| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Applied and Environmental Microbiology, May 2007, p. 3123-3136, Vol. 73, No. 10
0099-2240/07/$08.00+0 doi:10.1128/AEM.01399-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Craig T. Parker,2
Lynn A. Joens,3
John D. Klena,1,
Beatriz Quiñones,2
Amy M. Keech,1 and
Michael E. Konkel1*
School of Molecular Biosciences, Washington State University, Pullman, Washington,1 USDA, Western Regional Research Center, Albany, California,2 Department of Veterinary Science and Microbiology, University of Arizona, Tucson, Arizona3
Received 16 June 2006/ Accepted 28 February 2007
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The ability of C. jejuni to cause disease is a complex, multifactorial process. Potential virulence determinants include toxins (7, 11, 26, 34, 40, 46, 48, 63, 69, 79, 85), adherence factors (adhesins) (13, 19, 20, 35, 38, 49, 53, 62), and entry-promoting molecules (invasins) (5, 18, 36, 55, 57, 70, 75). Also of interest are strain-variable genes, which encode factors involved in iron acquisition, DNA restriction/modification, sialylation, flagellar biosynthesis, LOS biosynthesis, and capsular biosynthesis (60, 81). Investigators have proposed that strain-variable genes encode factors that contribute to different disease presentations and enable the organism to survive in unique ecological niches. Regardless, an established set of C. jejuni virulence genes and a determination of their contribution to disease production have yet to emerge.
To better understand the metabolic capacity and virulence properties of C. jejuni, the genome sequence of strain NCTC 11168 was determined (60). Shortly thereafter a comparison of C. jejuni isolates by whole-genome microarray analysis revealed extensive genetic diversity (16). Based on the comparison of 11 C. jejuni isolates, 21% of the genes in the C. jejuni NCTC 11168 strain sequence were proposed to be dispensable as they were either absent or highly divergent among the other isolates included in the study. Dorrell et al. (16) also noted that many of the virulence genes identified to date are conserved among C. jejuni strains.
Published reports suggest that not all C. jejuni strains have the same virulence potential. Everest et al. (18) noted that 86% of Campylobacter isolates from individuals with colitis were able to translocate across Caco-2 polarized cells versus 48% of strains isolated from individuals with noninflammatory disease. Fauchère et al. (20) found that C. jejuni recovered from individuals with fever and diarrhea adhered to cultured cells with greater efficiency than those isolated from asymptomatic individuals. The relative ability of C. jejuni to invade cultured cells also appears to be strain dependent (18, 38, 54). Newell et al. (54) found that environmental isolates were much less invasive for HeLa cells than clinical isolates as determined by immunofluorescence and electron microscopy examination of C. jejuni-infected cells. Moreover, a statistically significant difference in the level of invasion between C. jejuni isolates from individuals with colitis and those from individuals with noninflammatory diarrhea has been observed (18).
Poly et al. (65) compared two unrelated C. jejuni strains (ATCC 43431 and NCTC 11168) by a shotgun genomic DNA microarray technique. Not surprisingly, a large number of genes unique to ATCC 43431 encoded proteins involved in LOS and capsular synthesis. Interestingly, 36 of 130 DNA fragments unique to ATCC 43431 showed similarity to DNA from the Helicobacter hepaticus Imp locus, located on a putative pathogenicity island. In other organisms, the Imp locus has been proposed to modulate host responses (9). More recently, Poly et al. (64) compared the genomic content of C. jejuni strain 81-176 with that of C. jejuni strain NCTC 11168 and found divergence at LOS, capsular biosynthesis, and restriction/modification system loci.
In this study, we assessed the putative virulence properties of C. jejuni isolates recovered from poultry. More specifically, we analyzed the virulence attributes of two C. jejuni isolates, designated Turkey and CS, because they were indistinguishable by PFGE, MLST, and genomotyping. The C. jejuni Turkey isolate showed greater pathogenic potential than the C. jejuni CS isolate based on both in vitro and in vivo assays. The lack in pathogenic potential of the C. jejuni CS isolate, relative to the C. jejuni Turkey isolate, was attributed to a loss in the synthesis of a functional flagellum. The flagellum and associated motility are a known C. jejuni virulence determinant (8, 51, 53, 77, 78, 84). In addition, host cell invasion and the secretion of the Cia (Campylobacter invasion antigen) proteins require a functional flagellar export apparatus (39). We identified a point mutation in the flgR gene of the C. jejuni CS isolate. The flgR gene in C. jejuni encodes the response regulator of the FlgS/FlgR two-component signal transduction system that participates in flagellar biosynthesis. Phosphorylation of the C-terminal output domain of the FlgR response regulator protein presumably results in its binding to DNA, whereby it interacts with
54 to initiate the expression of flagellar class II genes. The class II flagellar genes encode proteins that are required for the assembly of a functional flagellum (32, 33).
While other investigators have examined differences in C. jejuni isogenic strains or passage variants, we are unaware of another study undertaken to examine the virulence attributes of naturally occurring clonally matched isolates. We identified a difference in the nucleotide sequences of the flgR genes in C. jejuni Turkey and CS isolates, which resulted in the nonmotile and avirulent phenotype of the C. jejuni CS isolate. This mutation appears to provide the isolate a fitness advantage in the environment. More specifically, the C. jejuni CS isolate exhibited greater resistance to the antimicrobial activity of the bile salt deoxycholate and is thus able to reach a greater cell density in deoxycholate-supplemented medium than a genotypically matched isolate. Further, the C. jejuni Turkey isolate harboring a mutation in flgR mirrored the phenotype of the C. jejuni CS isolate.
