Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) An erratum has been published Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Baptista, I. I. R. Articles by Livingston, A. G. Search for Related Content PubMed PubMed Citation Articles by Baptista, I. I. R. Articles by Livingston, A. G. Agricola Articles by Baptista, I. I. R. Articles by Livingston, A. G.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, June 2006, p. 4411-4418, Vol. 72, No. 6
0099-2240/06/$08.00+0     doi:10.1128/AEM.02576-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Stability and Performance of Xanthobacter autotrophicus GJ10 during 1,2-Dichloroethane Biodegradation

Ines I. R. Baptista,¹ Ludmila G. Peeva,¹ Ning-Yi Zhou,^2, David J. Leak,² Athanasios Mantalaris,¹ and Andrew G. Livingston^1*

Department of Chemical Engineering and Chemical Technology,¹ Department of Biological Sciences, Imperial College London, Prince Consort Road, SW7 2BY London, United Kingdom²

Received 1 November 2005/ Accepted 5 April 2006

Top Abstract Introduction Materials and Methods Results Discussion References

 
A nucleic acid-based approach was used to investigate the dynamics of a microbial community dominated by Xanthobacter autotrophicus GJ10 in the degradation of synthetic wastewater containing 1,2-dichloroethane (DCE). This study was performed over a 140-day period in a nonsterile continuous stirred-tank bioreactor (CSTB) subjected to different operational regimens: nutrient-limiting conditions, baseline operation, and the introduction of glucose as a cosubstrate. The microbial community was analyzed by a combination of fluorescence in situ hybridization (FISH) and denaturing gradient gel electrophoresis (DGGE). Under nutrient-limiting conditions, DCE degradation was restricted, but this did not affect the dominance of strain GJ10, determined by FISH to comprise 85% of the active population. During baseline operation, DCE degradation improved significantly to over 99.5% and then remained constant throughout the subsequent experimental period. DGGE profiles revealed a stable, complex community, while FISH indicated that strain GJ10 remained the dominant species. During the addition of glucose as a cosubstrate, DGGE profiles showed a proliferation of other species in the CSTB. The percentage of strain GJ10 dropped to 8% of the active population in just 5 days, although this did not affect the DCE biodegradation performance. The return to baseline conditions was accompanied by the reestablishment of strain GJ10 as the dominant species, suggesting that this system responds robustly to external perturbations, both at the functional biodegradation level and at the individual strain level.

Top Abstract Introduction Materials and Methods Results Discussion References

 
1,2-Dichloroethane (DCE) is a halogenated compound widely used in industry, commonly for the production of vinyl chloride. It is a toxic and potentially carcinogenic compound, and so its emissions have to be minimized by following strict environmental regulations (public health statement for 1,2-dichloroethane; Agency for Toxic Substances and Disease Registry, http://www.atsdr.cdc.gov/toxprofiles/phs38.html). One strategy to reduce the environmental impact of such hazardous compounds is to implement point source treatment technologies, preventing dilution of other uncontaminated streams by dealing with the hazardous waste close to its point of emission (11). Biotreatment systems are one point source treatment option. However, due to the recalcitrance of most chlorinated compounds, only relatively few bacterial strains (specific strains) have been identified as possessing the capability to mineralize them (17, 26).

The application of these specific strains to industrial situations can be difficult, as typical operating conditions, such as nonsterile long-term operation and dynamic waste production regimens, can be challenging (20, 34). There is evidence that in long-term nonsterile operation, some of these specific bacterial strains can be outcompeted by other nonspecific microorganisms, and regular reinoculation might be necessary to maintain the strain and the specific biodegradation capability (4, 23).

The application of biomolecular techniques for analysis of biotreatment systems has provided insight into dynamics of specific microorganisms involved in degradation processes (6). Fluorescence in situ hybridization (FISH) (2) and denaturing gradient gel electrophoresis (DGGE) (24) are two powerful techniques which together allow the quantification and detection of strains of interest while providing an indication of community complexity and dynamics over time (5, 19, 36). Prior to the availability of these techniques, it was often assumed or implied that constant functional performance was sustained by a stable community. However, recent studies based on biomolecular techniques have revealed that these communities can in fact be highly dynamic (10, 18, 38). In contrast, some authors have reported stable communities under dynamic functional conditions (9, 21, 32). Interestingly, Smith et al. (29) have shown that even a complex community, such as that found in activated sludge, can exhibit stable long-term behavior even when exposed to perturbations at the functional level. These recent microbial dynamics studies have demonstrated that community stability is not necessarily correlated to functional stability. While these previous reports have considered mixed cultures degrading single substrates, it would be interesting to investigate the stability of a specific strain, and the dynamics of the associated community, in the degradation of a recalcitrant compound. In point source biotreatment applications in which biodegradation of toxic and/or recalcitrant compounds is dependent on specific strains, this investigation becomes important to outline strategies to avoid treatment disruption.

Here we investigated the stability of Xanthobacter autotrophicus GJ10 degrading DCE present in synthetic wastewater. The microbial dynamics and the continuous stirred-tank bioreactor (CSTB) functional performance, in terms of DCE degradation, were analyzed under (i) nutrient-limiting conditions, (ii) baseline operating conditions, and (iii) addition of glucose as a cosubstrate. A combination of FISH and DGGE was used to quantify and characterize the microbial community.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Bacteria and growth conditions.
Xanthobacter autotrophicus strain GJ10 (ATCC 43050) (kindly provided by D. Janssen from the University of Groningen, Groningen, The Netherlands) can utilize DCE as a sole source of carbon and energy. Strain GJ10 was initially grown in shake flasks at 30°C under aerobic conditions. The flasks were tightly closed to prevent DCE evaporation and filled to one-fifth of their capacity with mineral medium (15). Ninety-nine percent pure DCE (Sigma, United Kingdom) was added to a final concentration of 5 mM.

