Cloning of the Novel Gene Encoding {beta}-Agarase C from a Marine Bacterium, Vibrio sp. Strain PO-303, and Characterization of the Gene Product

The ß-agarase C gene (agaC) of a marine bacterium,Vibrio sp. strain PO-303, consisted of 1,437 bp encoding 478amino acid residues. ß-Agarase C was identified asthe first ß-agarase that cannot hydrolyze neoagarooctaoseand smaller neoagarooligosaccharides and was assigned to a novelglycoside hydrolase family.

INTRODUCTION

Top

Introduction

Agar is a hydrophilic polysaccharide contained in the cell wallsof agarophyte red algae and is composed of agarose and agaropectins(7). ß-Agarases (EC 3.2.1.81), which hydrolyze agar,are useful tools for the preparation of neoagarooligosaccharidesand the isolation of protoplasts from the algae (4). We isolateda ß-agarase-producing bacterium, Vibrio sp. strainPO-303, from a sea environment. Among the ß-agarasessecreted by the organism, ß-agarase C was found tobe capable of forming neoagarooligosaccharides longer than neoagarohexaose(DP6) from agar (3). In this paper, we describe the cloningand expression of the ß-agarase C gene (agaC) andthe characterization of the recombinant enzyme (rAgaC).

Cloning of the agaC gene.

Top

Cloning of the agac...

A 759-bp DNA fragment was amplified by PCR using chromosomalDNA of strain PO-303 as a template and the degenerate primersGCNAAYTAYACNGCNWSNAAYGC and CCRTTNGCRAANACNACNGG, composed accordingto the N-terminal amino acid sequences of ß-agaraseC and its protease-digested fragment. Sequence analysis showedthat the 759-bp fragment derived from the agaC gene. The XbaI-digestedchromosomal DNA fragments were purified and self-ligated witha Takara ligation kit, version 2. The upstream and downstreamregions of the 759-bp fragments were amplified by inverse PCRwith the self-ligated DNA fragments as templates and two outward-facingprimers designed according to the sequence given above. ThePCR product was cloned into a pT7Blue-2 vector (Novagen) andsequenced. The sequencing results showed that the agaC geneconsisted of 1,437 bp encoding 478 amino acid residues witha predicted molecular weight of 50,922. A potential ribosome-bindingsite (AGGAGA) and the –35 and –10 promoter regionswere identified upstream of the coding region (15, 17). A possibletranscription terminator was found downstream of the TAG terminationcodon. Comparison of the deduced amino acid sequence with theentries in databases suggested that ß-agarase C mightbelong to a novel glycoside hydrolase (GH) family, because noknown GH was found to have homology with it.

Expression and purification of rAgaC.

Top

Expression and Purification of...

The agaC gene without the signal sequence was amplified by PCRfrom strain PO-303 chromosomal DNA by using primers GGTGTACATATGGCTAACTATACTGCCAGTAAand GCGGCCCTCGAGCTATTGGCAAGTATAACCTG, which contained artificialNdeI and XhoI sites (italicized). The amplified DNA fragmentwas digested with NdeI and XhoI and was ligated into a pET22b(+)vector (Novagen) to construct pETAgaC. Escherichia coli BL21(DE3)strains (Novagen) harboring pETAgaC were cultivated for 12 hat 25°C in 1,000 ml of Luria-Bertani medium containing ampicillinand were induced with 1 mM isopropyl-ß-D-thiogalactopyranoside.The cells harvested by centrifugation were suspended in sodiumacetate buffer (pH 6.0) and disrupted on ice by a sonicator.The supernatant of the cell lysate was collected by centrifugationand purified by chromatography using DEAE-Toyopearl 650M, Ether-Toyopearl650S, and MonoQ 5/50 GL columns. The activity of the enzymetoward agarose was determined by the Somogyi-Nelson method,which measured the increase in the amount of reduced sugars(18). One unit of enzyme activity was defined as the amountof enzyme that liberated 1 µmol of D-galactose per min.Protein concentrations were measured by the method of Bradford(6). The recombinant AgaC (rAgaC) exhibited an activity of 7,130U per 1,000 ml of culture and was finally purified 17.9-fold,with a high specific activity of 329 U mg^–1 and a finalyield of 23.3%. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis(10) of the purified rAgaC gave a single band with an apparentmolecular mass of 47 kDa (Fig. 1A), and activity staining (23)showed that the band had activity against agarose (Fig. 1B).The molecular mass was in good agreement with that deduced fromthe amino acid sequence (47,240 Da).