(A portion of this work was presented at 105th General Meeting of the American Society for Microbiology, Atlanta, GA, 5 to 9 June 2005, and at the Conference of Research Workers in Animal Diseases, Chicago, IL, 13 to 15 November 2004.)
| MATERIALS AND METHODS |
|---|
|
|
|---|
F' (Invitrogen, Carlsbad, CA), S17-1
pir, and XL1-Blue MRF' (Stratagene, La Jolla, CA) were cultured on Luria-Bertani (LB) agar plates at 37°C.
Culture of INT 407 cells.
A culture of INT 407 human epithelial cells (ATCC CCL6) was obtained from the American Type Culture Collection (Manassas, VA). Stock cultures of INT 407 cells were grown in minimal essential medium (MEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS; HyClone Laboratories, Logan, UT). Cultures were maintained at 37°C in a humidified, 5% CO2 incubator.
C. jejuni-INT 407 cell binding and invasion assay.
For experimental assays, each well of a 24-well tissue culture tray was seeded with 1.4 x 105 INT 407 cells and incubated for 18 h at 37°C in a humidified, 5% CO2 incubator. The cells were rinsed with MEM-1% FBS and inoculated with a suspension of approximately 5 x 107 CFU of bacteria. Tissue culture trays were centrifuged at 600 x g for 5 min and incubated at 37°C in a humidified, 5% CO2 incubator. For binding, the infected monolayers were incubated for 30 min and rinsed three times with phosphate-buffered saline (PBS) and the epithelial cells were lysed with 0.1% (vol/vol) Triton X-100 (Calbiochem, La Jolla, CA). The suspensions were 10-fold serially diluted, and the number of viable, adherent bacteria was determined by counting the resultant colonies on MH-blood agar plates. To measure bacterial internalization, the infected monolayers were incubated for 3 h, rinsed three times with MEM-1% FBS, and incubated for an additional 3 h in MEM-1% FBS containing a bactericidal concentration (250 µg/ml) of gentamicin. The number of internalized bacteria was determined as outlined above. Unless otherwise stated, the reported values represent the mean counts ± standard deviations derived from triplicate wells. All assays were performed a minimum of three times to ensure reproducibility. Significance between samples was determined using Student's t test following log10 transformation of the data. Two-tailed P values were determined for each sample, and a P value <0.01 was considered significant.
Secretion assay.
C. jejuni isolates were harvested from MH-blood agar plates in PBS, pelleted by centrifugation at 6,000 x g, washed twice in MEM, and suspended in MEM lacking methionine (labeling medium; ICN Biomedicals, Inc., Aurora, OH) to an optical density at 540 nm (OD540) of 0.3 (approximately 5 x 108 CFU). Metabolic labeling experiments were performed in 3 ml of labeling medium with the addition of [35S]methionine (PerkinElmer Life Sciences, Inc., Boston, MA) as described elsewhere (37). Following a 3-h labeling period, bacterial cells were pelleted by centrifugation at 6,000 x g and supernatant fluids collected. The supernatant fluids were concentrated fourfold by the addition of 5 volumes of ice-cold 1 mM HCl-acetone followed by centrifugation. The pellets were air dried and resuspended in water. The secreted proteins were resolved in sodium dodecyl sulfate (SDS)-12.5% polyacrylamide gels using the discontinuous buffer system described by Laemmli (41). Gels were treated with Amplify (Amersham, Piscataway, NJ) according to the manufacturer's instructions. Autoradiography was performed with Kodak BioMax MR film at 70°C.
Motility assay.
Motility assays were performed using MH medium supplemented with 0.4% Select agar (motility agar plates; Life Technologies, United Kingdom). A 10-µl suspension of each bacterial isolate was spotted on the surface of the semisolid medium. Motility plates were incubated at 37°C under microaerobic conditions for 48 h.
Macrorestriction enzyme PFGE.
C. jejuni isolates were harvested from MH-blood agar plates in 3 ml PETT IV buffer (1 M NaCl, 10 mM Tris, 10 mM EDTA, pH 8.0) and cell densities adjusted to 0.75 using a Microscan turbidity meter (Dade Behring, West Sacramento, CA) in 12- by 75-mm Falcon round-bottom tubes (Becton Dickinson, Franklin Lakes, NJ). Four hundred microliters of 1.4% (wt/vol) molten (50°C) pulsed-field grade agarose (Bio-Rad, Hercules, CA) was added to an equivalent volume of each bacterial suspension, the suspension was mixed gently, and a 100-µl aliquot was pipetted into agarose plug molds. The agarose plugs were removed from the molds and incubated in 1 ml of ESP buffer (50 mM Tris-HCl [pH 8.0], 50 mM EDTA, 1% [wt/vol] N-lauroylsarcosine, 0.5 mg/ml proteinase K) at 50°C for 1 h. Following cell wall lysis, the agarose blocks were washed three times in sterile water and three times in TE (10 mM Tris, pH 8.0, 1 mM EDTA). Each wash was performed at ambient temperature for 30 min. Individual agarose plugs were incubated with 100 µl of 1x restriction endonuclease buffer containing 20 U of SmaI. The reaction mixtures were incubated at 25°C for a minimum of 4 h. Following incubation, the agarose plugs were loaded into an agarose gel. Restricted genomic DNA was separated in 1% (wt/vol) pulsed-field grade agarose prepared with 0.5x TBE (0.089 M Tris base, 0.089 M boric acid, 0.002 M EDTA [pH 8.0]). Run parameters consisted of a reorientation angle of 120° with a constant voltage of 120 V and a constant temperature of 14°C. An electrophoresis run time of 19 h and a ramped pulse time of 6.8 to 35.4 s were used. For plugs digested with SalI, a run time of 18 h and a ramped pulse time of 5.2 to 42.3 s were used. Gels were stained for 20 min in 3 µg/ml ethidium bromide and destained for 20 min in water. Images were captured using a Bio-Rad FluorS system and processed using Adobe Photoshop.