CSTB.
The total volume of the reactor was 2.6 liters, with a working volume of 2.3 liters, and the stirring speed was set at 220 rpm. The pH was controlled by addition of NaOH (1 M) and maintained at 7.00 ± 0.1 throughout the experiment. The temperature of the biomedium was maintained at 30°C and the oxygen saturation was always above 30% (Mettler Toledo Ltd, Leicester, United Kingdom). The bioreactor was inoculated with the GJ10 shake flask culture and operated under nonsterile conditions. A mineral medium (15) was used at a flow rate of 0.020 liter h^–1 until day 45; this was followed by enrichment with 0.5 g liter^–1 of (NH₄)₂SO₄ supplied at 0.027 liter h^–1. The concentration of DCE in the synthetic wastewater was ca. 3 g liter^–1 and it was supplied at a flow rate of 0.048 liter h^–1 until day 45 and afterwards at 0.064 liter h^–1. On day 109, glucose was added to the synthetic wastewater at a concentration of 2 g liter^–1 for a period of 13 days.

Analytical methods.
The DCE concentration in the liquid feed and in the CSTB outlet was analyzed using a gas chromatograph (GC; Agilent Technologies, Wokingham, United Kingdom) with a flame ionization detector and a column (30 m by 0.318 mm by 35 µm; J&W Scientific, Agilent Technologies) with an HP-1 stationary phase. DCE present in the liquid phase was analyzed by extracting into 2.5 ml of n-decane 8 ml of sample and injecting 1 µl into the GC. The starting temperature was 40°C, which was maintained for 2 min, increased by 20°C min^–1 to 90°C, and then increased by 40°C min^–1 to 260°C. DCE present in the gas outlet was analyzed by directly injecting 25 µl of sample into the GC. The temperature was set at 40°C for 2 min and increased by 20°C min^–1 to 70°C. The coefficient of variation was 0.2% at a concentration of 24 mg liter^–1. The glucose concentration in the biomedium was analyzed by high-pressure liquid chromatography (Gilson, United Kingdom) with a UV detector. The samples were centrifuged and filtered through a 0.2-µm filter to eliminate bacteria and suspended solids. A sample was injected into the column (50 mm by 2.00 mm by 3 µm) with a C₁₈ stationary phase (Luna, Phenomenex), and the mobile phase was water. Glucose was detected at 190 nm, and its concentration was determined based on a calibration curve. Chloride concentration was analyzed by ion chromatography (Dionex DX 120 with an IonPAC AS114 4- by 250-mm column; Camberley, United Kingdom). The mobile phase was 3.5 mM Na₂CO₃ and 1.0 mM NaHCO₃ at 1.1 ml min^–1. To analyze the cations, the mobile phase used was 19 mM CH₄O₃S (IonPAC CS12A column; Dionex). The samples were centrifuged and filtered through a 0.2-µm filter to eliminate bacteria and suspended solids.

The biomass was measured at 660 nm on a UV-Vis spectrophotometer (Unicam, United Kingdom). The absorbance was correlated with dry weight to determine the actual biomass concentration. Carbon dioxide was determined using an isothermal GC (GC-14A; Shimadzu, Milton Keynes, United Kingdom) fitted with a thermal conductivity detector. Samples were injected at 128°C into a Porapak N column (2 m by 2 mm; Alltech Associates Applied Science Ltd, Carnforth, United Kingdom) packed with dininylbenzene-vinyl pyrrodinone at 28°C. The coefficient of variation for five samples was 2.6% at a concentration of 0.03% (vol/vol) carbon dioxide. Total organic carbon was measured with a Shimadzu 5050 total organic carbon analyzer. The biomass and any remaining solids were removed from the biomedium via centrifugation and filtration. The coefficient of variation for three samples was 0.5% at a concentration of 500 g m^–3 of carbon.

Sample collection and preparation for microbial analysis.
Samples were collected from the biomedium through the sampling port and washed in phosphate-buffered saline (PBS; 1.040 g of Na₂HPO₄, 0.332 g of NaH₂PO₄, and 0.754 g of NaCl per liter). The samples were resuspended twice in 1 ml PBS and 10 µl of 0.1% (wt/wt) Igepal (Sigma, United Kingdom). Six µl of this cell suspension was added to each spot of a Teflon-coated slide with eight wells (Erie Scientific Company) coated with a thin layer of gelatin (0.1% [wt/vol]) and KCr(SO₄)₂ (0.01% [wt/vol]). After air drying, the slides were dehydrated in a series of ascending ethanol concentrations (50, 80, and 100% [vol/vol]) for 3 min each step.

