This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gubala, A. J.
Right arrow Articles by Proll, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gubala, A. J.
Right arrow Articles by Proll, D. F.
Agricola
Right arrow Articles by Gubala, A. J.
Right arrow Articles by Proll, D. F.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, September 2006, p. 6424-6428, Vol. 72, No. 9
0099-2240/06/$08.00+0     doi:10.1128/AEM.02597-05

SHORT REPORT

Molecular-Beacon Multiplex Real-Time PCR Assay for Detection of Vibrio cholerae

Aneta J. Gubala* and David F. Proll

Human Protection and Performance Division, Defence Science and Technology Organisation, Melbourne, Australia

Received 4 November 2005/ Accepted 16 June 2006


arrow
ABSTRACT
 
A multiplex real-time PCR assay was developed using molecular beacons for the detection of Vibrio cholerae by targeting four important virulence and regulatory genes. The specificity and sensitivity of this assay, when tested with pure culture and spiked environmental water samples, were high, surpassing those of currently published PCR assays for the detection of this organism.


arrow
INTRODUCTION
 
The continual wave of outbreaks and pandemics all over the world caused by the bacterium Vibrio cholerae is a steady reminder of the immense importance of cholera as a global threat and a major public health problem (28). The disease may become life-threatening if appropriate therapy is not undertaken quickly; hence, fast, accurate, and sensitive detection of this organism is of foremost importance.

The use of PCR as a reliable molecular-biology-based technology has been reported for the detection of a variety of organisms. Although a significant number of PCR detection assays have been reported for V. cholerae, these reports mostly describe conventional, time-consuming, and laborious methods of PCR product characterization (1, 2, 4-6, 8, 11-15, 17, 19, 21-26). Real-time PCR analysis enables the detection of reaction products through fluorescence, which is faster and more sensitive. However, published real-time PCR assays for V. cholerae are few (9, 10, 16) and have limitations in sensitivity or detect no more than two genes simultaneously. Molecular beacons (MB), due to their stable stem-and-loop structure, have been demonstrated to be significantly more specific than dyes such as SYBR green I and other types of probes. The assay described here utilizes MB for the highly sensitive detection of four important V. cholerae genes by multiplex real-time PCR.

This assay was developed through significant modification of our previously developed fourplex real-time PCR assay, which used SYBR green I for detection (10). Three of the four targets were taken from the previously described assay: rtxA, epsM, and tcpA (10). The fourth gene target, ompW, was incorporated to replace the mshA target. It has been proposed that all V. cholerae strains, both toxigenic strains and nontoxigenic environmental isolates, contain this conserved gene sequence (19). As previously reported, the exploitation of a 68-bp deletion in tcpA within classical biotypes could give an indication of the presence of the El Tor/O139 biotype (10). Collectively, the four unique gene targets cover a range of gene sequences essential for the virulence and survival of V. cholerae.

The 51 bacterial strains used in this study (Table 1) were grown, and the DNA template was prepared, as described previously (10). Tenfold serial dilutions with the equivalent of 1 to 1 x 105 CFU of V. cholerae and 1 x 105 CFU of all the other bacterial species were then added directly to the PCR mixtures in order to determine the sensitivity and specificity of the assay.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains assayed by molecular-beacon real-time PCR

The primers for the newly incorporated ompW target (forward, AACATCCGTGGATTTGGCATCTG; reverse, GCTGGTTCCTCAACGCTTCTG) produced an amplicon of 89 bp and were used at a final concentration of 0.40 µM. The design and optimization of the other three primer pairs have been described previously (10). To enable simultaneous detection, each of the beacons was labeled with a different fluorophore (Table 2). Initially, each of the four primer pairs and molecular beacons was individually assessed. Following this, each individual assay was incorporated stepwise to form a single, optimized multiplex assay capable of the simultaneous real-time PCR detection of all four target sequences in a single reaction.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Molecular beacon probes used in this study

The results obtained for the analysis of all 51 strains using the developed multiplex PCR assay indicated 100% specificity for all of the V. cholerae strains examined (Table 1). The only exception was the presence of a weak fluorescent signal, indicating the presence of small amounts of amplified product, for the ompW sequence with the two V. mimicus strains. This signal, however, appeared late in the amplification protocol, and upon the addition of fewer cells (1 x 103 CFU), the signal was no longer detected, indicating that the amplified product was not specific. Since limited genetic sequence data are publicly available for V. mimicus, it is not possible to preclude the presence of a similar gene in this organism. The rtxA, epsM, and ompW gene targets were detected in all of the V. cholerae strains, and the El Tor-type tcpA gene target, as previously reported, was correctly detected only for the O1 El Tor and O139 strains (10). PCR analysis of the non-O1 isolate failed to generate a product for the El Tor-type tcpA target. However, this lack of detection could be due to the fact that this strain contained a different allele of the gene (3, 7, 18, 20).