MLST.
MLST was performed as described by Dingle et al. (15). Portions of the housekeeping genes encoding aspartase A (aspA), glutamine synthetase (glnA), citrate synthase (gltA), serine hydroxymethyl transferase (glyA), phosphoglucomutase (pgm), transketolase (tkt), and the ATP synthase alpha subunit (uncA) were amplified and sequenced. Genomic DNA was recovered from C. jejuni isolates harvested from MH-blood agar plates. Amplification of each gene fragment was performed using approximately 10 ng of genomic DNA and 1.25 U of Taq DNA polymerase (Invitrogen) in a 50-µl reaction volume containing 1 µM forward and reverse primer, 1x PCR buffer (Invitrogen), 1.5 mM MgCl2, and 0.8 mM deoxynucleoside triphosphates (dNTPs). Amplification reactions consisted of the following cycling conditions: an initial denaturation step (94°C, 2 min) followed by annealing (50°C, 1 min) and extension (72°C, 1 min) steps, which were repeated for 35 cycles. PCR amplicons were assessed for quantity and quality by agarose gel electrophoresis. Primers and unincorporated dNTPs were removed by passing amplicons through a commercially available batch column purification system (Qiaquick PCR kit; QIAGEN, Valencia, CA). The nucleotide sequences of PCR amplicons were determined using a modification of Sanger dideoxynucleotide sequencing, incorporating fluorescence dye technology, at the DNA sequencing facility of Washington State University. Sequencing was performed on both strands for a segment of each allele from each isolate. Nucleotide sequences for each allele were aligned using the program Clustal X, and the nucleotide sequences were assigned alleles from the MLST website (http://mlst.zoo.ox.ac.uk). Sequence types, based on the combination of assigned alleles to the seven housekeeping genes, were determined using the MLST website (http://mlst.zoo.ox.ac.uk).
Inoculation of piglets.
Newborn piglets were obtained from sows at the time of farrowing. Feces from each sow were plated on selective Abeyta Hunt Bark agar plates containing sodium cefoperazone (32 mg/liter), rifampin (10 mg/liter), amphotericin B (2 mg/liter), and 4 ml/liter of FBP (62.5 g/liter sodium pyruvate, 62.5 g/liter ferrous sulfate, and 62.5 g/liter sodium metabisulfite). Suspect colonies were tested for C. jejuni as described by Nogva et al. (56). Only piglets obtained from C. jejuni-free sows were used for in vivo studies.
Each piglet was fed five times daily with 50 ml of Similac formula (Ross Laboratories). Overnight-grown cultures of C. jejuni were resuspended in Similac at a concentration of approximately 5 x 109 CFU/ml. Piglets were orally inoculated with approximately 20 ml of either the C. jejuni Turkey or CS isolate. Actual numbers of viable bacteria inoculated were determined by serial dilution and plating of the bacterial suspension.
Piglets were observed for diarrhea, and rectal swabs were plated on Abeyta Hunt Bark medium prior to inoculation and daily thereafter to determine the presence of C. jejuni shedding. Piglets were euthanized when morbidity was observed or at 6 days postinoculation with 2 ml of Beuthanasia-D (Schering Corp.). Gross examinations of the small intestine, colon, and cecum were recorded, and tissue samples were fixed in 10% buffered formalin and examined for histological lesions at the University of Arizona Veterinary Diagnostic Laboratory (Tucson, AZ).
Preparation of whole-cell lysates, outer membrane proteins (OMP), and flagellin.
C. jejuni whole-cell lysates were generated by harvesting bacteria grown overnight on MH-blood agar plates in PBS and subjecting the bacterial suspension to sonication on ice (five 30-s pulses).
OMP were prepared as described by deMelo and Pechère (13) with minor modifications. Briefly, bacterial sonicates were centrifuged at 8,000 x g to remove whole bacterial cells. Supernatant fluids were centrifuged at 100,000 x g for 2 h. The resulting pellets were resuspended in a solution of 1% Sarkosyl (Sigma, St. Louis, MO) in 10 mM Tris-HCl (pH 7.5) and allowed to incubate at ambient temperature for 30 min on a platform rocker. The solutions were centrifuged at 100,000 x g for 2 h, and the supernatants were removed. The pellets were washed in 10 mM Tris-HCl (pH 7.5) and centrifuged at 100,000 x g for 2 h. Finally, the pellets were resuspended in 50 mM Tris-HCl (pH 7.5), and the protein concentration was determined by the BCA protein assay kit according to the manufacturer's instructions (Pierce, Rockford, IL).
Flagella were purified as described by Alm et al. (3). Bacteria were resuspended in PBS and homogenized twice for 3 min. The bacterial suspensions were centrifuged at 8,000 x g to remove whole cells. The supernatant fluids were centrifuged at 100,000 x g for 1 h. The resulting pellets were resuspended in 1% SDS and allowed to incubate at ambient temperature. The solutions were centrifuged at 100,000 x g for 1 h, and the resulting pellets were washed twice in distilled water and centrifuged as above. The final pellets were resuspended in 10 mM Tris-HCl (pH 7.0), and the protein concentration was determined as described above. All protein extracts were stored at 20°C.
Gel electrophoresis.
Two-dimensional gel electrophoresis was performed using the parameters described elsewhere (37). One-dimensional gel electrophoresis was performed by mixing an equal volume of a bacterial suspension (an equivalent of 0.1 OD600 unit) with double-strength electrophoresis sample buffer (37). The samples were placed in boiling water for 5 min and allowed to cool to ambient temperature. Proteins were resolved by 12.5% SDS-polyacrylamide gel electrophoresis (PAGE) using the discontinuous buffer system described by Laemmli (41).