Oligonucleotide probes and in situ hybridization.
The oligonucleotide probes used are listed in Table 1 and were labeled at the 5' end with fluorescein isothiocyanate (FITC) or Cy3 (Thermo Electron GmbH, Dreieich, Germany). A 9-µl aliquot of hybridization buffer (0.9 M NaCl, 20 mM Tris-HCl, 0.1% [vol/vol] sodium dodecyl sulfate, 15% [vol/vol] of formamide) was placed on each spot. One µl of specific strain GJ10 probe and 1 µl (50 ng µl^–1) of either EUB338I, NonEUB338, or ARCH344 probe were applied on each spot. The NonEUB338 probe was used as a negative control to test the specificity of hybridization, and the ARCH344 probe was sporadically used to assess whether any archaea were present. The slides were placed in an equilibrated humidity chamber at 35°C for 2 h to hybridize. The slides were thereafter rinsed with distilled water and immersed in a washing buffer (20 mM Tris-HCl, 0.1% [wt/vol] sodium dodecyl sulfate, and 0.34 M of NaCl) for 15 min at 50°C; this was followed by rinsing with distilled water and air drying. Before microscopic analysis, DAPI (4',6'-diamidino-2-phenylindole) was added to each spot for 2 min. Finally, the slides were rinsed with distilled water, air dried, and mounted with Citifluor medium (Citifluor Ltd, United Kingdom). The slides were analyzed using a fluorescence microscope (Olympus BX51; Middlesex, United Kingdom) equipped with a digital photographic camera (Olympus DP 50). Images were acquired using specialized imaging software (AnalySIS—Soft Imaging System version 3.2; Helperby, United Kingdom). At least 10 randomly selected pictures were taken per sampling event and the cells were counted manually. Two quantitative ratios were determined: total staining (Ts), corresponding to the ratio between the number of cells hybridized with EUB338I probe and the total number of cells stained with DAPI; and specific staining (Ss), corresponding to the ratio between the cells hybridized with the specific strain GJ10 probe and the cells hybridized with the EUB338I probe. Viability cell analysis was performed with DAPI and propidium iodide according to the method of Koutinas et al. (20).

View this table: [in this window] [in a new window]

TABLE 1. Probes used in this study

Plate counting.
Samples taken from the biomedium were serially diluted and spread onto nutrient agar plates (5.0 g peptone, 3.0 g beef extract, 8.0 g NaCl, and 15 g agar per liter). They were incubated at 30°C, and emerging colonies were counted for 1 week. Colonies of X. autotrophicus GJ10 were identified by their characteristic yellow color.

DNA extraction and PCR.
Bacterial samples were harvested from the reactor and washed in PBS. DNA extraction was performed using an UltraClean microbial genomic isolation kit (MoBio; Carlsbad) according to the manufacturer's instructions. The primers (MWG Biotech, Ebersberg, Germany) 518R (5' ATTACCGCGGCTGCTGG 3') and GC-341F (5' CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAGCAG 3') targeting the V3 region of the 16S rRNA gene were used for the amplification of DNA fragments corresponding to bases 341 through 518 with reference to the Escherichia coli sequence. The PCRs were performed using 1 µl of DNA template and 24 µl of a PCR mix (3 mM of MgCl₂, 0.5x NH₄SO₄ PCR buffer, 0.5x KCl PCR buffer, 200 µM of deoxynucleoside triphosphates, 0.3 µM of each primer, and 1 U of Taq DNA polymerase [Fermentas, Lithuania]). The following cycle conditions were used for the PCR: 5 min at 94°C followed by 30 cycles of 30 s at 92°C, 30 s at 55°C, and 30 s at 72°C and by a final extension step of 7 min at 72°C. The products were examined by electrophoresis on a 2% agarose gel before applying them to DGGE.

DGGE analysis.
DGGE was performed in a total mutation detection system (Ingeny International, Goes, The Netherlands). The products of the PCR were mixed with 6 µl of DNA loading buffer and then were loaded onto a 10% polyacrylamide gel (37.5:1 ratio of acrylamide to bisacrylamide) prepared with a denaturing gradient of 40% to 70% (100% denaturing gradient corresponds to 7 M urea and 40% formamide [Sigma, United Kingdom]). Electrophoresis was performed at 20 V for 15 min and then at 100 V for 14 h in 1x TAE (Tris-acetate-EDTA) buffer at a constant temperature of 60°C. The gel was then stained in ethidium bromide (1% solution; Sigma, United Kingdom) for 15 min and washed in distilled water before being observed under a UV illuminator (Alpha Innotech, San Leandro, CA). The DGGE gel profiles were manually scored based on the presence and absence of comigrating bands by three different operators, to ensure consistent results. To compare the individual DGGE profiles to each other, the Dice similarity coefficient (Dc), which is defined by the ratio between the number of common bands among two given profiles and the combined total number of bands of these two profiles (12, 21), was used. A Dc value of 1 indicates identical profiles, while a Dc value of 0 indicates totally dissimilar profiles.

Sequence analysis.
Prominent bands were excised from the gel and DNA was eluted in distilled sterile water overnight. A PCR was carried out as described previously, but using 2 µl of template DNA from each band, and the products were run in a new DGGE gel to check its purity. For sequencing, a new PCR was performed with 2 µl of template DNA from each band and non-GC-clamped primers (341F; 5' ACTCCTACGGGAGGCAGCAG 3'). These products were purified using a QIAquick PCR purification kit (QIAGEN) according to the kit's instructions. The resulting DNA was sequenced at the Advanced Biotechnology Centre, Imperial College London, London, United Kingdom, and the derived sequences were investigated using the sequence match analysis tool from the Ribosomal Database Project II version 9 (8).

