AEM
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AEM.02681-06v1
73/12/4078    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Latour, X.
Right arrow Articles by Orange, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latour, X.
Right arrow Articles by Orange, N.
Agricola
Right arrow Articles by Latour, X.
Right arrow Articles by Orange, N.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, June 2007, p. 4078-4081, Vol. 73, No. 12
0099-2240/07/$08.00+0     doi:10.1128/AEM.02681-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

SHORT REPORT

Thermoregulation of N-Acyl Homoserine Lactone-Based Quorum Sensing in the Soft Rot Bacterium Pectobacterium atrosepticum{triangledown}

Xavier Latour,1* Stéphanie Diallo,1 Sylvie Chevalier,1 Danièle Morin,2 Bruno Smadja,1 Jean-François Burini,1 Dominique Haras,2 and Nicole Orange1

Laboratoire de Microbiologie du Froid - UPRES 2123, Université de Rouen, 55 rue Saint-Germain, F-27000 Evreux, France,1 Laboratoire de Biotechnologie et Chimie Marines, Université de Bretagne-Sud, B.P. 92116, F-56321 Lorient cedex, France2

Received 16 November 2006/ Accepted 21 April 2007


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 Effect of temperature on...
 Cloning, sequencing, and role...
 Effect of temperature on...
 REFERENCES
 
The psychrotolerant bacterium Pectobacterium atrosepticum produces four N-acyl homoserine lactones under a wide range of temperatures. Their thermoregulation differs from that of the exoenzyme production, described as being under quorum-sensing control. A mechanism involved in this thermoregulation consists of controlling N-acyl homoserine lactones synthase production at a transcriptional level.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
Effect of temperature on...
 Cloning, sequencing, and role...
 Effect of temperature on...
 REFERENCES
 
Several gram-negative bacteria synthesize N-acyl homoserine lactone (HSL) signal molecules that serve for cell-to-cell communication called for the first time quorum sensing (QS) by Fuqua et al. (7). Such regulatory systems operate to allow bacteria to sense cell density and to synchronize the functions of the entire population (reviewed in references 15, 23, and 29). In the Pectobacterium atrosepticum species (formerly Erwinia carotovora subsp. atroseptica) (8), QS regulation is involved in pectinolytic, cellulase, and protease activities, tuber maceration, and harpin synthesis leading to a hypersensitive response in nonhost plant (18, 25). In contrast, QS via HSL production does not regulate growth and mobility during initial infection events or during liquid culture in a synthetic medium (25).

Pectobacterium atrosepticum is a psychrotrophic bacterium involved in the soft rot of Solanum tuberosum (17, 26). Consequently, it causes important losses within cool temperate regions, where potatoes have traditionally been grown. The optimal temperature for pathogenicity, estimated to be around 20°C (19, 21), is a good compromise allowing both a fast multiplication (optimal at 24°C) and an efficient production of lytic enzymes, which is optimal at temperatures ranging between 12 and 24°C (26). As the thermoregulation of bacterial multiplication differs from that of exoenzyme production, we investigated the thermoregulation of QS that triggers exoenzyme synthesis. Therefore, HSL production and accumulation were measured during the three growth phases of a typical P. atrosepticum strain (Table 1) cultured at six temperatures. The role of the expI gene encoding the HSL synthase was determined by cloning this gene in Escherichia coli and by engineering a mutated strain of P. atrosepticum. Finally, the transcription of expI was estimated by relative reverse transcription-PCR (RT-PCR) under the same range of temperatures.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Bacterial strains and plasmidsa

 

   Effect of temperature on N-acyl HSL diversity and levels.
Top
 ABSTRACT
 INTRODUCTION
 Effect of temperature on...
Cloning, sequencing, and role...
 Effect of temperature on...
 REFERENCES
 