Immunoblot analysis.
Proteins were electrophoretically transferred to polyvinylidene difluoride (PVDF) membranes (Immobilon P; Millipore Corp., Bedford, MA). The membranes were washed three times in PBS and incubated for 18 h at 4°C with a 1:500 dilution of a rabbit anti-C. jejuni flagellin antibody in PBS (pH 7.4)-0.01% Tween 20 containing 9% dried milk. Bound antibodies were detected using peroxidase-conjugated rabbit anti-goat immunoglobulin G (Sigma) at a 1:1,000 dilution and 4-chloro-1-naphthol (Sigma) as the chromogenic substrate.
RNA isolation.
Total cellular RNA was isolated from the C. jejuni Turkey and CS isolates grown to mid-log phase using the hot-phenol method (74). Briefly, 5 ml of RNA degradation stop solution was added (10% phenol solution, buffered saturated with 0.1 M citrate buffer, pH 4.3 + 0.2, in 100% ethanol) to 50 ml of each bacterial culture. The bacterial suspension was then pelleted and resuspended in 3 ml of 1% buffer-saturated phenol solution. The culture was pipetted into 1.5 ml of boiling lysis buffer in a water bath until cell lysis occurred. This was followed by two extractions with phenol at 60°C and one extraction with phenol-chloroform, and the aqueous phase was precipitated with ethanol and resuspended in diethyl pyrocarbonate-treated water. Contaminating genomic DNA was removed by two consecutive treatments with RQ1-DNase (Promega, Rockford, IL). The absence of genomic DNA was confirmed via PCR using C. jejuni ciaB gene sequence-specific primers (CiaB-F, CTATGCTAGCCATACTTAGGC; CiaB-R, GCCCGCCTTAGAACTTAC). The PCR conditions used were 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min, with a final extension time of 5 min (35 cycles in total).
Construction of the C. jejuni DNA microarray.
DNA fragments of individual open reading frames (ORFs) were amplified using primers specific for ORFs present in strain NCTC 11168 (Sigma Genosys, The Woodlands, TX). Each PCR (total reaction volume, 100 µl) consisted of 1x MasterAmp Taq PCR buffer, 1x MasterAmp Taq enhancer, 2.5 mM MgCl2, 200 µM each dNTP, forward and reverse primers at 0.2 µM each, 0.5 U of MasterAmp Taq DNA polymerase (Epicenter, Madison, WI), and approximately 50 ng of genomic DNA from strain NCTC 11168. Thermal cycling was performed using a Tetrad thermal cycler (MJ Research, Waltham, MA) with the following amplification parameters: 30 cycles of 25 s at 94°C, 25 s at 52°C, and 2 min at 72°C and a final extension at 72°C for 5 min. PCR products were analyzed by gel electrophoresis in a 1% (wt/vol) agarose gel (containing 0.5 µg of ethidium bromide/ml) in 1x Tris-acetate-EDTA buffer. DNA bands were examined under UV illumination. A total of 1,530 PCR products were successfully amplified and then purified on a QIAGEN 8000 robot using a Qiaquick 96-well Biorobot kit (QIAGEN), dried, and resuspended to an average concentration of 0.1 to 0.2 µg/µl in 20 µl of 50% dimethyl sulfoxide containing 0.3x saline sodium citrate (SSC; 1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate). All of the PCR probes were then spotted in duplicate on GAPSII slides (Corning, Acton, MA) using an OmniGrid Accent (GeneMachines, Ann Arbor, MI) producing a final array that contained a total of 3,060 features.
Fluorescent labeling of genomic DNA and cDNA.
For each comparative genomic microarray hybridization reaction, genomic DNAs from the reference strain NCTC 11168 and a test strain were fluorescently labeled with Cy5 and Cy3, respectively. Approximately 2 µg of DNA was mixed with 5 µl 10x NEBlot labeling buffer containing random sequence octamer oligonucleotides (New England Biolabs, Beverly, MA) and water to a final volume of 41 µl. This mixture was heated to 95°C for 10 min and then stored for 5 min at 4°C. After this incubation, the remainder of the labeling reaction components were added: 5 µl of 10x dNTP labeling mixture (1.2 mM each dATP, dGTP, dCTP; 0.5 mM dTTP in 10 mM Tris, pH 8.0; 1 mM EDTA), 3 µl of Cy3-dUTP or Cy5-dUTP (Amersham Biosciences, Piscataway, NJ), and 1 µl of Klenow fragment. The labeling reaction mixtures were incubated overnight at 37°C. Fluorescently labeled DNA was purified using Qiaquick PCR purification columns (QIAGEN, Valencia, CA) according to manufacturer's directions.
For the expression profiling arrays, an indirect comparison of gene expression levels was performed (83), where the levels of expression from the various C. jejuni isolates were measured separately on different slides. In this microarray experimental design, each labeled cDNA is combined with a fixed reference source (83), allowing the comparison of different experiments in which a common reference has been used, as in previous studies (17, 45). Sixteen micrograms of total RNA from each C. jejuni isolate was labeled during reverse transcription to cDNA with Cy5-dUTP using Stratascript (Stratagene, Palo Alto, CA). Following 16 h of labeling, RNA was degraded by the addition of NaOH to 0.3 M and incubation at 70°C for 10 min, followed by neutralization with an equimolar amount of HCl. The labeled cDNA was purified using Qiaquick PCR purification columns (QIAGEN) according to the manufacturer's directions. In all expression microarray hybridizations, genomic DNA from C. jejuni strain NCTC 11168 was labeled with Cy3-dUTP as described above. The labeled genomic DNA also served as a quality control for all the spots in the array. In this particular indirect comparison for gene expression, an analysis of repeatable residual color bias from Cy dye swap experiments was removed since the between-slide differences were taken into account (see below) (83).
