AEM
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AEM.00119-07v1
73/13/4286    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mruk, I.
Right arrow Articles by Kaczorowski, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mruk, I.
Right arrow Articles by Kaczorowski, T.
Agricola
Right arrow Articles by Mruk, I.
Right arrow Articles by Kaczorowski, T.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, July 2007, p. 4286-4293, Vol. 73, No. 13
0099-2240/07/$08.00+0     doi:10.1128/AEM.00119-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

A Rapid and Efficient Method for Cloning Genes of Type II Restriction-Modification Systems by Use of a Killer Plasmid{triangledown}

Iwona Mruk and Tadeusz Kaczorowski*

Department of Microbiology, University of Gdansk, Kladki 24, 80-822 Gdansk, Poland

Received 17 January 2007/ Accepted 18 April 2007


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We present a method for cloning restriction-modification (R-M) systems that is based on the use of a lethal plasmid (pKILLER). The plasmid carries a functional gene for a restriction endonuclease having the same DNA specificity as the R-M system of interest. The first step is the standard preparation of a representative, plasmid-borne genomic library. Then this library is transformed with the killer plasmid. The only surviving bacteria are those which carry the gene specifying a protective DNA methyltransferase. Conceptually, this in vivo selection approach resembles earlier methods in which a plasmid library was selected in vitro by digestion with a suitable restriction endonuclease, but it is much more efficient than those methods. The new method was successfully used to clone two R-M systems, BstZ1II from Bacillus stearothermophilus 14P and Csp231I from Citrobacter sp. strain RFL231, both isospecific to the prototype HindIII R-M system.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the biology of microorganisms, the restriction-modification (R-M) systems play the important role of "molecular wardens" by protecting bacteria against phage infections. On the other hand, the enzymatic constituents of these systems have also made great contributions to the field of recombinant DNA technology and have served as attractive models for the study of DNA-protein interactions due to the exact mode of target recognition (33, 34, 37). However, practical applications are limited almost solely to the enzymes belonging to type II R-M systems. Each of these systems is composed of two entities that act independently: a restriction endonuclease (ENase) that recognizes and cleaves a specific short nucleotide sequence (4 to 8 bp) in DNA and a methyltransferase (MTase) that modifies the same sequence in order to protect the host genomic DNA against the action of the cognate restriction enzyme. As both genes coding for R-M systems are usually localized in close proximity (55), cloning an MTase gene often results in the cloning of a matching ENase gene.

Until now, more than 400 type II R-M systems have been cloned (38) by the use of either (i) the "Hungarian trick" (45), which selects clones carrying the gene coding for a specific DNA MTase that confers resistance to digestion by the cognate restriction enzyme; (ii) methods based on the detection of SOS response induction in Escherichia coli (10, 32); or (iii) a direct search through genomic databases to identify open reading frames coding for conserved amino acid sequence motifs characteristic of DNA MTases, followed by PCR-based cloning (27).

Our research is focused on the nature of the isospecificity phenomenon among type II R-M systems. We would like to know (i) how similar the genes coding for isospecific enzymes are, (ii) whether is it possible to map their functional domains, (iii) whether the systems recognize a cognate sequence in the same way, (iv) what their mode of action is, and (v) how those systems spread among bacteria.

For the model in our study, we decided to use a group of systems isospecific to HindIII, an R-M system from Haemophilus influenzae Rd (30, 39). This group consists of over 30 R-M systems isolated from different bacteria, all of them recognizing the same specific palindromic sequence: 5'-AAGCTT-3' (38). To date, except for HindIII (28), only two systems, EcoVIII from Escherichia coli E1585-68 (15, 26) and LlaCI from Lactococcus lactis subsp. cremoris W15, have been cloned and sequenced (22).