Nucleotide sequence accession numbers.
The sequences obtained in this study have been deposited in GenBank under accession no. DQ471346 to DQ471352.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Bioreactor functional performance.
The CSTB was run over a period of 142 days under the operating conditions summarized in Table 2. As indicated, the operation was divided into four stages according to the dilution rate and carbon source fed into the reactor. The purpose of these stages was to evaluate the functional performance of the reactor in terms of DCE degradation, when the microbial culture was subjected to nutrient limitation (I), baseline operation (II and IV), and addition of glucose as a cosubstrate (III).

View this table: [in this window] [in a new window]

TABLE 2. Schedule of the changes performed during the operation of the CSTB

The average DCE degradation based on GC measurements during stage I was 83% and rose to over 99.5% during stages II, III, and IV. Figure 1 shows the evolution of the operational performance of the reactor in terms of the carbon and chloride balances.

View larger version (22K): [in this window] [in a new window]

FIG. 1. Bioreactor functional performance. Symbols: , chloride fed as DCE, based on GC analysis; , chloride discharged, determined by ion chromatography analysis of chloride present in the biomedium; , carbon inlet as DCE and glucose present in feed; , carbon outlet, calculated as the sum of carbon released as CO2, biomass, DCE in the liquid and gas phases, and organic metabolites as total organic carbon; —, dilution rate. Roman numerals indicate the stages of operation. d, day.

During stage I of operation, the reactor performance in terms of DCE degradation deteriorated, as revealed by the chloride balance and GC analyses of DCE. Investigation of the cations present in the biomedium revealed that ammonium limitation was occurring. From stage II onwards, an additional 0.5 g liter^–1 ammonium sulfate was supplied in the nutrient feed. The chloride balance improved significantly, and GC analysis indicated degradation of DCE greater than 99.5%. Due to the low concentration of biomass in the reactor, the dilution rate was increased from 0.030 h^–1 to 0.040 h^–1 to enhance the microbial growth and facilitate microbial analysis.

The secretion of polysaccharides, typical of the genus Xanthobacter (25, 37), enhances cell attachment and aggregation, and a thin biofilm developed on the wall during reactor operation even though the system was vigorously stirred. However, this did not affect microbial analysis, since the biofilm was continuously sloughing from the wall and being mixed back into the biomedium. The slight increase in the carbon outlet around day 90 was due to the release of part of this biofilm, causing a sudden rise in the suspended biomass concentration.

In stage III, glucose (2 g liter^–1) was added to the DCE feed. Carbon inlet load rose from about 1,000 mg day^–1 to 2,500 mg day^–1, which contributed to a corresponding increase of the carbon outlet load as biomass and carbon dioxide. Throughout this stage, DCE degradation was not affected and remained consistently high, while glucose was completely degraded. Glucose addition ceased at the start of stage IV, so the carbon inlet load decreased to the initial value of 1,000 mg day^–1. Stage IV was operated under baseline conditions, and the observed functional performance was analogous to that seen for stage II.

Bioreactor microbial dynamics: in situ hybridization.
The dynamics of the microbial culture were analyzed over time by FISH using a combination of universal and specific probes. Figure 2 illustrates the progress of the culture throughout the experiment and summarizes the FISH results in terms of Ts percentage and Ss percentage. The average Ts and Ss during the first two stages of the experiment were 41% and 85%, respectively, with the latter showing clearly that the dominant strain in the culture was GJ10. Although there was a slight variation, the average Ss correlated well with plate-counting analysis, which pointed to an average of 92% of the colonies as being GJ10.

View larger version (19K): [in this window] [in a new window]

FIG. 2. Bioreactor microbial dynamics. Symbols: , Ss, as the ratio between the cells hybridized with GJ10-specific probe and EUB338I probe; , Ts, as the ratio between the cells hybridized with the EUB338I probe and those stained with DAPI; , percentage of GJ10 based on nutrient agar plate counts. The error bars indicate the standard deviation between the 10 pictures counted. Roman numerals indicate the stages of operation.

On day 109, glucose was added to the feed for a period of 14 days. The reactor was running under nonsterile conditions, and this modification in the feed induced a proliferation of other species (Fig. 3). During stage III, the Ss decreased drastically from 85% to 8% in just 5 days, showing that this proliferation occurred rapidly and was associated with a considerable increase in the suspended biomass (from 200 mg liter^–1 to 1,200 mg liter^–1). Strain GJ10 remained in the reactor at very low levels but even so continued to degrade the DCE (Fig. 1, stage III). In contrast, Ts increased significantly during glucose addition, from 40% to 90%, returning to 30% during stage IV. It appears that the sudden availability of an easily degradable substrate prompted the activity of other species, increasing their rRNA levels and resulting in higher Ts. After day 124, the last day of the glucose addition, it is clear that the contamination had been washed out of the system and that GJ10 had reestablished itself as the dominant strain in the reactor (Fig. 2 and 3). Ts returned to values similar to those observed in stages I and II, due to the washing out of the species that proliferated during the glucose addition. An extensive sloughing of the biofilm was observed in the transition between these last two stages.

View larger version (40K): [in this window] [in a new window]

FIG. 3. Micrographs of FISH-hybridized bacteria. (A) Fields from day 48 (stage II); (B) fields from day 88 (stage II); (C) fields from day 113 (stage III); (D) fields from day 131 (stage IV); 1, cells hybridized with GJ10-specific probe; 2, cells hybridized with EUB338I probe.