Microarray hybridization.
For each genomic indexing hybridization, Cy5-labeled reference DNA from C. jejuni strain NCTC 11168 was mixed with Cy3-labeled test DNA or cDNA in 45 µl of Corning hybridization buffer (Corning, Acton, MA) and heated to 95°C for 5 min. Then 15 µl of the hybridization mixture was put onto the microarray slide and sealed with a coverslip in a GeneMachine hybridization chamber (Genomic Solutions, Ann Arbor, MA) and incubated at 42°C for 18 h. This method, known as differential labeling, allows the hybridization of fluorescently labeled control and test DNA or cDNA to be measured for each probe on the microarray. As the genetic composition of the sequenced strain C. jejuni NCTC 11168 is known, it served as a control fluorescence signal for each probe and was used for comparison with the test DNA signal during the statistical analysis (see below). Following hybridization, microarray slides were washed for 2 min in 2x SSC and 0.1% SDS at 42°C to remove the coverslip and then washed twice for 5 min in each of the following buffers: (i) 2x SSC and 0.1% SDS at 42°C, (ii) 0.2x SSC, and finally (iii) 0.01x SSC. Microarray slides were dried by centrifugation at 300 x g for 15 min before scanning.
Microarray data analysis.
DNA microarrays were scanned using a GenePix 4000B microarray laser scanner (Axon Instruments, Union City, CA), and the data for spot and background intensities were processed using GenePix 4.0 software. Poor features were excluded from analysis if they contained abnormalities or a reference signal lower than background plus 3 standard deviations. As described by Eriksson et al. (17), fluorescence ratios were calculated after local background was subtracted from spot signals. To compensate for any effect of the amount of template and uneven Cy-dye incorporation, data normalization was performed as previously described (4, 17, 45) by bringing the median natural logarithm of the ratios for each group of spots printed by the same pin to zero using the following equation: ln(Ti) = ln(Ri/Gi) c, where T is the centered ratio, i is the gene index, R and G are the red and green intensities, respectively, and c is the 50th percentile of all red/green ratios. Normalized data that passed the quality controls were analyzed using GENESPRING 6.2 software (Silicon Genetics, Palo Alto, CA). For comparison of levels of C. jejuni Turkey and CS gene expression, at least four hybridization measurements were generated per biological experiment (two technical replicate arrays and two replicate features per array) and the experiment was repeated two times (biological replicate). The significance of the centered data at P values >0.05 was determined using a parameter-based statistical t test adjusting the individual P value with the Benjamini and Hochberg false-discovery rate multiple test correction within the GeneSpring analysis package.
Sequencing genes involved in flagellar biosynthesis.
The genes of interest (flhA, flhB, flhF, fliA, fliF, fliG, fliH, fliI, fliM, fliN, fliP, fliQ, fliR, fliY, flgR, flgS, rpoN, Cj0667, Cj0668, and Cj0669) were PCR amplified using KOD DNA polymerase (Novagen, San Diego, CA) and sequenced using gene-specific primers. Both strands of every gene above from both the C. jejuni Turkey and CS isolates were sequenced. All sequencing primers were designed based on C. jejuni NCTC 11168 genomic sequences (60). Sequencing was performed using the Big Dye Terminator kit (Applied Biosystems, Foster City, CA) and the DNA sequencer ABI373 (Applied Biosystems, Foster City, CA). The sequences were analyzed using the MultAlin multiple sequence alignment program.
Real-time RT-PCR.
The relative expression of 26 genes (clpB, cmeA, flaA, flaB, flaC, flgB, flgC, flgD, flgE, flgG, flgH, flgK, fliF, fliG, fliH, fliI, fliM, fliY, flhA, flhB, metA, rpoN, Cj1514, Cj0667, Cj0668, and Cj0669) was determined by real-time quantitative reverse transcription-PCR (RT-PCR). cDNA was synthesized using the ThermoScript RT-PCR system (Invitrogen) according to the manufacturer's directions. Real-time RT-PCR amplification of 0.5 µl of cDNA was performed in a reaction mixture containing Power SYBR Green PCR master mix (Applied Biosystems, Foster City, CA), a 300 nM concentration of forward and reverse primers, and diethyl pyrocarbonate-treated water. Real-time RT-PCR analysis was performed using a Gene Amp 7000 thermocycler (Applied Biosystems, Foster City, CA). PCR conditions included 1 cycle of 2 min at 50°C, followed by 40 cycles of denaturation at 95°C for 15 s and an annealing at 55°C for 1 min. Cycle threshold (CT) values were determined using Prism SDS software version 1.0 (Applied Biosystems). The comparative threshold cycle (
CT) method was used to calculate change (n-fold) where samples were normalized to glnA, since glnA is a housekeeping gene and was not found to be differentially expressed by microarray analysis. Reactions were performed in duplicate, and two biological replicates were performed for each sample.
Construction of reporter vectors.