The phenomenon of isospecificity among type II R-M systems is interesting in many ways. First, it poses the intriguing question of how genes that code for functional homologs evolve in bacteria that are often phylogenetically remote. In addition, the structural analysis of these enzymes can help to identify particular protein motifs responsible for catalysis and target recognition and, consequently, may lead to the designing of enzymes with novel/tailored specificities in the future. At the moment, the small number of cloned isospecific systems makes such studies difficult. Therefore, we have developed a simple cloning method to speed up our research efforts. The method is based on the use of the killer plasmid, which simplifies the selection of clones carrying the gene coding for a specific DNA MTase. In this paper, we report the successful application of this approach to the cloning of two new HindIII-isospecific R-M systems: BstZ1II of Bacillus stearothermophilus 14P and Csp231I of Citrobacter sp. strain RFL231.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial strains and plasmids.
The bacterial strains used in this study, Bacillus stearothermophilus 14P (BstZ1II R+ M+, where R is endonuclease activity and M is DNA methyltransferase activity) and Citrobacter sp. strain RFL231 (Csp231I R+ M+), were kindly provided by E. Raleigh, New England Biolabs, and A. Janulaitis, MBI Fermentas, Lithuania, respectively. Batch cultures of B. stearothermophilus 14P were grown at 55°C. The strains of E. coli used were DH5{alpha}, MM294 (40), and MMS1999 (MM294 attB::ecoVIIIRM bla), obtained from M. Sektas, Department of Microbiology, University of Gdansk, Poland. Bacteria were cultivated in LB or LA medium (40) that was supplemented, when required and as appropriate, with the following antibiotics: ampicillin (Ap), 100 µg/ml; tetracycline (Tc), 15 µg/ml; and chloramphenicol (Cm), 30 µg/ml. The following plasmids were used in this work: pKRP10 as a source for the cat (Cmr) cassette (35), and pGEM3Zf(+), pSP72 (Promega), and pBR322 (6) as vectors for cloning experiments.

DNA isolation and manipulation.
For molecular cloning, we used standard techniques (40). Recombinant plasmids were transformed into an appropriate E. coli strain and verified by restriction analysis and automated DNA sequencing. Genomic DNA was isolated as described previously (40) or with the use of a Genomic Mini AX bacterial kit (A&A Biotechnology). Restriction ENases and DNA-modifying enzymes were purchased from New England Biolabs, Epicentre, or MBI Fermentas. Enzymatic reactions were carried out under conditions suggested by the suppliers. PCRs were performed with DyNAzyme II DNA polymerase from Thermus brockianus (Finnzymes Inc.).

Genomic library construction.
Ten micrograms of genomic DNA from Bacillus stearothermophilus 14P or Citrobacter sp. strain RFL231 was partially digested with EcoRI, cloned into the EcoRI site of pBR322, and introduced into E. coli MM294. The resultant transformants were selected for resistance by plating on LA medium with Ap and Tc.

Oligonucleotides and DNA sequencing.
Oligonucleotide synthesis was performed by Proligo. The following primers were used for PCR (all listed 5' to 3'): for vectorette PCR, VecTOP (GATCAGGCTGGAGATGT AGCAGATTGAGATATTCGTTATAGTTTACCTATCCCGACCGAGCATG), VecBOT (CATGCTCGGTCGGGATAGGCACTGGTCTAGAGGGTTAGGTTCCTGCTACATCTCCAGCCTGATC), VecPRIM (AGGCACTGGTCTAGAGGGTTAGGTTC), and BST4 (CATTCTGTTAC CATAGCC); for inverse PCR, BST12 (GAAATGTTTCAGCAGTAC), and BST13 (AAACTATGC TATATTTT ATAC).

DNA sequence analysis was performed using the ABI Prism BigDye Terminator cycle sequencing ready reaction kit, version 2.0 (Applied Biosystems), as recommended by the manufacturer. The DNA template amounts for the sequencing reactions were 50 ng for the PCR fragment, 300 ng for plasmid DNA, and 3 µg in the case of the chromosomal DNA of Citrobacter sp. strain RFL231. The cycling temperature profile for the sequencing of the chromosomal DNA was as follows: 5 min at 96°C; 90 cycles of 96°C for 1.5 min, 50°C for 1 min, 60°C for 3 min; and extension at 72°C for 5 min. Products were analyzed using the ABI PRISM 310 automated sequencer (Perkin-Elmer, Applied Biosystems).

Vectorette and inverse PCR.
Two PCR techniques were performed in order to reconstruct the cloned 5' end of a 10-kb EcoRI DNA fragment from B. stearothermophilus 14P: vectorette PCR (1, 4) and inverse PCR (I-PCR) (18, 29). The vectorette unit was produced by hybridizing 500 pmol VecTOP with 500 pmol VecBOT in 50 µl containing 33 mM Tris-acetate (pH 7.8), 66 mM potassium acetate, 10 mM magnesium acetate, and 0.5 mM dithiothreitol; heating the mixture to 80°C; and then gradually cooling it to room temperature.