Bacterial cultures were grown at 8, 12, 15, 20, 24, and 28°C in minimal medium with polygalacturonic acid (PGA) as the sole source of carbon. This vegetable compound induces synthesis of virulence factors involved in plant disease or resistance that have been demonstrated to be under QS control (25). Characterization of HSLs was performed by high-performance liquid chromatography coupled with mass spectrometry (16). In these conditions, P. atrosepticum 6276 produces four HSLs: mainly N-3-oxo-octanoyl-L-HSL (3-oxo-C8-HSL) and minor quantities of N-octanoyl-L-HSL (C8-HSL), N-3-oxo-hexanoyl-L-HSL (3-oxo-C6-HSL), and N-3-oxo-decanoyl-L-HSL (3-oxo-C10-HSL). The HSL levels increase from the middle to the end of the logarithmic phase and then decline during the stationary phase (Fig. 1). Growth temperature significantly influences HSL quantities produced, and optimal HSL production occurs at 24°C. In this psychrotolerant species, significant HSL levels were measured at 12°C and HSL production was still observed at 8°C. In contrast, a negative effect appeared at a warmer temperature (28°C). Lastly, the four HSLs were produced and accumulated in the same way at each temperature (Fig. 1). These data do not allow an association of the production of a particular HSL with a typical growth phase or temperature.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 1. Effect of temperature on HSL production and accumulation by P. atrosepticum 6276. The HSLs were extracted from supernatant at exponential phase (white columns), late exponential phase (gray columns), and stationary growth phase (black columns). For each temperature point, at least three independent cultures were made. Each bar represents the standard deviation. OD580U, unit of optical density at 580 nm.

 

   Cloning, sequencing, and role of expI.
Top
 ABSTRACT
 INTRODUCTION
 Effect of temperature on...
 Cloning, sequencing, and role...
Effect of temperature on...
 REFERENCES
 
The primers ExpI1C (5'TGAATTGGGCGGTAAAAATGT3') and ExpI2C (5'AATTCACCGTTGCCAAGAAG3'), deduced from the E. carotovora subsp. carotovora SCC1 genome (22), were used for amplification of expI by PCR. The single PCR product (651 bp) was cloned into the pMOS Blue vector as described by the manufacturer (pMOS Blue blunt-ended cloning kit; Amersham Pharmacia Biotech, Little Chalfont, United Kingdom) and introduced into E. coli XL1-Blue cells by electroporation according to standard procedures (13). Positive clones were checked by PCR using the two above-described oligonucleotides as primers, and the sequence of the cloned fragment was determined (Genome Express, Meylan, France). In silico sequence analyses were performed with programs available at the Infobiogen web site (Bioinformatic Resources center; http://www.infobiogen.fr/). A unique gene, named expI for exoenzyme production inducer (20), was identified in P. atrosepticum 6276 (GenBank accession no. AJ580599). Comparison of sequences of the 216-amino-acid-residue peptide deduced from in silico translation showed, respectively, 98% and 97% identities with E. carotovora subsp. carotovora EC153 and E. carotovora SCC3193 HSL synthase proteins (4, 20).

An HSL-deficient P. atrosepticum 6276 mutant was obtained by random transposon mutagenesis. A bank of random insertion mutants was made by using the mini-Tn5 transposon delivery system carried by the pAG408 suicide vector (27). The Escherichia coli S17-1{lambda}pir strain was used as the donor in a mating experiment to transfer the suicide plasmid into P. atrosepticum 6276. Transconjugants were selected on PGA agar (25) plates supplemented with kanamycin (50 µg·liter–1) and gentamicin (30 µg·liter–1) and then tested on indicative LB plates containing an HSL monitor bacterium (Chromobacterium violaceum CV026) (14). Among transconjugants analyzed, one did not display purple color in the surrounding agar. For this mutant strain, named P. atrosepticum 6276-EI, PCR experiments show that the transposable element is integrated approximately 500 bp downstream from the expI translation start codon.

At the optimal temperature of production (24°C), HSL synthesis was totally altered in P. atrosepticum 6276-EI, since no HSL was detected. In contrast, tenuous but quantifiable amounts of 3-oxo-C8-HSL and C8-HSL were detected in the E. coli XL1-Blue strain harboring the complete expI gene when grown at 24°C in LB medium, but no HSLs were detected in the wild strain (data not shown). Soft rot in tuber was assessed by testing at the optimal temperature of HSL production as described previously (25). The test confirmed, in planta, the importance of the expI gene in the QS and in the consequent tissue maceration. No macerated tissue was found on tubers 7 days after inoculation with P. atrosepticum 6276-EI (Fig. 2). This lack of maceration is attributed to the absence of HSL synthesis in the potato tuber.


Figure 2
View larger version (54K):
[in this window]
[in a new window]

  		FIG. 2. Role of expI gene on tuber disease. Potato tubers were infected by P. atrosepticum 6276 and incubated at 24°C. The development of symptoms was evaluated after 7 days.

