplify the DNA surrounding tlpB by inverse PCR using primers 523-A and 523-B (Table 1).
Nucleic acid sequencing.
Automated fluorescence sequencing was performed at the Oviedo University DNA analysis facility using BigDye 3.1 terminator chemistry with an ABI PRISM 3100 genetic analyzer platform (Applied Biosystems). Sequences were compared to databases by using BLAST from the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST/). Predictions of protein subcellular localization were made using PSORTb v.2.0 (16). Secondary structure and fold recognition analyses were carried out using the programs PSIPRED (30) and 3D-PSSM (22), respectively.
RT-PCR.
Total RNA was obtained from 3-ml late-exponential-phase cultures of wild-type strain THC02-90 and mutant FP523 grown in half-strength NB. RNA was isolated using an RNeasy mini kit (QIAGEN, Valencia, Calif.) and was treated with RNase-free DNase (Promega, Inc.) to eliminate traces of DNA. Reverse transcription (RT)-PCRs were performed using Superscript One-Step with Platinum Taq (Invitrogen Life Technologies, Carlsbad, Calif.). Fifteen nanograms of RNA was used in each reaction. Control PCRs using Dynazyme II DNA polymerase (Finnzymes OY, Finland) were performed to determine whether RNA was free of contaminant DNA. The primers used (RT-A, RT-B, RT-C, RT-D, RT-E, RT-F, RT-G, RT-H, RT-I, and RT-J) are listed in Table 1.
Growth curves and determination of the proteolytic activities of THC02-90 and FP523.
THC02-90 and FP523 cultures were grown in NB in a Gallemkamp rotary incubator at 250 rpm and 12°C or 18°C. Growth was determined by measuring the absorbance of the cultures at 525 nm. One-milliliter aliquots were removed to assay proteolytic activity. These aliquots were centrifuged at 15,000 x g for 5 min, and the supernatants were collected and stored frozen until the proteolytic activity was determined. Proteolytic activity was assayed by using azocasein (Sigma Co.) as a substrate, as previously described (46).
Confocal laser scanning microscopic observations of colony spreading.
Exponential-phase cells of strains THC02-90 and FP523 were spotted onto thin layers of GNA on microscope slides and incubated for 3 days at 20°C. The colonies formed after this incubation were stained with SYTO 9 (Molecular Probes, Eugene, Oreg.) and observed with a Leica TCS-SP2-AOBS confocal laser scanning microscope at an excitation wavelength of 488 nm and an emission wavelength of 530 nm. Colonies were also examined by phase-contrast microscopy.
Biofilm formation assay.
Wild-type strain THC02-90 and the mutant strain were grown on half-strength NB to the mid-exponential phase. The cultures were diluted 1:100 in different concentrations of NB, and then 100 µl of each dilution was inoculated in quadruplicate into wells of a 96-well microtiter polystyrene plate. Wells containing uninoculated medium were used as negative controls. The microtiter plate was incubated at 12°C for 4 days. Following this incubation, the supernatants were discarded, and the wells were washed six times with 200 µl of sterile distilled water. Then 150 µl of a 1% (wt/vol) crystal violet solution was added to each well to stain the cells. After 45 min, the crystal violet solution was removed, the wells were washed six times with 200 µl of sterile distilled water, and 200 µl of 96% (vol/vol) ethanol was added. Biofilm formation was then quantified by measuring the A595. To observe biofilms by confocal laser scanning microscopy, 500 µl of cells was added to each chamber of BD Falcon four-chamber culture slides, incubated for 4 days at 12°C, and stained with SYTO 9 as described above.
Disulfide reductase and Ellman assays and sensitivity to diamide, dithiothreitol (DTT), menadione, and plumbagin.
The wild-type strain and the FP523 mutant strain were grown in NB to the late exponential phase and exposed to 0.5 mM diamide for 3 h when appropriate. Then cells were harvested and washed with 50 mM Tris-HCl (pH 8) buffer containing 1 mM EDTA. Cell extracts were prepared by sonication and centrifugation at 25,000 x g for 20 min, and disulfide reductase activity was assayed as described by Holmgren (18) using 5,5'-dithiobis2-nitrobenzoic acid (DTNB) as the substrate. DTNB reductase activity was determined by measuring the increase in A412 at room temperature during the initial 5 min of the reaction. The reaction mixture (final volume, 1 ml) contained 50 mM Tris-HCl (pH 8), 1 mM EDTA, 0.2 mM NADPH, 0.2 mM DTNB, and cell extract. In control reactions in which NADPH was omitted there was no significant increase in absorbance. One unit of activity was defined as the amount of protein that oxidized 1 µmol of NADPH per min, calculated using
A412/ (13.6 x 2) (24).
Periplasmic protein samples from cells of the wild-type and mutant strains in the exponential phase of growth were isolated by using the chloroform method described by Ames et al. (4), except that the periplasmic proteins were solubilized with Ellman's buffer (1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride in 50 mM phosphate buffer, pH 7.5). To determine the amount of free thiols groups, a sample containing 0.3 mg of protein was mixed with 0.8 mM (final concentration) DTNB. The absorbance at 412 nm of each sample was determined after 1 min of incubation at room temperature. The assays were carried out in quadruplicate.