The limit of detection of this fourplex assay, when tested by the addition of 10-fold serial dilutions of heat-lysed V. cholerae cells, was very low: the assay routinely detected as few as 5 CFU per reaction (Fig. 1). This sensitivity was good and in most cases significantly better than other described PCR detection limits for V. cholerae (1, 8, 11, 12, 16, 17, 24-26).


Figure 1
View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1. Representative PCR amplification profile obtained from the fourplex real-time PCR analysis of products amplified from serially diluted heat-lysed V. cholerae AI-1838. All four targets—rtxA (A), epsM (B), ompW (C), and tcpA (D)—were detected simultaneously by the four different molecular beacons. To determine the limit of detection of the assay, the dilutions contained the following CFU of V. cholerae: 1 x 105 ({blacksquare}), 1 x 104 (•), 1 x 103 ({blacktriangleup}), 1 x 102 ({blacktriangleright}), 10 ({blacklozenge}), 5 ({square}), and 1 ({circ}). {triangleup}, negative control. The optimized multiplex PCR amplification profile consisted of 150 s at 95°C, followed by 45 cycles of three steps consisting of 30 s at 95°C, 60 s at 60°C, and 30 s at 72°C using the Smart Cycler (Cepheid, Sunnyvale, Calif.). Fluorescence signals emitted from the molecular beacon were measured at the end of each annealing step. Each analysis was repeated multiple times to ensure the reproducibility of results.

To determine the applicability of the multiplex assay to the detection of V. cholerae from a model environmental niche, five different environmental water samples were collected and analyzed by the multiplex PCR assay (10). Initial PCR analysis performed directly on the collected water samples indicated that no detectable levels of naturally occurring V. cholerae were present in these samples. PCR analysis was performed directly on spiked water samples containing 10, 102, or 103 CFU of V. cholerae or 105 CFU of the other Vibrio spp. (Table 3). Analysis of water samples spiked with the mixture of non-V. cholerae Vibrio spp. resulted in the detection of a weak amplification signal, indicating small amounts of the ompW amplified product, synonymous with the findings obtained when the assay was tested using pure heat-lysed V. mimicus cells. Analysis of the samples spiked with V. cholerae resulted in the detection of the bacteria at 103 CFU per reaction, except for the seawater sample, which possibly inhibited the reaction due to its high salt content. In comparison, this was a 10-fold improvement over the 104-CFU limit of detection for the previously described SYBR green I assay (10). Upon the addition of 100 and 10 CFU of V. cholerae, the multiplex MB assay was capable of detecting the organism, although with some variability.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Fourplex detection of V. cholerae from spiked water samples

With the aim of increasing the sensitivity, DNA was extracted from the spiked water samples to remove inhibitory substances by using InstaGene Matrix (Bio-Rad) (10). Fourplex PCR analysis of this semipurified DNA resulted in the routine detection of as few as 10 V. cholerae CFU (lower dilutions were not assessed). This was a significant improvement over the previously described SYBR green I assay, which had a detection limit of 103 CFU per reaction (10). Several groups have similarly employed a DNA extraction step prior to PCR analysis of environmental water samples for V. cholerae (12, 15, 16, 23, 27). In comparison, a major advantage of the DNA extraction method used in this study is that it can be easily adapted to filter very large volumes of water. This can effectively provide an even greater capacity to detect low numbers of V. cholerae in large volumes of water.

Through the use of molecular beacons for the simultaneous detection of four target genes, the specificity and sensitivity of this assay surpass those of the published PCR assays for the detection of V. cholerae. The application of the assay to environmental water samples suggests that the assay could be used for the sensitive and cost-effective monitoring of environmental and drinking water samples. Importantly, this assay is the first to apply molecular beacons for the detection of V. cholerae and is the first fourplex molecular-beacon real-time PCR assay published for the detection of a single bacterial species.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: P.O. Box 4331, Melbourne, Victoria 3001, Australia. Phone: 61 3 9626 8237. Fax: 61 3 9626 8410. E-mail: aneta.gubala{at}dsto.defence.gov.au. Back