Approximately 1 µg of purified genomic DNA from B. stearothermophilus 14P was digested with SspI or RsaI to produce blunt ends. Vectorette libraries were constructed by ligating the corresponding compatible vectorette units to the obtained DNA fragments. The ligation mixture (10 µl) contained 10 pmol of the vectorette units, the fragmented genomic DNA (1 µg), 33 mM Tris-acetate (pH 7.8), 66 mM potassium acetate, 10 mM magnesium acetate, 0.5 mM dithiothreitol, 1 mM ATP, and 12 U of T4 DNA ligase. After incubation at 20°C for 1.5 h, the reaction mixture was inactivated by heating (60°C, 10 min). Vectorette libraries were amplified in 50-µl reaction mixtures containing 50 pmol of specific primer (BST4), 50 pmol of vectorette primer (VecTOP), 10 mM Tris-HCl, (pH 8.3), 1.5 mM MgCl2, 150 µM deoxynucleoside triphosphates, and 5 U of DyNAzyme II DNA polymerase. The PCR was run at 96°C for 1 min, 56°C for 1 min, and 72°C for 2 min for 30 cycles, followed by extension at 72°C for 10 min.

The I-PCR includes digestion of target genomic DNA, self-ligation of the DNA fragment, and amplification of the circularized fragment by PCR. One microgram of genomic DNA from Bacillus stearothermophilus 14P was digested with HinfI enzyme and self-ligated as previously described. PCRs were carried out using 50-µl volumes of the following ingredients: the total DNA from the previous step, 50 pmol of primer BST12, 50 pmol of primer BST13, 10 mM Tris-HCl, (pH 8.3), 1 mM magnesium chloride, 500 µM deoxynucleoside triphosphates, and 5 U of DNA polymerase. The PCRs were run with the following cycling conditions: 96°C for 1 min; 30 cycles of 96°C for 1 min, 56°C for 1 min, and 72°C for 3 min; and a final step at 72°C for 10 min. The PCR products obtained as a result of the two methods were separated by 7% polyacrylamide gel electrophoresis, eluted, and analyzed by DNA sequencing.

Expression of genes coding for R.BstZ1II and R.Csp231I in E. coli.
To express the gene coding for BstZ1II ENase in E. coli cells, the EcoRI-BamHI fragment (4.3 kb, R M+) was subcloned into pSP72. After digestion with EcoRI and EcoRV, the resultant plasmid, pSPBst4.3 (R M+), was used for cloning a 475-bp DNA fragment containing the 5' end of bstZ1IIR. This fragment was amplified from B. stearothermophilus genomic DNA by PCR (primers 5'-CATTCTGTTACCATAGCC-3' and 5'-GAGAATTCCTGTATAAGTTG-3'; underlining indicates EcoRI site) and then processed with EcoRI. The construct obtained, pBstZ1II (R+ M+), was introduced into E. coli MM294. The cloning procedure was successful only if the cells were carrying the plasmid bearing the M.EcoVIII gene (pEcoVIIIM1), which has the same specificity as M.BstZ1IIIM. Thus, MTase was preexpressed in competent cells as described for the BamHI and DdeI R-M system (7, 13).

For the expression of the gene coding for R.Csp231I, a 2.4-kb EcoRI-BglII DNA fragment was cloned into pSP72 double digested with EcoRI and BglII to generate pSPCsp3.1 (Csp231I R M+). Then a 0.53-kb DNA fragment coding for C.Csp231I as well as the N-terminal portion of the R.Csp231I was amplified by PCR from the genomic DNA of Citrobacter sp. strain RFL231 (primers 5'-AGGAATTCTTAGCAAAAGTG-3' and 5'-ATGATCACTAAACCAACG-3'), cleaved with EcoRI, ligated into EcoRI-digested pSPCsp3.1, and introduced into premethylated competent E. coli MM294(pEcoVIIIM1) cells. The sequence of the newly generated plasmid (pCsp231I, R+ M+) was confirmed.