The sensitivities of the wild-type and mutant strains to the thiol-specific oxidant and reductant and to a redox cycling compound were determined on plates containing NA using paper disks that were soaked in 100 mM or 1 M solutions of diamide and DTT and 1 mM or 10 mM solutions of metadione and plumbagin. The results were analyzed after 4 days of incubation at 20°C.
Complementation of tlpB mutant.
To complement FP523, three plasmids based on pCP23 (Table 1) were constructed. The tlpB gene was amplified by PCR using a Certamp long amplification kit (BIOTOOLS B&M Labs, S.A.) and primers tlpB-F and tlpB-R (Table 1). BamHI and PstI restriction sites were introduced into the sequences of tlpB-F and tlpB-R, respectively, to clone the PCR product digested with BamHI and PstI into pCP23 that had been digested with the same restriction enzymes. The resulting plasmid was designated pGA1. tlpA was amplified using primers tlpA-F and tlpA-R (Table 1), and a DNA fragment which contained tlpB and tlpA was amplified using primers tlpB-F and tlpA-R (Table 1). Each PCR product was cloned into pCP23 as described above to generate pGA2, which contained tlpA, and pGA3, which contained tlpB and tlpA. For complementation analysis, pGA1, pGA2, and pGA3 were first introduced into F. psychrophilum THC02-90 by conjugation. The plasmids were isolated from wild-type F. psychrophilum and transferred by electroporation into F. psychrophilum FP523 as previously described (3).
Cytopathic effects and 50% lethal dose (LD50) of FP523.
The bluegill fry BF2 cell line was used in cytotoxicity studies. Cells were cultured in Eagle minimal essential medium (Sigma Co.) supplemented with 2.2 g NaHC03 per liter and 10% serum at 15°C. Monolayer cultures of BF2 cells in 24-well plates were inoculated with approximately 107 CFU per well of exponential-phase bacterial cultures previously washed with phosphate-buffered saline (PBS). After 48 h of incubation at 15°C, the plates were observed with an inverted microscope.
To determine the LD50, we used rainbow trout (Oncorhynchus mykiss) that weighed between 5 and 7 g, which were kept in 60-liter tanks containing dechlorinated water at 12 ± 1°C. F. psychrophilum cultures were grown to the exponential phase, harvested by centrifugation, and washed with PBS. Cells were suspended in PBS, and serial dilutions were prepared in PBS. Groups of 10 fish were challenged by intramuscular injection of 0.05 ml of dilutions containing 103 to 107 cells, and the LD50 was calculated by using the method of Reed and Muench (45).
Genetic nomenclature.
Open reading frames (ORFs) that code for predicted thiol:disulfide oxidoreductases were designated tlp (thioredoxin-like protein), followed by a letter. The ORFs that did not exhibit high levels of homology with known genes were designated fpo (F. psychrophilum open reading frame), followed by a number.
Nucleotide sequence accession number.
The sequence of the fpt operon and the surrounding DNA has been deposited in the GenBank database under accession number DQ137800.
 |
RESULTS
|
|---|
Isolation of Tn4351-induced mutants.
Using plasmid pEP4351 as a Tn4351 delivery system, approximately 1,600 erythromycin-resistant colonies of F. psychrophilum were obtained. Thirteen mutants with defects in motility, proteolytic activity, and/or the ability to grow in the presence of 2,2'-dipyridyl were obtained. Some of these mutants were affected only in one characteristic, whereas others had two or more phenotypic defects. Southern blot analysis of Tn4351 insertions revealed that most mutants had a single Tn4351 insertion (data not shown). The pleiotropic mutant FP523, which lacked extracellular proteolytic activity and colony spreading, grew poorly in iron-limited medium, and had a single Tn4351 insertion (Fig. 1), was chosen for further study.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 1. Phenotypic characteristics of the F. psychrophilum FP523 mutant. F. psychrophilum wild-type strain THC02-90 exhibits gliding motility in GNA, extracellular proteolytic activity in NA containing 0.5% gelatin, and growth in the presence of 2,2'-dipyridyl. The FP523 mutant lacks gliding motility and extracellular proteolytic activity and exhibits limited growth in the presence of 2,2'-dipyridyl.
|
|
Sequencing and analysis of the DNA surrounding the site of Tn4351 insertion in FP523.
The site of Tn4351 insertion and the surrounding DNA in FP523 were analyzed (Fig. 2A). The transposon was inserted in a gene designated tlpB. tlpB is 1,101 nucleotides long and codes for a predicted protein consisting of 367 amino acids with a molecular mass of 41.4 kDa (Fig. 2B). The amino acid sequence of TlpB does not exhibit high levels of homology with proteins having known functions. TlpB exhibits sequence similarity with the hypothetical protein Chut02002298 of Cytophaga hutchinsonii (GenBank accession number ZP_00308793; 26% identity over 362 amino acids). C. hutchinsonii is a member of the CFB group, and like F. psychrophilum, it exhibits gliding motility. Sequence analysis revealed that TlpB has two distinguishable domains: an N-terminal domain (positions 1 to 174) that has five transmembrane regions (Fig. 2B), which strongly suggests that the protein is membrane anchored, and a C-terminal domain (positions 174 to 367). The carboxy-terminal portion of F. psychrophilum TlpB has a putative thioredoxin-like domain which includes the Cys-X-X-Cys motif (C260-D-H-C263) of thiol:disulfide oxidoreductases, as well as a highly conserved proline (P227) that is present in the redox proteins. Secondary structure and fold recognition analyses suggested that the folding of the TlpB C-terminal domain is similar to the folding of the thiol:disulfide oxidoreductase ResA from Bacillus subtilis, a protein which is involved in cytochrome c synthesis (10). These molecules have the thioredoxin fold characteristic of this family of proteins (26).