 

   Effect of temperature on expI expression.
Top
 ABSTRACT
 INTRODUCTION
 Effect of temperature on...
 Cloning, sequencing, and role...
 Effect of temperature on...
REFERENCES
 
The kinetics of the expI transcription were determined by semiquantitative RT-PCR experiments with P. atrosepticum 6276 cultured in PGA medium. Total RNAs were extracted as described by the manufacturer (RNA isolation kit; Roche Diagnostics, Mannheim, Germany). For calibration, an RT-PCR was also performed using R16S1C (5'-GGGGGTAGAATTCCAGGTGT-3') and R16S2C (5'-CGGCAGTCTCCTTTGAGTTC-3') primers, amplifying a unique 495-bp fragment of the P. atrosepticum E1 16S ribosomal gene (6). At each studied temperature, expI transcript amounts were most important at the end of the exponential growth phase. From 8°C to 24°C, amounts of transcripts increased in the same manner as the growth temperature, and a negative effect appeared at 28°C (Fig. 3). The thermoregulation of expI transcription and that of HSL levels are identical throughout the bacterial culture (Fig. 1 and 3).


Figure 3
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 3. Effect of temperature on expI gene expression in P. atrosepticum 6276. Transcription of expI was determined by RT-PCR experiments with cells harvested from exponential phase, late exponential phase, and stationary growth phase. Results obtained on 1% agarose gels were expressed as the ratio of expI transcripts to 16S transcripts.

 
Pectobacterium atrosepticum 6276 harbors the QS signaling system of class I recently defined by Chatterjee et al. (4). This trait is linked to the structural characteristics of its HSL synthase (2, 28). We suggest that only 3-oxo-C8-HSL corresponds to a QS signal and that the others are less specific products of ExpI synthase or catabolites that appear during HSL turnover. This hypothesis is supported by (i) HSL concentrations usually measured in other Pectobacterium strains (1, 3, 30), (ii) the absence of HSL synthesis in an expI-deficient mutant, (iii) the major production of this HSL by another bacterial species (E. coli) complemented with expI, and (iv) the identical thermoregulation of each HSL.

The effect of temperature on extracellular HSL concentration is the concomitant result of HSL production and degradation. Previous studies showed that HSL degradation could be influenced by pH or temperature: nonenzymatic lysis is increasingly favored in LB medium with increasing pH (from neutral to mildly alkaline) and temperature over a range from 22 to 37°C (3, 31). However, in PGA medium, during the bacterial growth, a decrease of pH from 8 to 7.2 is observed (data not shown). In these conditions, the HSL autolysis seems to be minor, since we observed at each temperature tested an increase of HSL production from the log exponential to the early stationary phase over a decrease in the pH of the medium (Fig. 1). Here we show that the thermoregulation of QS molecules reflects the thermoregulation of HSL synthesis.

Another report in this work is that the QS thermoregulation is identical to that of the bacterial growth that we have previously described for strain 6276 under the same culture conditions (26). However, by engineering P. atrosepticum 6276 which expresses a lactonase and so is unable to produce high concentrations of HSLs, we have shown that QS does not control bacterial growth in vitro (PGA medium) and in planta (25). This suggests that the HSL synthesis pathway is not thermoregulated differently from the main pathways involved in the basal metabolism. Besides, our results show that one of the mechanisms involved in the QS thermoregulation consists of controlling HSL synthase production by modulating the amounts of expI transcripts. This temperature-dependent regulation could occur at the level of transcription initiation involving temperature-sensitive sigma factors or by production of small RNAs which would act as thermosensors (9, 10). In contrast, the QS thermoregulation differs from that one of the main virulence factors studied in the soft rot bacterium Pectobacterium. Indeed, these bacteria secrete a large variety of extracellular lytic enzymes. Among them, the pectate lyase has been described as the most important cause of maceration and cell killing (11). In P. atrosepticum 6276, the optimal temperature for pectate lyase production (between 12 and 15°C) is lower than the optimal temperature for HSL synthesis (24°C), while this exoenzyme production is under QS control (25, 26). These results strongly suggest that the thermoregulation of pectate lyase production occurs downstream of quorum signaling.


   ACKNOWLEDGMENTS
 
We thank A. Dufour for critical review of the manuscript.

This study was supported by a grant from Conseil Régional de Haute-Normandie and Comité Nord.