Bioreactor microbial dynamics: DGGE analysis and sequencing.
To complement the FISH analysis, PCR-DGGE profiles were used to examine the level of microbial diversity and analyze the stability of the community over time (Fig. 4). This DNA fingerprinting method revealed a very diverse but relatively stable community. The number of individual bands detected in the different profiles varied from 17 to 32 (lane 126 was excluded from the analysis due to low DNA amplification). Stages I and II show the highest dissimilarity between lanes, giving a Dc score of 0.66 (Table 3). During glucose addition, the appearance and intensification of bands was clear (Dc was 0.61 between stages I/II and III), which confirmed the presence of a more diversified community in the reactor. The DGGE profiles were very consistent throughout this stage (Dc = 0.89), revealing that this complex community was fairly stable. Conversely, in the following stage, there was a slight decrease in the number and intensity of bands (Dc was 0.87 between stages III and IV), although some bands associated with the previous stages still remained. The similarity of the profiles was still high (Dc = 0.91).

View larger version (131K): [in this window] [in a new window]

FIG. 4. DGGE profile of PCR-amplified DNA extracted from the reactor throughout the different stages of operation. Lane numbers correspond to days of operation and M indicates the GJ10 marker. The bands highlighted with arrows were excised and sequenced. Roman numerals indicate the stages of operation.

View this table: [in this window] [in a new window]

TABLE 3. Dice similarity coefficients between lanes determined intrastage and interstage

Due to the complexity of the DGGE profiles, three bands that had migrating patterns identical to that of the GJ10 marker (bands 2, 3, and 4) were excised from the different stages and sequenced (Table 4). This analysis confirmed that strain GJ10 was present throughout the four stages; however, its band intensities were very low compared to those of other bands highlighted in Fig. 4. Some of these prominent and persistent bands were excised and sequenced to access its phylogeny. The results displayed in Table 4 show that the similarities achieved for bands 5 to 10 were fairly low; therefore, it is not reasonable to infer the role of these species based on their closest match. Even so, none of these matches was reported to be able to degrade chlorinated compounds.

View this table: [in this window] [in a new window]

TABLE 4. Assignment of identities to band sequences extracted from the DGGE gel

Top Abstract Introduction Materials and Methods Results Discussion References

 
In this study we investigated the long-term operation of a bioreactor inoculated with strain GJ10 degrading DCE in synthetic wastewater under various operational regimens. Initially, the microbial culture was subjected to a nutrient limitation caused by insufficient ammonium in the mineral medium supply. DCE degradation was gradually affected but increased rapidly when the nitrogen limitation was removed. A similar observation was reported by Song and Kinney (30) while operating a vapor-phase bioreactor treating a toluene-contaminated stream. The initial removal varied between 60 and 70%, and after testing for nitrogen-limiting conditions, these authors found that a threefold increment in the nitrogen supply increased the toluene removal to higher than 99%. They also reported that during the nutrient-limiting conditions, the toluene-degrading microbial fraction corresponded to 20 to 40% of the total population, while after the nitrogen increment it increased to 70 to 100%. Their results suggest that the competition between the toluene degraders and the secondary population was greatly affected by the nutrient limitation. In contrast, FISH analysis in our system indicated that strain GJ10 was dominant throughout this first stage and that no evident change occurred when the supply of nitrogen was increased in stage II. So in this case, the nitrogen supply did not appear to affect the dominance of strain GJ10 in the bioreactor.

During the next stage of operation (stage II), DCE removal was excellent, being greater than 99.5%. The Ss results obtained with FISH indicated that an average of 85% of the active bacterial population present in the reactor were GJ10, suggesting that the other 15% corresponded to other species, which probably fed on polysaccharides excreted by GJ10. DGGE profiles complemented this analysis by showing several bands corresponding to different species and confirming the presence of a diverse community in the bioreactor. This diversity was expected, since the bioreactor was running under nonsterile conditions, and it has been reported that DGGE can identify species that correspond to only 1% of the total population (5, 24). Interestingly, none of the most prominent bands corresponded to strain GJ10, although FISH indicated that this strain was dominant among the active population. DGGE analysis, as a DNA-based technique, is inclusive of dead, inactive, or dormant cells, so it does not provide an accurate representation of the most active species in the reactor (4). In addition, technical considerations for DNA extraction and PCR amplification introduce a species-to-species variability, as has been documented by others (12, 13, 35). Conversely, FISH targets rRNA and provides a more accurate characterization of the active population; however, it targets specific bacterial groups or strains, and the overall diversity is not pictured (2). Despite their intrinsic limitations, these two techniques complement each other, providing a quantification of targeted species and a good representation of the community diversity and population shifts (3, 19).

During the first two stages of operation, FISH analysis showed that GJ10 was stable and the dominant strain in the reactor. This long-term stability of strain GJ10 was also observed by Emanuelsson et al. (9); however, the community composition dynamics were not investigated. Our observation is also consistent with those of Carvalho et al. (7), who reported a stable community dominated by a specific fluorobenzene degrader in an up-flow fixed-bed reactor operating under constant functional conditions. These results suggest that the degradation of recalcitrant compounds can sustain quite stable communities. This is in contrast to reports of dynamic communities within functionally stable reactors, which are fed simple substrates (10, 38). This could be related to the requirement of the degradative pathways of these recalcitrant compounds for specific enzymes that are not widespread in nature. In these cases, xenobiotic compounds could create a selective pressure on contaminant species, maintaining the reactor microbial variability at a reasonably low level and enhancing community stability.