The start codon of tlpA is located six nucleotides downstream of the tlpB stop codon (Fig. 2A). TlpA consists of 165 amino acids, exhibits sequence similarity with thiol:disulfide oxidoreductase, and has the Cys-X-X-Cys motif (data not shown). It exhibits identity to the TlpA protein (31% identity over 132 amino acids; GenBank accession number NP_811658) of Bacteroides thetaiotaomicron VPI-54 and to the thiol:disulfide oxidoreductase family of proteins, such as COG0526 (30% identity over 169 amino acids; GenBank accession number ZP_00310634) of C. hutchinsonii. Downstream of tlpA (Fig. 2A) is tpiA, whose start codon overlaps the tlpA stop codon. tpiA encodes a predicted triosephosphate isomerase of the glycolytic pathway. The amino acid sequence encoded by F. psychrophilum tpiA is similar to the sequences of triosephosphate isomerases of many microorganisms, such as Porphyromonas gingivalis W83 (51% identity over 248 amino acids; GenBank accession number AAQ65807). A 19-bp inverted repeat sequence (TTTAAAAAAGTAAAACCACCCGAGACGAGTGGTTTTACTTTTTTAAA) that is 11 bp downstream of the stop codon of tpiA may function in transcription termination. Downstream of tpiA and oriented in the opposite direction is the predicted ftsY gene (Fig. 2A). The TAA stop codon of ftsY is located 225 nucleotides from the tpiA stop codon. We do not have the complete coding region of F. psychrophilum ftsY, but the translated partial amino acid sequence exhibits similarity to FtsY proteins of P. gingivalis W83 (86% identity over 73 amino acids; GenBank accession number NP_904493.1) and other microorganisms. FtsY is a component of the signal recognition particle complex that is involved in targeting and integration of inner membrane proteins. fpo1 is upstream of tlpB. The stop codon of fpo1 is 217 nucleotides upstream of the tlpB start codon (Fig. 2A). The sequence of the protein encoded by fpo1 is not similar to the sequences of proteins having known functions.
RT-PCR analysis of the tlpB, tlpA, and tpiA loci.
RT-PCR studies of F. psychrophilum THC02-90 indicated that transcripts corresponding to the tlpB, tlpA, and tpiA genes were present (Fig. 3, lanes 2, 3, and 4). However, as expected, a tlpB transcript was not obtained for FP523 (Fig. 3, lane 8). To determine if the three loci were transcribed as a single mRNA, as suggested by sequence analysis, RT-PCR using primers complementary to the end of a locus and the beginning of the next locus was carried out (Fig. 3). As shown in Fig. 3, lanes 5 and 11, amplicons that were the expected size were generated between tlpB-tlpA (458 bp) and tlpA-tpiA (380 bp) (Fig. 3, lanes 6 and 12), indicating that the three loci are transcribed as a polycistronic mRNA. The operon was designated the fpt operon. Although fpt appears to be an operon, the Tn4351 insertion in tlpB did not eliminate transcription of tlpA and tpiA (Fig. 3, lanes 9 and 10). Transcription of tlpA and tpiA in FP523 is probably driven by a promoter in Tn4351. Tn4351 has promoters reading out of each end and often causes nonpolar mutations in Bacteroides fragilis and F. johnsoniae (20, 49).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 3. RT-PCR analysis of the fpt operon in the RNA of F. psychrophilum THC02-90 and FP523. PCRs were performed with 15 ng of RNA from F. psychrophilum strains using primers RT-A, RT-B, RT-C, RT-D, RT-E, RT-F, RT-G, RT-H, RT-I, and RT-J. As a control for DNA contamination, PCRs were also performed with the primers used for RT-PCR analyses and Taq polymerase. Lanes 1 and 7, 100-bp molecular marker; lanes 2 to 6, RT-PCRs performed with THC02-90 RNA; lanes 8 to 12, RT-PCRs performed with FP523 RNA; lanes 13 to 22, PCRs performed without reverse transcription as negative controls. The following primers were used: RT-A and RT-B for lanes 2, 8, 13, and 18; RT-C and RT-D for lanes 3, 9, 14, and 19; RT-E and RT-F for lanes 4, 10, 15, and 20; RT-G and RT-H for lanes 5, 11, 16, and 21; and RT-I and RT-J for lanes 6, 12, 17, and 22. The map of the fpt operon shows the localization of the primers used for RT-PCR analysis and the lengths of the amplicons obtained.
|
|
Phenotypic characterization of the FP523 mutant.
To further characterize FP523, different phenotypic characteristics were studied. FP523 had a longer lag phase and a slightly lower growth rate than the wild type, and the final cell density was not as high (Fig. 4A). FP523 cultures exhibited basal levels of proteolytic activity that were much lower than the levels observed for the wild type (Fig. 4A). These experiments were conducted at 12°C, but similar results were obtained at 18°C.