To determine the activity of R.BstZ1II or R.Csp231I, E. coli strains containing the different ENase gene-bearing plasmids were grown and lysed by sonication or by incubation with lysozyme (0.4 mg/ml). Restriction activity was assayed in a 20-µl reaction mixture containing 0.5 µg of {lambda} DNA, 10 mM Tris-HCl (pH 7.9), 50 mM NaCl, 10 mM MgCl2, 1 mM dithiothreitol, and a solution of cell extract containing the enzyme (15 min at 37°C for R.Csp231I or 15 min at 55°C for R.BstZ1II). The products of {lambda} DNA digestion were analyzed on 1% agarose gels.

Computational analysis of DNA and proteins.
Nucleotide and protein sequences were searched for in the GenBank database (http://www.ncbi.nlm.nih.gov) using the BLAST program (2). Protein sequences were aligned by using the CLUSTAL W program (47), accessible through the European Bioinformatics Institute server (http://www.ebi.ac.uk). Genes coding for the BstZ1II and Csp231I R-M systems were analyzed with DNASIS software (Hitachi Software Engineering).

Nucleotide sequence accession numbers.
The nucleotide sequences of genes coding for the BstZ1II and Csp231I R-M systems have been deposited in the GenBank database under accession numbers AY789018 and AY787793, respectively.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Construction of the lethal plasmid pKILLER.
Plasmid pKILLER was constructed from a naturally occurring plasmid, pEC156, that carries the genes of the EcoVIII R-M system (25, 26). In the first step of the plasmid construction, a 0.8-kb XbaI fragment (cat gene, Cmr) derived from pKRP10 (35) was cloned into the pEC156 plasmid linearized with NheI. The obtained pEC156 derivative (pIB8, EcoVIII R+ M+) (Fig. 1A), after removal of the EcoRV-NruI DNA fragment (354 bp) from the ecoVIIIM gene, was ligated, resulting in a final construct. Thus, pKILLER (EcoVIII R+ M; 4.7 kb) contains a functional gene coding for EcoVIII ENase and an inactive gene coding for the cognate MTase (Fig. 1A). To demonstrate its efficiency in selecting clones carrying a gene for specific MTase, the pKILLER plasmid was introduced into E. coli strain MM294, used as a host in cloning experiments. As expected, no transformants were obtained due to the lethal effect of the pKILLER plasmid which, inside the bacterial cell, functions as a Trojan horse. Therefore, to maintain and propagate pKILLER in bacteria, E. coli MMS1999, which contains a chromosomal copy of the gene coding for EcoVIII MTase, was used as a host.


Figure 1
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 1. Construction of the pKILLER plasmid and its use in selecting clones carrying a specific MTase gene. (A) Construction of pKILLER. An antibiotic cassette (cat gene, Cmr) was inserted into the pEC156 plasmid (NheI site), resulting in pIB8. pKILLER was then created by deleting the NruI-EcoRV DNA fragment from the ecoVIIIM gene. Thus, pKILLER contains a functional EcoVIII ENase gene but not a functional gene coding for the cognate MTase. (B) Screening the clones obtained as a result of the selection procedure based on the use of pKILLER. Clones 1 to 3 are from the Bacillus stearothermophilus 14P genomic library; clones 4 to 6 are from the Citrobacter sp. strain RFL231 genomic library. Lanes: a, uncut plasmid DNA; b, plasmid DNA cleaved with HindIII; c, plasmid DNA cleaved with EcoRI. The arrows indicate the linear forms of vector (pBR322) and pKILLER. The appropriate inserts carrying the MTase gene (10 kbp in the case of BstZ1II and 3.1 kbp for Csp231I) are indicated with arrows labeled "insert."