The DGGE profiles in the first two stages reveal the highest dissimilarity observed intrastage (Dc = 0.66). As the reactor was initially inoculated with pure GJ10 and run under nonsterile conditions, this dissimilarity could be, to a certain extent, a reflection of the community development in the reactor. This dynamic acclimation period was also observed in a study of a biotrickling filter degrading styrene vapors and monitored with DGGE (32). In this study, dissimilar profiles were observed during the first 35 days of operation, but afterwards hardly any variation was detected until day 182.

It is well established that the microbial activity is linked to the rRNA levels present in the cell (2, 27), since the more active a cell is, the more rRNA it contains. Consequently, a general correlation between the cell activity and the fluorescence signal observed from the EUB338I probe hybridization can be made. The Ts results over the first two stages of operation averaged 41%, indicating that 59% of the cells in suspension were dead or inactive. Viability tests performed with DAPI and propidium iodide justified the low Ts, indicating that approximately 54% of the cells in the reactor were nonviable, which is consistent with results from similar studies (13, 19). The lack of hybridization with the ARCH344 discounted the possibility of the presence of significant numbers of archaeal cells.

In stage III of operation, glucose was introduced into the bioreactor feed along with the DCE. This substrate was selected because, unlike DCE, it can be metabolized by a wide range of microorganisms. However, it cannot be metabolized by strain GJ10 (16). The selection of glucose prevented strain GJ10 from using an additional carbon source and promoted the proliferation of other species present. Throughout this stage DCE removal was maintained. The suspended biomass increased sixfold during this period, and the FISH analysis revealed that Ss dropped to 8%. Since the performance of the reactor was not affected, the biofilm was probably having a more significant role in the DCE degradation. The availability of a readily degradable substrate in the biomedium boosted the growth of contaminant species, while increasing their metabolic activity at the same time. The signal obtained from the EUB338I probe during this stage was stronger and easily detectable, which resulted in higher Ts. This has also been observed in other studies when a substrate was reintroduced in the system (14). DGGE profiles show an increase in the number of bands, indicating a more complex community inside the reactor. The effect of the glucose addition was quite significant on the community composition, as revealed by the Dc of 0.61 determined between stages I/II and III. The similarity analysis also revealed that the community remained extremely stable (Dc = 0.88), even though the complexity of the DGGE profiles increased. This observation contradicts a recent study performed with a mixed culture degrading glucose under constant conditions, where the community was found to be highly dynamic, while no significant changes were observed at the functional level (10). The community stability observed in our system during this stage suggests once again that the degradation of recalcitrant compounds may enhance community stability.

It is interesting to note that during this deliberate contamination, none of the other species present seemed to be able to degrade the DCE. The metabolic pathway of GJ10 has been studied in detail (31, 33), and most of the key enzymes are chromosomally encoded. Therefore, as thoroughly discussed by Emanuelsson et al. (9), the possibility of this information being horizontally transferred to other species is relatively low. The sequencing analysis of some of the most prominent bands in stages III and IV also suggested that these species could not utilize DCE or any other chlorinated organic compounds. However, these phylogenetic similarity analyses are very speculative, and due to the low similarity values achieved, the resulting physiological roles of these species can be considered only as an indication.

In stage IV, following cessation of glucose addition, DGGE profiles indicated that some of the opportunistic species still remained in the reactor, as indicated by the Dc of 0.87 between stage III and stage IV; however, the intensities of most bands decreased. The biofilm detached substantially from the wall in this last stage, which significantly affected cell dispersion and interfered with the FISH analysis, making the manual counting more laborious and less accurate. For this reason, lower values, which varied considerably from 60% to 90%, were observed for the Ss in the analyses performed in this stage. Nonetheless, these FISH results clearly showed that GJ10 became more abundant and the dominant species after the glucose addition ceased.

This last stage has undoubtedly demonstrated the robustness of this system and its capability to respond under biotic pressure. Although this study cannot be generalized to all single cultures degrading recalcitrant substrates, it has demonstrated that a specific strain degrading a recalcitrant compound can exhibit stable behavior and prevail, even under nonsterile conditions, in a bioreactor exposed to various operational regimens.

 
This work was supported by the Fundação para a Ciência e Tecnologia—FCT (grant BD/17965/2004) and by the European Young Researcher Network—BIOSAP (contract no. HPRTN-CT-2002-00213). Support from United Kingdom BBSRC (no. 28/E17405t), Glaxo Smith Kline, Rohm and Haas, and Membrane Extraction Technology is also gratefully acknowledged.

We thank Richard Ellis for kindly providing the DGGE equipment, Ruben F. Jorge for critical reading of the manuscript, and Namdar Baghaei-Yazdi and Muhammad Javed for technical support with the PCR and sequencing reactions.

 
* Corresponding author. Mailing address: Department of Chemical Engineering and Chemical Technology, Imperial College London, Prince Consort Road, SW7 2BY London, United Kingdom. Phone: 44 (0) 2075945582. Fax: 44 (0) 2075945604. E-mail: a.livingston{at}ic.ac.uk.