Colonies formed in GNA by wild-type strain THC02-90 and mutant FP523 were examined by confocal laser scanning microscopy and phase-contrast microscopy. The cells on the edges of FP523 colonies were perpendicular to the colony radius (Fig. 4B). In contrast, on the edges of THC02-90 colonies we observed flares of cells that were roughly parallel to the colony radius, which resulted in colony spreading (Fig. 4B).
One important factor for bacterial colonization is the development of biofilms. The ability of F. psychrophilum to form biofilms was not known until this study. In fact, the wild-type strain was not able to form biofilms under the culture conditions assayed (data not shown). However, there were clearly biofilms on polystyrene plastic wells after incubation of FP523 in half-strength NB (Fig. 5A). This mutant was not able to form biofilms when it was incubated in undiluted NB. This result revealed that the formation of biofilms depends on the concentration of nutrients. FP523 adherent cells in the biofilms were observed by confocal microscopy (Fig. 5B). Few wild-type cells were found in the glass slide cultures (Fig. 5B), but a well-developed biofilm was formed during culture of the FP523 mutant (Fig. 5B). Wild-type cells of related species, such as Flavobacterium columnare and F. johnsoniae, were not able to form biofilms under the same culture conditions (data not shown).

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 5. (A) Biofilm formation by F. psychrophilum THC02-90, FP523, and complemented FP523, as determined in stained microtiter wells. Microtiter wells containing half-strength NB cultures of the bacterial strains were incubated for 4 days and stained with 0.1% crystal violet (left panel). The four wells for each strain are replicates. The amount of biofilm formed was determined by ethanol solubilization of crystal violet and measuring the absorbance at 525 nm (Abs 525 nm) of the resulting solution (right panel). The error bars indicate standard deviations. (B) Biofilm formation by cells of wild-type strain THC02-90 and mutant FP523. F. psychrophilum cells were incubated on glass slides in half-strength NB for 4 days at 12°C and stained with SYTO 9.
|
|
Inactivation of the tlpB gene did not have any significant effect on the sensitivity to the thiol-specific oxidant diamide or on the sensitivity to menadione and plumbagin, two superoxidizing agents (data not shown). This is consistent with the similar levels of disulfide reductase activity determined for the wild type (0.00391 U/mg protein) and the FP523 strain (0.00413 U/mg protein) after induction with diamide. These results showed that the general redox state was not altered by the mutation. On the other hand, the amount of free thiol groups of periplasmic proteins was about 22% higher in the wild type than in the mutant strain (Fig. 6A), and there was also a clear difference between the sensitivities of the strains to DTT (Fig. 6B). These data strongly suggest that TlpB works as a periplasmic reductase.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6. (A) Levels of reduced periplasmic proteins in F. psychrophilum wild-type strain THC02-90, mutant FP523, and FP523 complemented with plasmid pGA3 (containing tlpB and tlpA loci). Periplasmic proteins isolated from cultures in the late exponential growth phase were mixed with Ellman's reagent at a final concentration of 0.8 mM, and the absorbance at 412 nm (Abs. 412 nm) was determined. The error bars indicate standard deviations. (B) Bioassays showing the DTT sensitivity of F. psychrophilum THC02-90 and FP523. Paper disks were soaked in 100 mM DTT.
|
|
Complementation of tlpB mutant.
Plasmids pGA1, pGA2, and pGA3 were constructed as described in Materials and Methods to complement the FP523 mutant. Introduction of pGA1, which contained tlpB, into the FP523 mutant restored gliding motility and the extracellular proteolytic activity (70% of the wild-type proteolytic activity) (Fig. 2A). In addition, 80% recovery of the proteolytic activity and recovery of the gliding motility phenotype and the level of periplasmic thiol groups (Fig. 6A) were observed when plasmid pGA3, which contained the tlpB and tlpA loci, was used in the complementation analysis. In contrast, plasmid pGA2, which contained only tlpA, did not complement FP523. The complemented FP523 strains containing pGA1 and pGA3 were like the wild type in that they were not able to attach efficiently to a surface (Fig. 2A). The results of quantification of biofilm formation by the crystal violet assay are shown in Fig. 5A. As expected, the FP523 mutant containing plasmid pGA1 or pGA3 did not form a biofilm (Fig. 2A and 5A). Thus, disruption of the tlpB gene resulted in loss of motility and promoted biofilm formation. All these findings indicate that tlpB is involved in the biofilm formation pathway, in addition to gliding motility, suggesting that these two cellular processes are in some way antagonistic in F. psychrophilum.
Cytopathic effects and LD50.
In order to determine the cytotoxicity for fish culture cells, wild-type F. psychrophilum strain THC02-90 and the FP523 mutant were incubated with bluegill sunfish BF2 cells, a fibroblastic cell line. There was a clear difference in the cytopathic effects on BF2 cells exposed to similar concentrations of the wild-type and FP523 mutant strains. Addition of wild-type F. psychrophilum cells resulted in lysis of the BF2 cells, whereas addition of cells of the tlpB mutant had no effect on the sunfish cells (data not shown).