arrow
REFERENCES
 
    1
  1. Albert, M. J., D. Islam, S. Nahar, F. Qadri, S. Falklind, and A. Weintraub. 1997. Rapid detection of Vibrio cholerae O139 Bengal from stool specimens by PCR. J. Clin. Microbiol. 35:1633-1635.[Abstract/Free Full Text]
  2. 2
  3. Aridgides, L. J., M. A. Doblin, T. Berke, F. C. Dobbs, D. O. Matson, and L. A. Drake. 2004. Multiplex PCR allows simultaneous detection of pathogens in ships' ballast water. Mar. Pollut. Bull. 48:1096-1101.[CrossRef][Medline]
  4. 3
  5. Chakraborty, S., A. K. Mukhopadhyay, R. K. Bhadra, A. N. Ghosh, R. Mitra, T. Shimada, S. Yamasaki, S. M. Faruque, Y. Takeda, R. R. Colwell, and G. B. Nair. 2000. Virulence genes in environmental strains of Vibrio cholerae. Appl. Environ. Microbiol. 66:4022-4028.[Abstract/Free Full Text]
  6. 4
  7. Chow, K. H., T. K. Ng, K. Y. Yuen, and W. C. Yam. 2001. Detection of RTX toxin gene in Vibrio cholerae by PCR. J. Clin. Microbiol. 39:2594-2597.[Abstract/Free Full Text]
  8. 5
  9. Chowdhury, M. A., R. T. Hill, and R. R. Colwell. 1994. A gene for the enterotoxin zonula occludens toxin is present in Vibrio mimicus and Vibrio cholerae O139. FEMS Microbiol. Lett. 119:377-380.[CrossRef][Medline]
  10. 6
  11. Di Pinto, A., G. Ciccarese, G. Tantillo, D. Catalano, and V. T. Forte. 2005. A collagenase-targeted multiplex PCR assay for identification of Vibrio alginolyticus, Vibrio cholerae, and Vibrio parahaemolyticus. J. Food Prot. 68:150-153.[Medline]
  12. 7
  13. Faruque, S. M., M. Kamruzzaman, I. M. Meraj, N. Chowdhury, G. B. Nair, R. B. Sack, R. R. Colwell, and D. A. Sack. 2003. Pathogenic potential of environmental Vibrio cholerae strains carrying genetic variants of the toxin-coregulated pilus pathogenicity island. Infect. Immun. 71:1020-1025.[Abstract/Free Full Text]
  14. 8
  15. Fields, P. I., T. Popovic, K. Wachsmuth, and O. Olsvik. 1992. Use of polymerase chain reaction for detection of toxigenic Vibrio cholerae O1 strains from the Latin American cholera epidemic. J. Clin. Microbiol. 30:2118-2121.[Abstract/Free Full Text]
  16. 9
  17. Fukushima, H., Y. Tsunomori, and R. Seki. 2003. Duplex real-time SYBR green PCR assays for detection of 17 species of food- or waterborne pathogens in stools. J. Clin. Microbiol. 41:5134-5146.[Abstract/Free Full Text]
  18. 10
  19. Gubala, A. J. 2005. Multiplex real-time PCR detection of Vibrio cholerae. J Microbiol. Methods 65:278-293. (First published 8 September 2005; doi:10.1016/j.mimet.2005.07.017.)
  20. 11
  21. Hoshino, K., S. Yamasaki, A. K. Mukhopadhyay, S. Chakraborty, A. Basu, S. K. Bhattacharya, G. B. Nair, T. Shimada, and Y. Takeda. 1998. Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunol. Med. Microbiol. 20:201-207.[CrossRef][Medline]
  22. 12
  23. Kapley, A., and H. J. Purohit. 2001. Detection of etiological agent for cholera by PCR protocol. Med. Sci. Monit. 7:242-245.[Medline]
  24. 13
  25. Keasler, S. P., and R. H. Hall. 1993. Detecting and biotyping Vibrio cholerae O1 with multiplex polymerase chain reaction. Lancet 341:1661.[CrossRef][Medline]
  26. 14
  27. Kong, R. Y., S. K. Lee, T. W. Law, S. H. Law, and R. S. Wu. 2002. Rapid detection of six types of bacterial pathogens in marine waters by multiplex PCR. Water Res. 36:2802-2812.[Medline]
  28. 15
  29. Lipp, E. K., I. N. Rivera, A. I. Gil, E. M. Espeland, N. Choopun, V. R. Louis, E. Russek-Cohen, A. Huq, and R. R. Colwell. 2003. Direct detection of Vibrio cholerae and ctxA in Peruvian coastal water and plankton by PCR. Appl. Environ. Microbiol. 69:3676-3680.[Abstract/Free Full Text]
  30. 16
  31. Lyon, W. J. 2001. TaqMan PCR for detection of Vibrio cholerae O1, O139, non-O1, and non-O139 in pure cultures, raw oysters, and synthetic seawater. Appl. Environ. Microbiol. 67:4685-4693.[Abstract/Free Full Text]
  32. 17