Present address: Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Amann, R., B. J. Binder, R. J. Olson, S. W. Chisholm, R. Devereux, and D. A. Stahl. 1990. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56:1919-1925.[Abstract/Free Full Text]
2
2. Amann, R., and W. Ludwig. 2000. Ribosomal RNA-targeted nucleic acid probes for studies in microbial ecology. FEMS Microbiol. Rev. 24:555-565.[CrossRef][Medline]
3
3. Araya, R., K. Tani, T. Takagi, N. Yamagushi, and M. Nasu. 2003. Bacterial activity and community composition in stream water and biofilm from an urban river determined by fluorescent in situ hybridization and DGGE analysis. FEMS Microbiol. Ecol. 43:111-119.[CrossRef]
4
4. Boon, N., J. Goris, P. de Vos, W. Verstraete, and E. Top. 2000. Bioaugmentation of activated sludge by an indigenous 3-chloroaniline-degrading Comamonas testosteroni strain, I2gfp. Appl. Environ. Microbiol. 66:2906-2913.[Abstract/Free Full Text]
5
5. Boon, N., E. M. Top, W. Verstraete, and S. Siciliano. 2003. Bioaugmentation as a tool to protect the structure and function of an activated-sludge microbial community against a 3-chloroaniline shock load. Appl. Environ. Microbiol. 69:1511-1520.[Abstract/Free Full Text]
6
6. Briones, A., and L. Raskin. 2003. Diversity and dynamics of microbial communities in engineered environments and their implications for process stability. Curr. Opin. Microbiol. 14:270-276.
7
7. Carvalho, M. F., R. Ferreira Jorge, C. C. Pacheco, P. De Marco, I. S. Henriques, A. Correia, and P. M. L. Castro. 2006. Long-term performance and microbial dynamics of an up-flow fixed bed reactor for the treatment of fluorobenzene. Appl. Microbiol. Biotechnol. [Online.] doi:10.1007/s00253-005-0175-7.
8
8. Cole, J. R., B. Chai, R. J. Farris, Q. Wang, S. A. Kulam, D. M. McGarrell, G. M. Garrity, and J. M. Tiedje. 2005. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis. Nucleic Acids Res. 33:D294-D296.[Abstract/Free Full Text]
9
9. Emanuelsson, E. A. C., I. I. R. Baptista, A. Mantalaris, and A. G. Livingston. 2006. Strain stability in biological systems treating recalcitrant organic compounds. Biotechnol. Bioeng. 92:843-849.[CrossRef]
10
10. Fernandez, A., S. Huang, S. Seston, J. Xing, R. Hickey, C. Criddle, and J. Tiedje. 1999. How stable is stable? Function versus community composition. Appl. Environ. Microbiol. 65:3697-3704.[Abstract/Free Full Text]
11
11. Freitas do Santos, L., and A. G. Livingston. 1995. Novel membrane bioreactor for detoxification of VOC wastewaters: biodegradation of 1,2-dichloroethane. Water Res. 29:179-194.[CrossRef]
12
12. Gillan, D. C., A. G. C. L. Speksnijder, G. Zwart, and C. de Ridder. 1998. Genetic diversity of the biofilm covering Montacuta ferruginosa (Mollusca, Bivalvia) as evaluated by denaturing gradient gel electrophoresis analysis and cloning of PCR-amplified gene fragments for 16S rRNA. Appl. Environ. Microbiol. 64:3464-3472.[Abstract/Free Full Text]
13
13. Haruta, S., M. Kondo, K. Nakamura, H. Aiba, S. Ueno, M. Ishii, and Y. Igarashi. 2000. Microbial community changes during organic solid waste treatment analyzed by double gradient-denaturing gradient gel electrophoresis and fluorescence in situ hybridization. Appl. Microbiol. Biotechnol. 60:224-231.
14
14. Hekmat, D., A. Feuchtinger, M. Stephan, and D. Vortmeyer. 2004. Biofilm population dynamics in a trickle-bed bioreactor used for the biodegradation of aromatic hydrocarbons from waste gas under transient conditions. Biodegradation 15:133-144.[Medline]
15
15. Janssen, D. B., A. Scheper, and B. Witholt. 1984. Biodegradation of 2-chloroethanol and 1,2-dichloroethane by pure bacterial cultures. Prog. Ind. Microbiol. 20:169-178.
16
16. Janssen, D. B., A. Scheper, L. Dijkhuizen, and B. Witholt. 1985. Degradation of halogenated aliphatic compounds by Xanthobacter autotrophicus sp. GJ10. Appl. Environ. Microbiol. 49:673-677.[Abstract/Free Full Text]
17
17. Janssen, D. B., J. R. van der Ploeg, and F. Pries. 1995. Genetic adaptation of bacteria to aliphatic compounds. Environ. Health Perspect. 103:29-32.
18
18. Kaewpipat, K., and C. P. L. Grady, Jr. 2002. Microbial population dynamics in laboratory-scale activated sludge reactors. Water Sci. Technol. 46:19-27.
19
19. Kleikemper, J., S. A. Pombo, M. H. Schroth, W. V. Sigler, M. Pesaro, and J. Zeyer. 2005. Activity and diversity of methanogens in a petroleum hydrocarbon-contaminated aquifer. Appl. Environ. Microbiol. 71:149-158.[Abstract/Free Full Text]
20
20. Koutinas, M., J. Martin, L. G. Peeva, A. Mantalaris, and A. G. Livingston. 2006. An oil-absorber-bioscrubber system to stabilize biotreatment of pollutants present in waste gas—fluctuating loads of 1,2-dichloroethane. Environ. Sci. Technol. 40:595-602.[Medline]
21