Rainbow trout were infected with wild-type and FP523 mutant cells to determine the effect of the mutation on virulence. Ten days after infection the calculated LD50s of the mutant and wild-type strains were 8.37 x 106 and 1.03 x 105, respectively. The approximately 80-fold difference between the two strains indicates that disruption of tlpB results in attenuation of F. psychrophilum virulence.
 |
DISCUSSION
|
|---|
In spite of the importance of cold water disease and the interest in F. psychrophilum, there are many aspects of this bacterium that are still not known. In the present study, genetic techniques that were recently developed for manipulation of F. psychrophilum (3) were used to obtain a set of mutants with mutations in extracellular proteolytic activities, gliding motility, and iron dependence. Some mutants were affected in only one of the phenotypic characteristics, whereas in others there were two or more phenotypic alterations. Gliding motility mutants of F. johnsoniae which exhibit pleiotropic effects have been isolated previously (28, 29). These mutants were unable to degrade chitin and were resistant to phage infection (27). One the pleiotropic mutants of F. psychrophilum, FP523, was chosen for further study. This mutant had defects in extracellular proteolytic activity, gliding motility, and growth in iron-deprived medium.
The gene disrupted in the FP523 pleiotropic mutant, tlpB, encodes a putative membrane-anchored thiol:disulfide oxidoreductase. Such proteins form disulfide bonds in unfolded proteins, reduce disulfide bonds to dithiols, or reduce for isomerization and reoxidation when undesirable disulfide bonds are formed. Oxidative formation of disulfide bonds is necessary for correct folding and assembly of secreted proteins in prokaryotes. The thiol:disulfide oxidoreductases have a Cys-X-X-Cys motif in the active site. The two cysteines that are present in this motif react with cysteines or cystines in the target molecules (13, 37). TlpB has the motif C260-D-H-C263 and a proline at position 227 which is highly conserved in redox proteins (26). Thiol:disulfide oxidoreductases exhibit very low primary sequence similarity, but most of them have the same overall tertiary structure, known as the thioredoxin-like fold (26).
Mutations in E. coli genes that code for thiol:disulfide oxidoreductases lead to pleiotropic effects. For example, dsbA mutations have severe effects on flagellar motility, resistance to reduced DTT and benzylpenicillin, infection with phage M13, sensitivity to Cd2+, Zn2+, and Hg2+, and other processes in which proteins need disulfide bonds in order to function. Similar results were obtained for Pseudomonas aeruginosa (17). Therefore, the effects of disruption of tlpB on the growth rate, growth in iron-deprived conditions, extracellular proteolytic activity, gliding motility, and virulence are consistent with the effects found in other bacterial mutants with mutations in genes encoding thiol:disulfide oxidoreductases. Perhaps the most surprising effect of the mutation in tlpB is activation of biofilm formation. Until now, biofilm formation had not been described for members of the genus Flavobacterium. The most interesting finding is that when the FP523 mutant was complemented in trans with the tlpB or tlpB-tlpA genes, it exhibited proteolytic activity and gliding motility and simultaneously lost the capacity to produce biofilms. Gliding motility and biofilm formation may be mutually exclusive in F. psychrophilum, or TlpB may indirectly affect motility and biofilm formation in different ways. To our knowledge, antagonism between motility and biofilm formation has not been reported previously, although flagellum-dependent motility has been related to adhesion, biofilm formation, and colonization in P. aeruginosa (7, 17), Vibrio cholerae (15), Vibrio vulnificus (23), E. coli (42), and Caulobacter crescentus (12).
The results of the disulfide reductase assay, together with the results obtained using compounds such as diamide, menadione, and plumbagin, indicate that TlpB is not involved in maintaining the redox state of the cytoplasm. However, the increase in sensitivity to DTT and the decrease in the number of thiol groups of periplasmic proteins in the mutated strain strongly suggest that TlpB plays a reducing role in the periplasm. Thus, as a putative inner membrane protein, TlpB is functionally similar to the DsbD proteins of E. coli and other bacteria (8, 13, 35, 41). This protein seems to play a role in folding secreted proteins, and when it is absent, there are pleiotropic effects, like those that occur in different dsb mutants of several bacteria (13, 17, 35, 37, 40, 51, 54). In the FP523 mutant, biofilm formation could be the result of a stress response induced by misfolding of proteins in the periplasmic space, as occurred with activation of the heat shock system in the E. coli dsbA and dsbC mutants (31, 44). Different stress response regulators are involved in triggering biofilm formation in E. coli, Staphyloccus aureus, P. aeruginosa, and Streptococcus mutans (1, 43, 52, 53). Therefore, external conditions or a specific genetic background of the bacteria with alterations in the function of a subset of proteins could generate a stress response and induce biofilm formation. In spite of its capacity to form biofilms, the FP523 mutant was less virulent than the wild-type strain. FP523 has simultaneously altered putative virulence factors, such as extracellular proteolytic activities, the iron uptake system, motility, etc. Thus, the balance of the multiple effects caused by the mutation on the different putative virulence factors seems to result in attenuation of the mutant both in in vivo experiments and in the toxic effect on cell cultures.
tlpA, which is immediately downstream of tlpB, codes for another predicted thiol:disulfide oxidoreductase. In this case, the level of similarity of TlpA with the thiol:disulfide oxidoreductase family of proteins is higher. TlpA has the thioredoxin motif C65-G-D-C68 and the conserved proline (P133). Moreover, it also has the thioredoxin-like fold. We do not have a tlpA mutant, so the exact function of this gene is not known. tlpA is expressed in FP523, presumably from a Tn4351 promoter. This result, together with the complementation data, indicates that the phenotypes described in this paper are probably not the result of effects on tlpA expression. However, introduction of both tlpB and tlpA into cells of FP523 resulted in a 10% increase in the proteolytic activity compared with the results obtained when only tlpB was used. This result could have been due to nonspecific additive enzyme activity or to a simple genetic dose effect for the presence of the plasmid harboring multiple copies of the genes in the cell. The third locus of the fpt operon, the putative triosephosphate isomerase-encoding gene tpiA, is involved mainly in the glycolysis pathway. However, a triosephosphate isomerase gene was specifically expressed in S. aureus during biofilm formation (5), indicating that there is some relationship between this enzyme and biofilm development.