 
Cloning strategy.
The cloning procedure was carried out separately for Bacillus stearothermophilus 14P and Citrobacter sp. strain RFL231. In short, the steps involved in our method were as follows: (i) the genomic library was constructed by digesting DNA with the suitable restriction enzyme, ligating DNA fragments to the plasmid vector, and introducing the recombinant plasmids into E. coli cells; (ii) competent cells were prepared from the pooled transformants; (iii) competent cells were transformed with pKILLER and clones harboring the specific MTase gene were selected; and (iv) restriction analysis of the obtained recombinants was performed, and clones producing specific MTase were identified. In greater detail, the first step was the preparation of a genomic library for each species as described in Materials and Methods. A total of approximately 3,000 clones was obtained for each library. These transformants, separately for each genomic library, were pooled together and used for preparing competent cells using the standard CaCl2-heat shock method (40). Finally, competent cells harboring the genomic library were transformed with 1 µg of plasmid pKILLER. Cells were plated on LA medium supplemented with Ap, Tc, and Cm to select for clones whose genomic DNA is protected against cleavage by the cognate restriction endonuclease due to the presence of a specific DNA MTase. Using this approach, we obtained approximately 50 colonies for each genomic library. In order to identify clones producing specific MTase, individual plasmid isolates were tested for resistance to HindIII cleavage (pBR322, used as a vector, possesses one HindIII site). The results of this test revealed that 90% ± 3% of clones contained plasmid DNA resistant to HindIII digestion (Fig. 1B, lanes a and b), suggesting the presence of the MTase gene. Two clones chosen for further analysis contained a 10-kb EcoRI DNA fragment from Bacillus stearothermophilus 14P (pG10) (Fig. 1B, lanes 1c, 2c, and 3c) and a 3.1-kb EcoRI DNA fragment in the case of Citrobacter sp. strain RFL231 (pG3) (Fig. 1B, lanes 4c, 5c, and 6c). Restriction analysis also revealed the presence of pKILLER (Fig. 1B, lanes 1c, 2c, 3c, 4c, 5c, and 6c). The rest of the analyzed clones (~10%) have not possessed a gene for MTase or shown EcoVIII ENase activity (data not shown). This, however, contradicts our earlier experiments and might be explained by mutations of unknown origin within the ecoVIIIR gene. Plasmid pKILLER was removed from selected clones after they were grown for a few generations without selection for resistance (Cm).

The 10-kb EcoRI DNA fragment derived from pG10 (B. stearothermophilus 14P genomic library) (Fig. 1B, lanes 1c, 2c, and 3c) and the 3.1-kb EcoRI DNA fragment from pG3 (Citrobacter sp. strain RFL231 genomic library) (Fig. 1B, lanes 4c, 5c, and 6c), which carried genes for the DNA MTases BstZ1II and Csp231I, respectively, were subcloned into the pGEM3Zf(+) vector digested with EcoRI. A reduced 4.3-kb EcoRI-BamHI DNA fragment from pG10 (BstZ1II R M+) and the entire 3.1-kb EcoRI DNA fragment from pG3 (Csp231I R M+) were sequenced using the "primer walking" method. A total of 30 sequencing reactions were performed in both directions for each clone.

Sequence analysis of the BstZ1II R-M system.
Analysis of the 4.3-kb EcoRI DNA fragment of the pG10 plasmid (BstZ1II R M+) revealed the presence of two large open reading frames (ORFs) divergently oriented (Fig. 2A). The ORF1 DNA sequence lacked a start codon and was considered incomplete at its 5' end (defined by an EcoRI site). The deduced amino acid (aa) sequence of ORF2 (nucleotides [nt] 2584 to 1241) exhibits significant positional identity to those of other isospecific MTases of the M.HindIII prototype, suggesting that ORF2 codes for the 447-aa M.BstZ1II (Mr, 51,140). A putative ribosome-binding sequence, AAGGAG, is present 10 bp upstream of the ATG start codon of the bstZ1IIM gene. Moreover, a fragment of a RadC gene homolog from Bacillus subtilis was found upstream of the bstZ1IIM gene (24) as well as the portion of the gene cluster involved in the utilization of {alpha}-D-glucuronic acid from Bacillus stearothermophilus T-6 (44).


Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 2. Genetic organization of the BstZ1II (A) and Csp231I (B) R-M systems. The DNA fragments that carry a specific MTase gene were isolated from the genomic libraries of Bacillus stearothermophilus 14P (A) and Citrobacter sp. strain RFL231 (B). The genes of the R-M systems BstZ1II (A) and Csp231I (B) are marked. Details concerning the reconstruction of the BstZ1II and Csp231I R-M systems are provided in the text.