21. LaPara, T. M., C. H. Nakatsu, L. M. Pantea, and J. E. Alleman. 2002. Stability of the bacterial communities supported by a seven-stage biological process treating pharmaceutical wastewater as revealed by PCR-DGGE. Water Res. 36:638-646.[Medline]
22
22. Manz, W., R. Amann, W. Ludwig, M. Wagner, and K.-H. Schleifer. 1992. Phylogenetic oligonucleotide probes for the major subclasses of Proteobacteria: problems and solutions. Syst. Appl. Microbiol. 15:593-600.
23
23. Massol-Deya, A., R. Weller, L. Rios-Hernandez, J.-Z. Zhou, R. F. Hickey, and J. M. Tiedje. 1997. Succession and convergence of biofilm communities in fixed-film reactors treating aromatic hydrocarbons in groundwater. Appl. Environ. Microbiol. 63:270-276.[Abstract]
24
24. Muyzer, G., E. C. De Waal, and A. G. Uitterlinden. 1992. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:695-700.
25
25. O'Neill, M. A., A. G. Darvill, and P. Albersheim. 1990. Structural analysis of an acidic polysaccharide secreted by Xanthobacter sp. (ATCC 53272). Carbohydr. Res. 206:289-296.[CrossRef][Medline]
26
26. Pieper, D. H., and W. Reineke. 2000. Engineering bacteria for bioremediation. Curr. Opin. Microbiol. 11:262-270.
27
27. Poulsen, L. K., G. Ballard, and D. A. Stahl. 1993. Use of rRNA fluorescence in situ hybridization for measuring the activity of single cells in young and established biofilms. Appl. Environ. Microbiol. 59:1354-1360.[Abstract/Free Full Text]
28
28. Raskin, L., J. M. Stromley, B. E. Rittmann, and D. A. Stahl. 1994. Group-specific 16S rRNA hybridization probes to describe natural communities of methanogens. Appl. Environ. Microbiol. 60:1232-1240.[Abstract/Free Full Text]
29
29. Smith, N. R., Z. Yu, and W. W. Mohn. 2003. Stability of the bacterial community in a pulp mill effluent treatment system during normal operation and a system shutdown. Water Res. 37:4873-4884.[Medline]
30
30. Song, J., and K. A. Kinney. 2000. Effect of vapor-phase bioreactor operation on biomass accumulation, distribution, and activity: linking biofilm properties to bioreactor performance. Biotechnol. Bioeng. 68:508-516.[CrossRef][Medline]
31
31. Tardif, G., C. W. Greer, D. Labbe, and P. C. K. Lau. 1991. Involvement of a large plasmid in the degradation of 1,2-dichloroethane by Xanthobacter autotrophicus. Appl. Environ. Microbiol. 57:1853-1857.[Abstract/Free Full Text]
32
32. Tresse, O., M.-J. Lorrain, and D. Rho. 2002. Population dynamics of free-floating attached bacteria in a styrene-degrading biotrickling filter analyzed by denaturing gradient gel electrophoresis. Appl. Microbiol. Biotechnol. 59:585-590.[CrossRef][Medline]
33
33. Van der Ploeg, J., M. P. Smidt, A. S. Landa, and D. B. Janssen. 1994. Identification of chloroacetaldehyde dehydrogenase involved in 1,2-dichloroethane degradation. Appl. Environ. Microbiol. 60:1599-1605.[Abstract/Free Full Text]
34
34. Von Canstein, H. F., Y. Li, A. Felske, and I. Wagner-Dobler. 2001. Long-term stability of mercury-reducing microbial biofilm communities analyzed by 16S-23S rDNA interspacer region polymorphism. Microb. Ecol. 42:624-634.[CrossRef][Medline]
35
35. Watts, J. E. M., Q. Wu, S. B. Schreier, H. D. May, and K. R. Sowers. 2001. Comparative analysis of polychlorinated biphenyl-dechlorinating communities in enrichment cultures using three different molecular screening techniques. Environ. Microbiol. 3:710-719.[CrossRef][Medline]
36
36. Whiteley, A. S., and M. J. Bailey. 2000. Bacterial community structure and physiological state within an industrial phenol bioremediation system. Appl. Environ. Microbiol. 66:2400-2407.[Abstract/Free Full Text]
37
37. Wiegel, J. K. W., and H. G. Schlegel. 1984. Genus Xanthobacter Wiegel, Wilke, Baugarten, Opitz and Schlegel 1978, 573^AL, p. 325-333. In N. R. Krieg and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 1. Williams & Wilkins, Baltimore, Md.
38
38. Zumstein, E., R. Moletta, and J. Godon. 2000. Examination of two years of community dynamics in an anaerobic bioreactor using fluorescence polymerase chain reaction (PCR) single-strand conformation polymorphism analysis. Environ. Microbiol. 2:69-78.[CrossRef][Medline]

---

Applied and Environmental Microbiology, June 2006, p. 4411-4418, Vol. 72, No. 6
0099-2240/06/$08.00+0     doi:10.1128/AEM.02576-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Mena-Benitez, G. L., Gandia-Herrero, F., Graham, S., Larson, T. R., McQueen-Mason, S. J., French, C. E., Rylott, E. L., Bruce, N. C. (2008). Engineering a Catabolic Pathway in Plants for the Degradation of 1,2-Dichloroethane. Plant Physiol. 147: 1192-1198 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) An erratum has been published Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Baptista, I. I. R. Articles by Livingston, A. G. Search for Related Content PubMed PubMed Citation Articles by Baptista, I. I. R. Articles by Livingston, A. G. Agricola Articles by Baptista, I. I. R. Articles by Livingston, A. G.