The promoter regions of the flaB and metK genes were PCR amplified using the following primer sets: primer set 1, (PmetK-F, ATTTGGATCCCCTTGTGCTCCTGTTTGTGC, and PmetK-R, ATATGGATCCAAAAAGTCCTTTCATTTAAAATGAACC) and, primer set 2 (PflaB-F, AAGGATCCACACTTAAAGGCGCTATGGCTGTGATG, and PflaB-R, AAGGATCCGATGTTGGTGTTTATCCTAAAACC). Primers were designed to include a BamHI site at the 5' end. The PCR products were cloned into pCR 2.1 using the TOPO TA cloning kit (Invitrogen). The ligated vector was electroporated into E. coli INV
F', and the transformants were selected on LB agar supplemented with kanamycin (KAN; 50 µg/ml). PflaB-pCR2.1 and PmetK-pCR2.1 were digested with BamHI to give 0.8-kb and 0.78-kb fragments, respectively. Each fragment was gel purified using the QIAquick gel extraction kit (QIAGEN, Valencia, CA). The pMW10 shuttle vector (80) was digested with BamHI, gel purified, and ligated with the BamHI-PflaB and BamHI-PmetK fragments for 18 h. The ligation mixture was ethanol precipitated and electroporated into E. coli INV
F'. The transformants were selected on LB-KAN agar and tested for insertion by blue-white screening. The sequences of the constructs were verified using a primer that anneals to the aphA3' gene encoding KAN resistance (TACACTCAAATGGTTCGCTG) as described previously (80).
Electroporation of promoter shuttle vectors in the C. jejuni F38011 and CS isolates.
The vectors (pMW10, PmetK-pMW10, and PflaB-pMW10) were introduced into the C. jejuni F38011 and CS strains by electroporation. The resultant colonies were selected on MH-blood agar plates supplemented with KAN (200 µg/ml).
ß-Galactosidase assay.
ß-Galactosidase activity was determined as a measure of conversion of o-nitrophenyl-D-galactopyranoside (Sigma) to nitrophenol. C. jejuni transformants were grown for 16 h in MH broth. Harvested bacteria were diluted in PBS until the OD600 was between 0.4 and 0.5. The assay was carried out in triplicate as previously described (80).
Construction of the complementation vectors.
To construct the flgR pRY107 (KAN resistance) complementation vector, the coding region of the flgR gene along with its native promoter (350 bp upstream of the start codon) was PCR amplified using primers containing 5' BamHI restriction sites (flgRcompF, TATATAGGATCCAATGGGTATGTGAAATTTCTTATAGTG; flgRcompR, TATATAGGATCCCCCAACCGCACCAGTAGC). The PCR product was cloned into pCR2.1 using the TOPO TA cloning kit (Invitrogen). The ligated vector was electroporated into E. coli INV
F', and the transformants were selected on LB-KAN plates (50 µg/ml). The pCR2.1 construct containing the BamHI flgR fragment was digested with BamHI, gel purified, and cloned into the BamHI site of pRY107. The ligated vector was electroporated into E. coli INV
F', and transformants were selected on LB-KAN plates (50 µg/ml).
To construct the rpoN pRY111 (chloramphenicol [CHL] resistance) complementation vector, the promoter region of Cj0667 was fused with the rpoN ORF. Noteworthy is that the rpoN gene is the fourth gene within the operon (5'-Cj0667-Cj0668-Cj0669-rpoN). The promoter region of Cj0667 was PCR amplified using primers containing 5' SstI and NdeI restriction sites (Cj0667-SstI-F, TATATAGAGCTCTCAAGGCGTCCTATACCGTG; Cj0667-NdeI-R2, ATATATACATATGTTCAGAAATAGCTCTTC). The rpoN ORF was PCR amplified using primers containing 5' NdeI and SstI restriction sites (rpoN-NdeI-F, TATAATCATATGTTAAAGCAAAAAATCACCCAAG; rpoN-SstI-R, TATAATCCGCGGAATATTTAAAAACAGTTATTATTGTATCAC). The PCR amplicons were cloned into pCR2.1 using the TOPO TA cloning kit (Invitrogen). The ligated vector was electroporated into E. coli INV
F', and transformants were selected on LB-KAN plates (50 µg/ml). The rpoN-pCR2.1 construct was digested with NdeI and SstI, and the gel-purified fragment was ligated into the NdeI- and SstI-restricted PCj0667-pCR2.1 construct. The ligated vector was electroporated into E. coli INV
F', and transformants were selected on LB-KAN plates (50 µg/ml). The PCj0776-rpoN-pCR2.1 fusion vector was digested with SstI, and the SstI-PCj0667-rpoN fragment was gel purified and cloned into the SstI site of pRY111. The resulting vector was electroporated into E. coli INV
F', and transformants were selected on LB agar plates supplemented with CHL (LB-CHL).
Conjugation.
The complementation plasmids were electroporated into E. coli S17-1
pir. E. coli S17-1
pir harboring the complementation plasmid flgR-pRY107 was then conjugated with the C. jejuni CS isolate. The transconjugants were selected on MH-blood agar plates supplemented with KAN (200 µg/ml) and tetracycline (TET, 50 µg/ml). The C. jejuni CS isolate colonies resistant to both KAN and TET were screened for motility on motility agar plates (Life Technologies, United Kingdom).
E. coli S17-1
pir harboring the PCj0667-rpoN-pRY111 complementation plasmid was conjugated with the C. jejuni S2B isolate. The transconjugants were selected on MH-blood agar plates supplemented with CHL (20 µg/ml) and TET (50 µg/ml). The C. jejuni S2B isolate colonies resistant to both KAN and TET were screened for motility on motility agar plates.
Generation of the C. jejuni Turkey flgR mutant.
A disrupted copy of the flgR gene was amplified from the C. jejuni F38011 flgR-cat mutant using flgR gene-specific primers (66), and the resultant product was cloned into pCR2.1. The flgR-cat fragment was digested using EcoRI, gel purified, and cloned into the EcoRI site of the pBluescriptII SK(+) vector. The ligated vector was electroporated into E. coli INV
F' and selected on LB-CHL. The mutagenesis vector was introduced into the C. jejuni Turkey isolate by electroporation and selected on MH-blood agar plates supplemented with CHL. The putative mutants were confirmed by PCR amplification of flgR, followed by digestion of the PCR product by NheI to release the cat cassette.