 
In order to obtain the BstZ1II R-M system with a functional restriction ENase, the DNA fragment upstream of ORF1 (the putative bstZ1IIR gene) was amplified by the two PCR methods that target regions flanking a known DNA sequence. First, vectorette PCR was applied and yielded a 0.34-kb PCR product from the SspI vectorette library in which the beginning of ORF1 and its putative promoter region were discovered. In the next step, I-PCR was performed, and more of the flanking sequence of ORF1 was identified. The total 0.35 kb located upstream of the EcoRI site was analyzed, and an additional 33 codons were found (Fig. 2A). We were able to detect the activity of the BstZ1II ENase in extracts derived from bacteria which carry plasmid pBstZ1II (BstZ1II R+ M+) with a reconstructed BstZ1II R-M system (data not shown). In the ORF assigned to the bstZ1IIR gene (ORF1), the putative translation initiation codon ATG is located at nt 252 and a termination codon at nt 1208. In addition, a strong ribosome-binding sequence, AAGGAG, is present 7 bp upstream of the proposed ATG codon. Thus, ORF1 (nt 252 to 1208) includes 957 bp and codes for the 318-aa BstZ1II ENase with a molecular weight of 37,650. The BLAST search did not reveal any other neighboring ORFs whose products might have been involved in BstZ1II R-M system regulation. The overall G+C content of the BstZ1II R-M system is 30.2% (29.9% for bstZ1IIR and 30.4% for bstZ1IIM), which is significantly lower than the average G+C content of B. stearothermophilus genomic DNA (50.9%).

Sequence analysis of the Csp231I R-M system.
Analysis of the 3.1-kb EcoRI DNA fragment from pG3 (Csp231I R M+) revealed the presence of two large ORFs divergently oriented (Fig. 2B). However, ORF1 was interrupted at its 5' end (the EcoRI site), and this, as in the case of the BstZ1II R-M system, corresponds to the restriction ENase gene. ORF2 (nt 2506 to 1601) codes for the 301-aa Csp231I MTase (Mr, 34,140). The ribosome-binding sequence, AGGA, is present 10 bp upstream of the translational start codon. Upstream of the csp231IM gene, we have found an incomplete ORF consisting of 177 bp with a predicted amino acid sequence that is 51% identical to OrfB, a RadC ortholog of Bacillus, neighboring the MTase gene of the BslI R-M system (14). The E. coli radC gene specifies a RecG-like DNA recombination/repair function associated with the replication fork.

To obtain the complete nucleotide sequence of the csp231IR gene, the same PCR methods as those described for the reconstruction of the BstZ1II R-M system were used. However, despite repeated efforts, these approaches failed, so we employed DNA sequencing using genomic DNA from Citrobacter sp. strain RFL231 as a template. In each of two attempts, a reverse primer was designed for the clearest part of the sequencing traces, and then sequencing of PCR products was performed. The total flanking sequence of ORF1 (0.6 kb) was identified (Fig. 2B). ORF1 (csp231IR) is 942 bp long (nt 507 to 1448) and codes for a polypeptide of 313 aa (Mr, 36,680). A putative ribosome-binding site was found upstream of this gene (AAGGA, 6 bp upstream of the ATG codon). In addition, R.Csp231I activity was detected in bacterial extracts of cells harboring pCsp231I carrying the reconstructed Csp231I R-M system (data not shown).

Computational analysis of the DNA fragment carrying the Csp231I R-M system revealed a third ORF (nt 141 to 437) (Fig. 2B) located 510 bp upstream of csp231IR and coding for a protein of 98 aa (Mr, 11,360) that shows similarity to C proteins that are involved in the regulation of some R-M systems' gene expression.

The overall G+C content of the genes coding for the Csp231I R-M system is 34.2% (31.3% for csp231IR, 36.3% for csp231IM, and 36.7% for csp231IC), which is significantly lower than the average G+C content of Citrobacter genomic DNA (50.5%).