View larger version (50K):
[in this window]
[in a new window]
FIG. 1. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (A) and zymogram (B) of purified rAgaC. Lane M, standard markers; lane E, purified rAgaC.

Characterization of rAgaC.

Top

Characterization of ragac.

The optimal pH of rAgaC was observed to be around 6.0 when theenzyme activity was assayed at various pHs in Britton-Robinson'suniversal buffer, and the enzyme was stable between pH 4.0 and8.0, after being preincubated in the same buffer solutions atvarious pHs at 25°C for 12 h. The enzyme was optimally activeat around 35°C and stable under 37°C.

For analysis of the substrate specificity of rAgaC, enzyme reactionswere performed at 37°C for 24 h and the hydrolysis productswere applied to silica gel 60 thin-layer chromatography plates(solvent, n-butanol-acetic acid-H₂O [2:1:1, vol/vol; Merck]).Oligosaccharides were visualized by spraying the plate withdiphenylamine/aniline/phosphate reagent (5). The hydrolysispattern of rAgaC on agarose (Wako Chemicals) was investigatedat different enzyme concentrations (0.5 to 30 U ml^–1).As shown in Fig. 2A, rAgaC with low activity (0.05 U ml^–1)cleaved agarose into longer neoagarooligosaccharides, such asneoagarooctaose (DP8), -decaose (DP10), -dodecaose (DP12), and-tetradecaose (DP14). When the activity was increased to 30U ml^–1, DP8 was produced predominantly in addition toDP6 and DP4. Figure 2B shows the activity patterns of rAgaC(30 U ml^–1) against neoagarooligosaccharides (DP2, DP4,DP6, DP8, and DP10), agarose, agar (Ina Food Industry), porphyran,and ${kappa}$ -carrageenan (Wako Chemicals). Porphyran and two neoagarooligosaccharides(DP8 and DP10) were prepared by the methods of Su and Hassid(19) and Aoki et al. (2), respectively. rAgaC did not hydrolyzeDP8 or smaller neoagarooligosaccharides but did hydrolyze DP10into DP4 and DP6 with a small amount of DP8. Therefore, rAgaCwas determined to be an enzyme that attacks preferentially thesixth linkage and subsequently the eighth linkage from the nonreducingend of DP10. The hydrolysis products from agar and porphyranwere mainly DP8 in addition to DP4 and DP6, results similarto those for agarose. rAgaC did not act on ${kappa}$ -carrageenan.

View larger version (77K):
[in this window]
[in a new window]
FIG. 2. Thin-layer chromatography of hydrolysis products from agarose (A) and from neoagarooligosaccharides and some polysaccharides (B) with rAgaC. Gal, galactose; DP2, DP4, DP6, DP8, and DP10, degrees of polymerization of neoagarooligosaccharides; S, standard neoagarooligosaccharides; E, rAgaC. Lanes 1, 3, 5, 7, and 9, DP2, DP4, DP6, DP8, and DP10, respectively; lanes 2, 4, 6, 8, and 10, hydrolysis products from DP2 to DP10, respectively; lanes 11, 13, 15, and 17, agarose, agar, porphyran, and ${kappa}$ -carrageenan, respectively; lanes 12, 14, 16, and 18, hydrolysis products from agarose, agar, porphyran, and ${kappa}$ -carrageenan, respectively.

Many agarases published to date have been found to act on DP6to form DP4 and DP2 but not on DP4 (1, 3, 8, 9, 12, 14, 16,20, 22). Some other agarases have been reported to produce DP2as the final product (2, 3, 11, 21). Recently, Ohta et al. publisheda ß-agarase that did not act on DP6 (13). To our knowledge,however, no ß-agarase unable to degrade not only DP6but also DP8 has been reported to date. These results have ascertainedthat ß-agarase C is a novel GH family agarase withnew substrate specificity.

Nucleotide sequence accession number.

Top

Nucleotide sequence accession...

The nucleotide sequence of the agaC gene has been depositedin DDBJ/EMBL/GenBank under accession no. AB218419.

FOOTNOTES

* Corresponding author. Mailing address: Graduate School of Bioresources, Mie University, 1577 Kurimamachiya, Tsu, Mie 514-8507, Japan. Phone: 81-59-231-9561. Fax: 81-59-231-9540. E-mail: araki{at}bio.mie-u.ac.jp.

Present address: Laboratory for Developmental Genomics, RIKENCenter for Developmental Biology, 2-2-3 Minatojima-minamimachi,Chuo-ku, Kobe 650-0047, Japan.

REFERENCES

Top