Growth curves.
Overnight cultures of C. jejuni Turkey and CS isolates were used to inoculate 250 ml of MH broth at an OD540 of 0.01. The flasks were incubated at 37°C under microaerobic conditions and shaken at 150 rpm. At different time points, 1 ml of bacterial culture was used to determine the OD540 until both cultures reached stationary phase.
Sensitivity to deoxycholate.
Overnight cultures of C. jejuni Turkey, the C. jejuni Turkey flgR mutant, and CS isolates were used to inoculate tubes at an OD540 of 0.05. Different concentrations of sodium deoxycholate were added to each tube in triplicate, and tubes were incubated for 48 h at 37°C under microaerobic conditions and shaken at 150 rpm. At the end of the incubation period, the OD540 for each tube was measured.
Other analytical procedures.
Protein concentrations were determined by the bicinchoninic acid method, with bovine serum albumin as the standard, as outlined by the supplier (Pierce, Rockford, IL). To determine the identity of the protein present in the flagellar extract prepared from the C. jejuni Turkey isolate, the extract was mixed with an equal volume of double-strength electrophoresis sample buffer sample and separated by SDS-PAGE. The proteins were transferred to PVDF membranes and stained with Coomassie brilliant blue G-250 (CBB-G250). The amino-terminal sequence of the 62-kDa protein was determined at the University of British Columbia Biotechnology Laboratory (Protein Sequencing and Peptide Mapping, NAPS Unit, Vancouver, B.C., Canada).
| RESULTS |
|---|
|
|
|---|
|
|
C. jejuni isolates Turkey and CS are genotypically indistinguishable.
To unravel the molecular basis of the differences in pathogenesis exhibited by the isolates, we wanted to determine their genetic relatedness. Since macrorestriction enzyme PFGE (MRP-PFGE) profiling is the currently accepted method to determine the relatedness of Campylobacter isolates (12, 14, 21, 22, 25, 28, 29, 67, 72, 73, 76), we used it to assess the genomic diversity of the C. jejuni isolates used in this study. Initially, C. jejuni isolates were analyzed by PFGE following digestion of chromosomal DNA with the restriction enzyme SmaI. A representative gel is presented in Fig. 2A. PFGE of SmaI-restricted C. jejuni chromosomal DNA yielded 4 to 10 fragments ranging in size from <97 kb to approximately 485 kb. The C. jejuni CS, SC, and Turkey isolates yielded indistinguishable macrorestriction profiles using the SmaI restriction enzyme. We chose to narrow the remainder of this study to the Turkey and CS isolates because the Turkey isolate was found to be highly invasive for INT 407 cells and was Cia secretion positive whereas the CS isolate displayed a noninvasive phenotype for INT 407 cells and was Cia secretion negative. Noteworthy is that macrorestriction profiles of the C. jejuni Turkey and CS isolates were also indistinguishable using a second restriction enzyme, SalI (Fig. 2B).
|
We also examined the gene content of the C. jejuni Turkey and CS isolates by a comparative genomic hybridization analysis (genomotyping) using a C. jejuni NCTC 11168 DNA microarray. It should be noted that only genes that have a feature represented on the C. jejuni NCTC 11168 DNA microarray can be detected using this method. Moreover, some mutations, including frameshift and point mutations that might be present in one isolate and not the other, would not be identified by this method. With these caveats in mind, we found no observable differences between the signal intensities for the C. jejuni Turkey and CS isolates, suggesting that, among those genes conserved with C. jejuni strain NCTC 11168, all three isolates have an identical gene content (not shown). However, both the C. jejuni Turkey and CS isolates exhibited divergence from the NCTC 11168 strain for genes that are contained within the recognized hypervariable regions, including the capsular biosynthesis locus, LOS biosynthesis locus, and restriction modification locus. To confirm divergence in the LOS locus among the isolates, we used a recently described PCR method (59). Both C. jejuni isolates CS and Turkey possess the class B LOS biosynthetic locus (not shown), while strain NCTC 11168 possesses the class C LOS locus.
The C. jejuni Turkey isolate is more pathogenic for piglets.
Because the C. jejuni Turkey and CS isolates were genetically indistinguishable as judged by MRP-PFGE, MLST, and comparative genomic hybridization analysis but differed significantly in their in vitro virulence capabilities, we focused our efforts on these two isolates to decipher the molecular basis for C. jejuni pathogenicity. However, we decided to perform in vivo experiments to assess the pathogenicity of the C. jejuni Turkey and CS isolates prior to comparing the protein and gene expression profiles. Noteworthy is that the infection of piglets with C. jejuni has been used previously as a model for Campylobacter-mediated enteritis, as infected piglets exhibit overt symptoms and histopathology that are characteristic of human infections (4). The C. jejuni Turkey isolate was more pathogenic than the CS isolate for piglets (Table 2). Diarrhea was noted in two of the three piglets inoculated with the C. jejuni Turkey isolate and none of the piglets inoculated with the C. jejuni CS isolate. A single Turkey-inoculated piglet developed hemorrhage in the colon, which was noted upon gross examination. Histological examination of intestinal samples was performed on piglets inoculated with the C. jejuni Turkey and CS isolates. Two of the three piglets inoculated with the C. jejuni Turkey isolate developed significant degenerative lesions in the small intestine. Also apparent in the small intestines of these two piglets were areas of congestion and cell necrosis. In the colon, the crypts were filled with eosinophilic debris and mucosal erosion was apparent, accompanied by a fibrinous exudate. One of the three C. jejuni CS-inoculated piglets exhibited minor pathological changes. This C. jejuni CS-inoculated piglet had congested vessels and slight villus degeneration.
|
|
|
|
70 and
54, respectively (10). All class I genes were expressed at a higher level in the C. jejuni CS isolate than in the C. jejuni Turkey isolate. In contrast, the
54-regulated flagellar genes were expressed at a lower level in the C. jejuni CS isolate than in the C. jejuni Turkey isolate (Fig. 4A). Moreover, flgG and flgH were also found to be expressed at a lower level in the C. jejuni CS isolate than in the C. jejuni Turkey isolate, even though differential expression of these genes was not detected by microarray analysis.
|
54-regulated flaB gene is poorly expressed in the C. jejuni CS isolate.