   FOOTNOTES
 
* Corresponding author. Mailing address: Laboratoire de Microbiologie du Froid - UPRES 2123, Université de Rouen, 55 rue Saint-Germain, F-27000 Evreux, France. Phone: 33 2 32291549. Fax: 33 2 32291550. E-mail: xavier.latour{at}univ-rouen.fr Back

{triangledown} Published ahead of print on 27 April 2007. Back


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 Effect of temperature on...
 Cloning, sequencing, and role...
 Effect of temperature on...
 REFERENCES
 

  1. Bainton, N. J., P. Stead, S. R. Chhabra, B. W. Bycroft, G. P. C. Salmond, G. S. A. B. Stewart, and P. Williams. 1992. N-(3-Oxohexanoyl)-L-homoserine lactone regulates carbapenem antibiotic production in Erwinia carotovora. Biochem. J. 288:997-1004.[Medline]
  2. Brader, G., S. Sjöblom, H. Hyytiäinen, K. Sims-Huopaniemi, and E. T. Palva. 2005. Altering substrate chain length specificity of an acylhomoserine lactone synthase in bacterial communication. J. Biol. Chem. 280:10403-10409.[Abstract/Free Full Text]
  3. Byers, J. T., C. Lucas, G. P. C. Salmond, and M. Welch. 2002. Nonenzymatic turnover of an Erwinia carotovora quorum-sensing signaling molecule. J. Bacteriol. 184:1163-1171.[Abstract/Free Full Text]
  4. Chatterjee, A., Y. Cui, H. Hasegawa, N. Leigh, V. Dixit, and A. K. Chatterjee. 2005. Comparative analysis of two classes of quorum-sensing signaling systems that control production of extracellular proteins and secondary metabolites in Erwinia carotovora subspecies. J. Bacteriol. 187:8026-8038.[Abstract/Free Full Text]
  5. de Lorenzo, V., M. Herrero, U. Jakubzik, and K. N. Timmis. 1990. Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria. J. Bacteriol. 172:6568-6572.[Abstract/Free Full Text]
  6. Fessehaie, A., S. H. De Boer, and C. A. Levesque. 2002. Molecular characterization of DNA encoding 16S-23S rRNA intergenic spacer regions and 16S rRNA of pectinolytic Erwinia species. Can. J. Microbiol. 48:387-398.[CrossRef][Medline]
  7. Fuqua, W. C., S. C. Winans, and E. P. Greenberg. 1994. Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J. Bacteriol. 176:269-275.[Free Full Text]
  8. Gardan, L., C. Gouy, R. Christen, and R. Samson. 2003. Elevation of three subspecies of Pectobacterium carotovorum to species level: Pectobacterium atrosepticum sp. nov., Pectobacterium betavasculorum sp. nov. and Pectobacterium wasabiae sp. nov. Int. J. Syst. Evol. Microbiol. 53:381-391.[Abstract/Free Full Text]
  9. Hasegawa, H., A. Chatterjee, Y. Cui, and A. K. Chatterjee. 2005. Elevated temperature enhances virulence of Erwinia carotovora subsp. carotovora strain EC153 to plants and stimulates production of the quorum-sensing signal, N-acyl homoserine lactone, and extracellular proteins. Appl. Environ. Microbiol. 71:4655-4663.[Abstract/Free Full Text]
  10. Johansson, J., and P. Cossart. 2003. RNA-mediated control of virulence gene expression in bacterial pathogens. Trends Microbiol. 11:280-285.[CrossRef][Medline]
  11. Liao, C.-H. 1989. Analysis of pectate lyases produced by soft rot bacteria associated with spoilage of vegetables. Appl. Environ. Microbiol. 55:1677-1683.[Abstract/Free Full Text]
  12. Liss, L. 1987. New M13 host: DH5F’ competent cells. Focus 9:13.
  13. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  14. McClean, K. H., M. K. Winson, L. Fish, A. Taylor, S. R. Chhabra, M. Camara, M. Daykin, J. H. Lamb, S. Swift, B. W. Bycroft, G. S. A. B. Stewart, and P. Williams. 1997. Quorum sensing and Chromobacterium violaceum. Exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology 143:3703-3711.[Abstract]
  15. Miller, M. B., and B. L. Bassler. 2001. Quorum sensing in bacteria. Annu. Rev. Microbiol. 55:165-199.[CrossRef][Medline]
  16. Morin, D., B. Grasland, K. Vallée-Réhel, C. Dufau, and D. Haras. 2003. On-line high-performance liquid chromatography-mass spectrometric detection and quantification of N-acyl homoserine lactones, quorum-sensing signal molecules, in the presence of biological matrices. J. Chromatogr. A 1002:79-92.[CrossRef][Medline]
  17. Morita, R. Y. 1975. Psychrophilic bacteria. Bacteriol. Rev. 39:144-167.[Free Full Text]