In conclusion, here we describe isolation of mutants of F. psychrophilum. One of these mutants, the FP523 mutant, was affected in the tlpB gene encoding a novel protein which has a putative thiol:disulfide oxidoreductase domain, which is necessary for efficient gliding motility of the bacterium. Disruption of the tlpB gene led to biofilm formation. This gene is part of the fpt operon, and studies to define the roles of this operon and the importance and relationship of the different loci in the behavior of this bacterium have been started. Finally, clear attenuation of the virulence of the FP523 mutant was observed. This result, together with the lack of cytopathic effects of the mutant on BF2 cells, shows the importance of the tlpB gene in the pathogenic process.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported by grant AGL2003-229 from the MEC of Spain. B.A. was the recipient of a grant from FICYT.
We thank A. Manteca, J. Álvarez, D. Rodríguez, L. M. Quirós, J. F. Aparicio, F. Lombó, and S. Cal for useful comments, assistance, and advice concerning different techniques; M. D. Chiara for facility support for the RT-PCR analysis; P. Solano for contributing to the BF2 cell experiments; and I. Márquez for performing the LD50 experiments. Also, we thank A. F. Braña and L. Fernández for critical reading and correction of the manuscript.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Microbiología, Facultad de Medicina, Universidad de Oviedo, 33006 Oviedo, Asturias, Spain. Phone: 34985104218. Fax: 34985103148. E-mail: jaga{at}fq.uniovi.es. 
 |
REFERENCES
|
|---|
- Adams, J. L., and R. J. McLean. 1999. Impact of rpoS delection on Escherichia coli biofilm. Appl. Environ. Microbiol. 65:4285-4287.[Abstract/Free Full Text]
- Agarwal, S., D. W. Hunnicutt, and M. J. McBride. 1997. Cloning and characterization of the Flavobacterium johnsoniae (Cytophaga johnsonae) gliding motility gene, gldA. Proc. Natl. Acad. Sci. USA 94:12139-12144.[Abstract/Free Full Text]
- Álvarez, B., P. Secades, M. J. McBride, and J. A. Guijarro. 2004. Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum. Appl. Environ. Microbiol. 70:581-587.[Abstract/Free Full Text]
- Ames, G. F.-L., C. Prody, and S. Kustu. 1984. Simple, rapid, and quantitative release of periplasmic proteins by chloroform. J. Bacteriol. 160:1181-1183.[Abstract/Free Full Text]
- Becker, P., W. Hufnagle, G. Paters, and M. Herrmann. 2001. Detection of differential gene expression in biofilm-forming versus planktonic population of Staphylococcus aureus using microrepresentational-difference analysis. Appl. Environ. Microbiol. 67:2958-2965.[Abstract/Free Full Text]
- Bertolini, J. M., H. Wakabayashi, V. G. Watral, M. J. Whipple, and J. S. Rohovec. 1994. Electrophorectic detection of proteases from selected strains of Flexibacter psychrophilus and assessment of their variability. J. Aquat. Anim. Health 6:224-233.[CrossRef]
- Choy, W.-K., L. Zhou, C. K.-C. Syn, L.-H. Zhang, and S. Swarup. 2004. MorA defines a new class of regulators affecting flagellar development and biofilm formation in diverse Pseudomonas species. J. Bacteriol. 186:7221-7228.[Abstract/Free Full Text]
- Chung, J., T. Chen, and D. Missiakas. 2000. Transfer of electrons across the cytoplasmic membrane by DsbD, a membrane protein involved in thiol-disulphide exchange and protein folding in bacterial periplasm. Mol. Microbiol. 35:1099-1109.[CrossRef][Medline]
- Cooper, A. J., A. P. Kalinowski, N. B. Shoemaker, and A. A. Salyers. 1997. Construction and characterization of a Bacteroides thetaiotaomicron recA mutant: transfer of Bacteroides integrated conjugative elements is recA independent. J. Bacteriol. 179:6221-6227.[Abstract/Free Full Text]
- Crow, A., R. M. Acheson, N. E. Le Brun, and A. Oubrie. 2004. Structural basis of redox-couple protein substrate selection by the cytochrome c biosynthesis protein ResA. J. Biol. Chem. 279:23654-23660.[Abstract/Free Full Text]
- Del Cerro, A., M. C. Mendoza, and J. A. Guijarro. 2002. Usefulness of a TaqMan-based polymerase chain reaction assay for the detection of the fish pathogen Flavobacterium psychrophilum. J. Appl. Microbiol. 93:149-156.[CrossRef][Medline]
- Entcheva-Dimitrov, P., and A. M. Spormann. 2004. Dynamics and control of biofilm of the oligotrophic bacterium Caulobacter crescentus. J. Bacteriol. 186:8254-8266.[Abstract/Free Full Text]