54-regulated flagellar genes were downregulated in the C. jejuni CS isolate. To determine if
54 is active in the C. jejuni CS isolate, we performed reporter assays with the pMW10 lacZ promoterless shuttle vector (80). The promoter regions of the
54-regulated flaB and
70-regulated metK genes were cloned upstream of the lacZ gene. C. jejuni F38011 was chosen as a positive control because we were unable to transform the C. jejuni Turkey isolate with a shuttle plasmid. Comparable levels of ß-galactosidase activity were noted in the C. jejuni F38011 and CS isolates harboring the PmetK-pMW10 construct. In contrast, the C. jejuni CS isolates harboring the PflaB-pMW10 construct showed almost no ß-galactosidase activity (Fig. 4B) compared to the C. jejuni F38011 isolate. This finding further suggests that
54 (RpoN)-regulated flagellar genes are not expressed in the C. jejuni CS isolate. To determine why the flaB flagellar gene is not expressed in the C. jejuni CS isolate, the entire rpoN operon (consisting of rpoN, Cj0667, Cj0668, and Cj0669) was sequenced in the C. jejuni Turkey and CS isolates to identify a frameshift or point mutation. No differences were found in the sequences of the genes contained within the rpoN operon of the C. jejuni Turkey and CS isolates. Furthermore, real-time RT-PCR indicated that all four genes in the rpoN operon of the C. jejuni Turkey and CS isolates were expressed at comparable levels.
Identification of point mutations in the flgR gene of the C. jejuni CS isolate.
We sequenced the entire ORFs of genes whose products are involved in either flagellar gene regulation or biosynthesis in an attempt to identify the molecular mechanism associated with disruption of flagellar biosynthesis in the C. jejuni CS isolate. The class I genes sequenced in the C. jejuni Turkey and CS isolates were flhA, flhB, flhF, fliF, fliG, fliH, fliI fliM, fliN, fliP, fliQ, and fliR. We also sequenced fliA (
28) and the genes known to interact or activate
54 including flgR and flgS. No nucleotide alterations were noted in the flhA, flhB, flhF, fliA, fliF, fliG, fliH, fliI, fliM, fliN, fliP, fliQ, fliR, and flgS genes of the C. jejuni Turkey and CS isolates. However, a difference was noted in a single nucleotide in the flgR gene that resulted in an amino acid change in the C. jejuni CS isolate compared to the Turkey isolate (Fig. 5A). The flgR gene encodes the response regulator of the FlgS/FlgR two-component regulatory system associated with the flagellar regulon. The amino acid change resides within in the receiver domain of the FlgR protein.
|
The C. jejuni CS isolate displays greater resistance to sodium deoxycholate than the C. jejuni Turkey isolate.
C. jejuni flagellar mutants (i.e., flgS, flgR, and rpoN mutants) have been shown previously to multiply at a rate three times greater than an isogenic wild-type isolate (81). While we did not find any differences in growth rates of the C. jejuni Turkey and CS isolates, the C. jejuni Turkey isolate displayed a longer lag phase than the C. jejuni CS isolate. Also, the C. jejuni CS isolate achieved a greater maximum cell density in MH medium than the C. jejuni Turkey isolate (Fig. 6).
|
|
To identify the molecular mechanism for the motility defects, we attempted to transform the C. jejuni S2B, S3, and H8a isolates with the pMW10 flaB promoter construct. Although we were unable to transform the C. jejuni H8a isolate with the pMW10 flaB construct, negligible ß-galactosidase activity was detected in the S2B and S3 isolates. Upon sequencing the rpoN genes from each of these isolates, it was found that a thymine base was inserted between bp 1004 and 1005 in the C. jejuni S2B isolate (Fig. 8A). This insertion resulted in an early termination codon at bp 1011. To determine if this frameshift mutation was responsible for the loss in
54 activity, a wild-type copy of the rpoN from C. jejuni NCTC 11168 was introduced into the C. jejuni S2B isolate using the pRY111 shuttle vector. The C. jejuni S2B isolate harboring the rpoNpRY111 shuttle vector was motile (Fig. 8B). The reason why the C. jejuni S3 and H8a isolates are nonmotile is not known currently.
|
| DISCUSSION |
|---|
|
|
|---|
Genetic variation among strains of Campylobacter spp. is well documented (2, 16, 42, 61, 64, 65, 71, 79). Dingle et al. (15) reported that C. jejuni cells form a weakly clonal population based on the distribution of strains among MLST sequence type complexes. In addition, various groups have shown that strains differ in their genomic contents using microarrays. Dorrell et al. (16) compared 11 C. jejuni strains with NCTC 11168 and found that at least 21% of the NCTC 11168 genome is divergent in one or more of the tested strains. Using a shotgun genomic microarray, Poly et al. (65) showed that there was significant variation between C. jejuni strains ATCC 43431 and NCTC 11168, especially at LOS, capsular biosynthesis, and restriction modification enzyme loci. Comparison of C. jejuni strains 81-176 and ATCC 43431 by the same method showed differences at similar loci (64). Finally, comparison of the whole genome sequences of NCTC 11168 and RM1221 identified the presence of phage i