  18. Pérombelon, M. C. M. 2002. Potato diseases caused by soft rot erwinias: an overview of pathogenesis. Plant Pathol. 51:1-12.[CrossRef]
  19. Pérombelon, M. C. M., and G. P. C. Salmond. 1995. Bacterial soft rots, p. 1-20. In I. U. S. Singh, R. P. Singh, and K. Kahmoto (ed.), Pathogenesis and host specificity in plant disease. Pergamon Press, Oxford, United Kingdom.
  20. Pirhonen, M., D. Flego, R. Heikinheimo, and E. T. Palva. 1993. A small diffusible signal molecule is responsible for the global control of virulence and exoenzyme production in plant pathogen Erwinia carotovora. EMBO J. 12:2467-2476.[Medline]
  21. Priou, S., and B. Jouan. 1996. Les maladies provoquées par les bactéries pathogènes du genre Erwinia, p. 260-265. In P. Rousselle, Y. Robert, and J. C. Crosnier (ed.), La pomme de terre. INRA Editions, Paris, France.
  22. Rantakari, A., O. Virtaharju, S. Vähämiko, S. Taira, E. T. Palva, H. T. Saarilahti, and M. Romantschuk. 2001. Type III secretion contributes to the pathogenesis of the soft-rot pathogen Erwinia carotovora: partial characterization of the hrp gene cluster. Mol. Plant-Microbe Interact. 14:962-968.[Medline]
  23. Reading, N. C., and V. Sperandio. 2006. Quorum sensing: the many languages of bacteria. FEMS Microbiol. Lett. 254:1-11.[CrossRef][Medline]
  24. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  25. Smadja, B., X. Latour, D. Faure, S. Chevalier, Y. Dessaux, and N. Orange. 2004. Involvement of N-acylhomoserine lactones throughout the plant infection by Erwinia carotovora subsp. atroseptica (Pectobacterium atrosepticum). Mol. Plant-Microbe Interact. 17:1269-1278.[Medline]
  26. Smadja, B., X. Latour, S. Trigui, J. F. Burini, S. Chevalier, and N. Orange. 2004. Thermodependence of growth and enzymatic activities implicated in pathogenicity of two Erwinia carotovora subspecies (Pectobacterium spp.). Can. J. Microbiol. 50:19-27.[CrossRef][Medline]
  27. Suarez, A., A. Guttler, M. Stratz, L. H. Staendner, K. N. Timmis, and C. A. Guzman. 1997. Green fluorescent protein-based reporter systems for genetic analysis of bacteria including monocopy applications. Gene 196:69-74.[CrossRef][Medline]
  28. Welch, M., J. M. Dutton, F. G. Glansdorp, G. L. Thomas, D. S. Smith, S. J. Coulthurst, A. M. L. Barnard, G. P. C. Salmond, and D. R. Spring. 2005. Structure-activity relationships of Erwinia carotovora quorum sensing signaling molecules. Bioorg. Med. Chem. Lett. 15:4235-4238.[CrossRef][Medline]
  29. Whitehead, N. A., A. M. L. Barnard, H. Slater, N. J. L. Simpson, and G. P. C. Salmond. 2001. Quorum-sensing in gram-negative bacteria. FEMS Microbiol. Rev. 25:365-404.[CrossRef][Medline]
  30. Wilson, K. J., A. Sessitch, J. C. Corbo, K. E. Giller, A. D. L. Akkermans, and R. A. Jefferson. 1995. Beta-glucuronidase (GUS) transposons for ecological and genetic studies of rhizobia and other gram-negative bacteria. Microbiology 141:1691-1705.[Abstract]
  31. Wirth, R., A. Muscholl, and G. Wanner. 1996. The role of pheromones in bacterial interactions. Trends Microbiol. 4:96-103.[CrossRef][Medline]
  32. Yates, E. A., B. Philipp, C. Buckley, S. Atkinson, S. R. Chhabra, R. E. Sockett, M. Goldner, Y. Dessaux, M. Camara, H. Smith, and P. Williams. 2002. N-Acylhomoserine lactones undergo lactonolysis in pH-, temperature-, and acyl chain length-dependent manner during growth of Yersinia pseudotuberculosis and Pseudomonas aeruginosa. Infect. Immun. 70:5635-5646.[Abstract/Free Full Text]

Applied and Environmental Microbiology, June 2007, p. 4078-4081, Vol. 73, No. 12
0099-2240/07/$08.00+0     doi:10.1128/AEM.02681-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AEM.02681-06v1
73/12/4078    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Latour, X.
Right arrow Articles by Orange, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latour, X.
Right arrow Articles by Orange, N.
Agricola
Right arrow Articles by Latour, X.
Right arrow Articles by Orange, N.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Microbiol. Mol. Biol. Rev. Eukaryot. Cell All ASM Journals