- Fabianek, R. A., H. Hennecke, and L. Thony-Meyer. 2000. Periplasmic protein thiol:disulfide oxidoreductases of Escherichia coli. FEMS Microbiol. Rev. 24:303-316.[CrossRef][Medline]
- Garcia, C., F. Pozet, and C. Michel. 2000. Standardization of experimental infection with Flavobacterium psychrophilum, the agent of rainbow trout Onchorhynchus mykiss fry syndrome. Dis. Aquat. Org. 42:191-197.[Medline]
- Gardel, C. L., and J. J. Mekalanos. 1996. Alteration in Vibrio cholerae motility phenotypes correlate with changes in virulence factor expression. Infect. Immun. 64:2246-2255.[Abstract]
- Gardy, J. L., M. R. Laird, F. Chen, S. Rey, C. J. Walsh, M. Ester, and F. S. L. Brinkman. 2005. PSORTb v. 2.0: expanded prediction of bacterial protein subcellular localization and insights gained from comparative proteome analysis. Bioinformatics 21:617-623.[Abstract/Free Full Text]
- Ha, U.-H., Y. Wang, and S. Jin. 2003. DsbA of Pseudomonas aeruginosa is essential for multiple virulence factors. Infect. Immun. 71:1590-1595.[Abstract/Free Full Text]
- Holmgren, A. 1977. Bovine thioredoxin system. J. Biol. Chem. 252:4600-4606.[Free Full Text]
- Hunnicutt, D. W., M. J. Kempf, and M. J. McBride. 2002. Mutations in Flavobacterium johnsoniae gldF and gldG disrupt gliding motility and interfere with membrane localization of GldA. J. Bacteriol. 184:2370-2378.[Abstract/Free Full Text]
- Hunnicutt, D. W., and M. J. McBride. 2000. Cloning and characterization of the Flavobacterium johnsoniae gliding-motility genes gldB and gldC. J. Bacteriol. 182:911-918.[Abstract/Free Full Text]
- Hunnicutt, D. W., and M. J. McBride. 2001. Cloning and characterization of the Flavobacterium johnsoniae gliding motility genes gldD and gldE. J. Bacteriol. 183:4167-4175.[Abstract/Free Full Text]
- Kelley, L. A., R. M. MacCallum, and M. J. Stember. 2000. Enhanced genome annotation using structural profiles in the program 3D-PSSM. J. Mol. Biol. 299:499-520.[Medline]
- Lee, J.-H., J. B. Rho, K.-J. Park, C. B. Kim, Y.-S. Han, S. H. Choi, K.-H. Lee, and S.-J. Park. 2004. Role of flagellum and motility in pathogenesis of Vibrio vulnificus. Infect. Immun. 72:4905-4910.[Abstract/Free Full Text]
- Luthman, M., and A. Holmgren. 1982. Rat liver thioredoxin and thioredoxin reductase: purification and characterization. Biochemistry 21:6628-6633.[CrossRef][Medline]
- Mahan, M. J., J. W. Tobias, J. M. Slauch, P. C. Hanna, R. J. Collier, and J. J. Mekalanos. 1995. Antibiotic-based selection for bacterial genes that are specifically induced during infection of a host. Proc. Natl. Acad. Sci. USA 92:669-673.[Abstract/Free Full Text]
- Martin, J. L. 1995. Thioredoxin: a fold for all reasons. Structure 3:245-250.[Medline]
- McBride, M. J. 2004. Cytophaga-Flavobacterium gliding motility. J. Mol. Microbiol. Biotechnol. 7:63-71.[CrossRef][Medline]
- McBride, M. J., and T. F. Braun. 2004. GldI is a lipoprotein that is required for Flavobacterium johnsoniae gliding motility and chitin utilization. J. Bacteriol. 186:2295-2302.[Abstract/Free Full Text]
- McBride, M. J., T. F. Braun, and J. L. Brust. 2003. Flavobacterium johnsoniae GldH is a lipoprotein that is required for gliding motility and chitin utilization. J. Bacteriol. 185:6648-6657.[Abstract/Free Full Text]
- McGuffin, L. J., K. Bryson, and D. T. Jones. 2000. The PSIPRED protein structure prediction server. Bioinformatics 16:404-405.[Abstract/Free Full Text]
- Mecsas, J., P. E. Rouviere, J. W. Erickson, T. J. Donohue, and C. A. Gross. 1993. The activity of sigma E, an Escherichia coli heat-inducible sigma-factor, is modulated by expression of outer membrane proteins. Genes Dev. 7:2618-2628.[Abstract/Free Full Text]
- Metcalf, W. W., W. Jiang, and B. L. Wanner. 1994. Use of the rep technique for allele replacement to construct new Escherichia coli hosts for maintenance of R6K
origin plasmids at different copy numbers. Gene 138:1-7.[CrossRef][Medline] - Michel, C., D. Antonio, and R. P. Hedrick. 1999. Production of viable cultures of Flavobacterium psychrophilum approach and control. Res. Microbiol. 150:351-358.[Medline]
- Missiakas, D., and S. Raina. 1997. Protein folding in the bacterial periplasm. J. Bacteriol. 179:2465-2471.[Free Full Text]
- Missiakas, D., F. Schwager, and S. Raina. 1995. Identification and characterization of a new disulfide isomerase-like protein (DsbD) in Escherichia coli. EMBO J. 14:3415-3424.[Medline]