  33. Morin, N. J., Z. Gong, and X. F. Li. 2004. Reverse transcription-multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Vibrio cholerae O1, and Salmonella Typhi. Clin. Chem. 50:2037-2044.[Abstract/Free Full Text]
  34. 18
  35. Mukhopadhyay, A. K., S. Chakraborty, Y. Takeda, G. B. Nair, and D. E. Berg. 2001. Characterization of VPI pathogenicity island and CTX{phi} prophage in environmental strains of Vibrio cholerae. J. Bacteriol. 183:4737-4746.[Abstract/Free Full Text]
  36. 19
  37. Nandi, B., R. K. Nandy, S. Mukhopadhyay, G. B. Nair, T. Shimada, and A. C. Ghose. 2000. Rapid method for species-specific identification of Vibrio cholerae using primers targeted to the gene of outer membrane protein OmpW. J. Clin. Microbiol. 38:4145-4151.[Abstract/Free Full Text]
  38. 20
  39. Novais, R. C., A. Coelho, C. A. Salles, and A. C. Vicente. 1999. Toxin-co-regulated pilus cluster in non-O1, non-toxigenic Vibrio cholerae: evidence of a third allele of pilin gene. FEMS Microbiol. Lett. 171:49-55.[CrossRef][Medline]
  40. 21
  41. Panicker, G., D. R. Call, M. J. Krug, and A. K. Bej. 2004. Detection of pathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA microarrays. Appl. Environ. Microbiol. 70:7436-7444.[Abstract/Free Full Text]
  42. 22
  43. Rivera, I. N., J. Chun, A. Huq, R. B. Sack, and R. R. Colwell. 2001. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. Appl. Environ. Microbiol. 67:2421-2429.[Abstract/Free Full Text]
  44. 23
  45. Rivera, I. N., E. K. Lipp, A. Gil, N. Choopun, A. Huq, and R. R. Colwell. 2003. Method of DNA extraction and application of multiplex polymerase chain reaction to detect toxigenic Vibrio cholerae O1 and O139 from aquatic ecosystems. Environ. Microbiol. 5:599-606.[CrossRef][Medline]
  46. 24
  47. Shangkuan, Y. H., Y. S. Show, and T. M. Wang. 1995. Multiplex polymerase chain reaction to detect toxigenic Vibrio cholerae and to biotype Vibrio cholerae O1. J. Appl. Bacteriol. 79:264-273.[Medline]
  48. 25
  49. Shirai, H., M. Nishibuchi, T. Ramamurthy, S. K. Bhattacharya, S. C. Pal, and Y. Takeda. 1991. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae. J. Clin. Microbiol. 29:2517-2521.[Abstract/Free Full Text]
  50. 26
  51. Singh, D. V., S. R. Isac, and R. R. Colwell. 2002. Development of a hexaplex PCR assay for rapid detection of virulence and regulatory genes in Vibrio cholerae and Vibrio mimicus. J. Clin. Microbiol. 40:4321-4324.[Abstract/Free Full Text]
  52. 27
  53. Theron, J., J. Cilliers, M. Du Preez, V. S. Brozel, and S. N. Venter. 2000. Detection of toxigenic Vibrio cholerae from environmental water samples by an enrichment broth cultivation-pit-stop seminested PCR procedure. J. Appl. Microbiol. 89:539-546.[CrossRef][Medline]
  54. 28
  55. WHO. 23 September 2005, posting date. Health topics: cholera. [Online.] http://www.who.int/topics/cholera/en/.


Applied and Environmental Microbiology, September 2006, p. 6424-6428, Vol. 72, No. 9
0099-2240/06/$08.00+0     doi:10.1128/AEM.02597-05




This article has been cited by other articles:

  • Huang, J., Zhu, Y., Wen, H., Zhang, J., Huang, S., Niu, J., Li, Q. (2009). Quadruplex Real-Time PCR Assay for Detection and Identification of Vibrio cholerae O1 and O139 Strains and Determination of Their Toxigenic Potential. Appl. Environ. Microbiol. 75: 6981-6985 [Abstract] [Full Text]  
  • Fykse, E. M., Skogan, G., Davies, W., Olsen, J. S., Blatny, J. M. (2007). Detection of Vibrio cholerae by Real-Time Nucleic Acid Sequence-Based Amplification. Appl. Environ. Microbiol. 73: 1457-1466 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gubala, A. J.
Right arrow Articles by Proll, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gubala, A. J.
Right arrow Articles by Proll, D. F.
Agricola
Right arrow Articles by Gubala, A. J.
Right arrow Articles by Proll, D. F.