- Møller, J. D., J. L. Larsen, L. Madsen, and I. Dalsgaard. 2003. Involvement of a sialic acid-binding lectin with hemagglutination and hydrophobicity of Flavobacterium psychrophilum. Appl. Environ. Microbiol. 69:5275-5280.[Abstract/Free Full Text]
- Nakamoto, H., and J. C. A. Bardwell. 2004. Catalysis of disulfide bond formation and isomerization in the Escherichia coli periplasm. Biochem. Biophys. Acta 1694:111-119.[Medline]
- Nematollahi, A., A. Decostere, F. Pasmas, and F. Haesebrouck. 2003. Flavobacterium psychrophilum infections in salmonid fish. J. Fish Dis. 26:563-574.[CrossRef][Medline]
- Nematollahi, A., A. Decostere, F. Pasmas, R. Ducatelle, and F. Haesebrouck. 2003. Adhesion of high and low virulence Flavobacterium psychrophilum strains to isolated gill arches of rainbow trout Oncorhynchus mykiis. Dis. Aquat. Org. 55:101-107.[Medline]
- Peek, J. A., and R. K. Taylor. 1992. Characterization of a periplasmic thiol:disulfide interchange protein required for the functional maturation of secreted virulence factors of Vibrio cholerae. Proc. Natl. Acad. Sci. USA 89:6210-6214.[Abstract/Free Full Text]
- Porat, A., S.-H. Cho, and J. Beckwith. 2004. The unusual transmembrane electron transporter DsbD and its homologues: a bacterial family of disulfide reductases. Res. Microbiol. 155:617-622.[Medline]
- Pratt, L. A., and R. Kolter. 1998. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol. Microbiol. 30:285-293.[CrossRef][Medline]
- Rachid, S., K. Ohlsen, U. Wallner, J. Hacker, M. Hecker, and W. Ziebuhr. 2000. Alternative transcription factor
B is involved in regulation of biofilm in a Staphylococcus aureus mucosal isolate. J. Bacteriol. 182:6824-6826.[Abstract/Free Full Text] - Raina, S., D. Missiakas, and C. Georgopoulos. 1995. The rpoE gene encoding the sigma E (sigma 24) heat shock sigma factor of Escherichia coli. EMBO J. 14:1043-1055.[Medline]
- Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27:493-497.
- Secades, P., B. Álvarez, and J. A. Guijarro. 2001. Purification and characterization of a psychrophilic calcium-induced, growth-phase-dependent metalloprotease from the fish pathogen Flavobacterium psychrophilum. Appl. Environ. Microbiol. 67:2436-2444.[Abstract/Free Full Text]
- Secades P., B. Álvarez, and J. A. Guijarro. 2003. Purification and properties of a new psychrophilic metalloprotease (Fpp2) in the fish pathogen Flavobacterium psychrophilum. FEMS Microbiol. Lett. 226:273-279.[Medline]
- Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Bio/Technology 1:784-791.[CrossRef]
- Smith, C. J., M. B. Rogers, and M. L. McKee. 1992. Heterologous gene expression in Bacteroides fragilis. Plasmid 27:141-154.[CrossRef][Medline]
- Soule, M., K. Cain, S. LaFrentz, and D. R. Call. 2005. Combining suppression subtractive hybridization and microarrays to map the intraspecies phylogeny of Flavobacterium psychrophilum. Infect. Immun. 73:3799-3802.[Abstract/Free Full Text]
- Stenson, T. H., and A. A. Weiss. 2002. DsbA and DsbC are required for secretion of pertussis toxin by Bordetalle pertussis. Infect. Immun. 70:2297-2303.[Abstract/Free Full Text]
- Whiteley, M., M. G. Bangera, R. E. Bumgarner, M. R. Parsek, G. M. Teitzeil, S. Lory, and E. P. Greenberg. 2001. Gene expression in Pseudomonas aeruginosa biofilm. Nature 413:860-864.[CrossRef][Medline]
- Yoshida, A., and H. K. Kuramitsu. 2002. Multiple Streptococcus mutants genes are involved in biofilm formation. Appl. Environ. Microbiol. 68:6283-6291.[Abstract/Free Full Text]
- Yu, J., and J. S. Kroll. 1999. DsbA: a protein-folding catalyst contributing to bacterial virulence. Microbes Infect. 1:1221-1228.[CrossRef][Medline]
Applied and Environmental Microbiology, June 2006, p. 4044-4053, Vol. 72, No. 6
0099-2240/06/$08.00+0 doi:10.1128/AEM.00128-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Alvarez, B., Alvarez, J., Menendez, A., Guijarro, J. A.
(2008). A mutant in one of two exbD loci of a TonB system in Flavobacterium psychrophilum shows attenuated virulence and confers protection against cold water disease. Microbiology
154: 1144-1151
[Abstract]
[Full Text]
-
Chen, S., Bagdasarian, M., Kaufman, M. G., Walker, E. D.
(2007). Characterization of Strong Promoters from an Environmental Flavobacterium hibernum Strain by Using a Green Fluorescent Protein-Based Reporter System. Appl. Environ. Microbiol.
73: 1089-1100
[Abstract]
[Full Text]