Analysis of the amino acid sequences.
The presence and distribution of nine conserved amino acid motifs and a target recognition domain in the enzyme structure suggest that M.Csp231I and M.BstZ1II belong to m6N-adenine ß-class MTases (Fig. 3A). These motifs can be grouped in three clusters which are responsible for three principal functions: (i) sequence-specific DNA recognition (target recognition domain [TRD]), (ii) binding of methyl group donor S-adenosylmethionine (motifs X, I, II, and III), and (iii) catalysis of methyl group transfer (motifs IV, V, VI, VII, and VIII) (9, 11, 23, 54). The overall level of positional identity between analyzed isospecific MTases is between 42 and 62%, with the least similar pair being M.BstZ1I and M.LlaCI and the most similar pair being M.EcoVIII and M.LlaCI. It is striking that M.BstZ1I contains an additional 68-aa fragment located between motif VIII and TRD that is absent in other isospecific MTases (Fig. 3A). A BLASTP search revealed no homology of this 68-aa region with any protein in the GenBank database. We hypothesize that this 68-aa fragment of the M.BstZ1II might function as an extended TRD that determines the additional sequence-specific methylation as previously shown for other multispecific MTases isolated from Bacillus and its phages (42, 48, 50, 53).


Figure 3
View larger version (45K):
[in this window]
[in a new window]

 
FIG. 3. Comparison of amino acid sequences of HindIII-isospecific R-M enzymes: (A) MTases, (B) ENases, and (C) putative regulatory C proteins of Csp231I and EcoO109I R-M systems. The numbers on the right margin denote the amino acid positions relative to the N terminus. The conserved motifs of m6N-adenine MTases are boxed and denoted by Roman numerals. The position of the putative TRD is indicated. The region of pronounced similarity between all isospecific ENases is boxed. The amino acids of the putative catalytic/magnesium binding motif PD/EXnDXK and putative DNA binding motif RXXR are indicated. Sequences were aligned using the CLUSTAL W computer program. Asterisks indicate identical amino acids; colons and periods indicate very similar amino acids and somewhat similar amino acids, respectively; dashes indicate gaps in the aligned sequences. The accession numbers for the nucleotide sequences of the HindIII, EcoVIII, LlaCI, BstZ1II, Csp231, BbrRORF307, and EsaSS1092P R-M genes that have been deposited in the GenBank database are L15391, AF158026, AJ002064, AY789018, AY787793, BX640437, and AACY01401088, respectively.

 
The alignment of the predicted amino acid sequence of ENases isospecific to HindIII (Fig. 3B) showed low positional identity, limited to the putative catalytic/Mg(II) binding sequence motif (PD/EXnDXK) that is characteristic for restriction ENases and is usually located in the N-terminal portion of each enzyme (34). When the sequences were compared in pairs, the highest level of positional identity showed that enzymes R.BstZ1II and R.LlaCI (with 41% identity) originated from gram-positive bacteria. Surprisingly, the level of positional identity for isospecific ENases from gram-negative bacteria was much lower (e.g., R.EcoVIII identity to R.Csp231I was 10% and R.HindIII identity to Csp231I was 11%). The differences in G+C content between the BstZ1II and Csp231I R-M systems and in the genomic DNA of their hosts suggest that these genetic entities entered the genomes of B. stearothermophilus and Citrobacter sp. relatively recently, which agrees with the notion that R-M systems behave like mobile genetic elements (17).

In our previous report, we proposed a catalytic motif (D94X14DXK111) for R.HindIII based on some structural and functional constraints (25). Thus, the suggested putative catalytic motifs for R.BstZ1II and R.Csp231I are D100X12DXK115 and D149X12DXK164, respectively (Fig. 3B), and these motifs are located in a 20-aa region of substantial positional identity that is present in all HindIII isoschizomers (Fig. 3B).

Moreover, a database search produced other putative HindIII-isospecific ENases: BbrRORF307P from Bordetella bronchiseptica RB50 (Wellcome Trust Sanger Institute, United Kingdom; www.sanger.ac.uk) and BbrRORF307P isogens from Bordetella pertussis Tahoma I and Bordetella parapertussis 12822 (31). Further searching produced another R.HindIII-like ORF corresponding to the putative, although not complete, isospecific ENase EsaSS1092P derived from an unknown organism isolated from the Sargasso Sea based on a whole-genome shotgun sequencing project (GenBank accession number AACY01401088) (51). Amino acid sequences of these enzymes show pronounced identity with respect to the 20-aa region containing the catalytic/Mg(II) binding sequence motif (Fig. 3B).

The deduced amino acid sequence of Csp231I R-M ORF3 (Fig. 2B) showed significant identity to the members of the helix-turn-helix families of DNA-binding proteins. These also include C regulatory proteins of several R-M systems, such as PvuII (46), BamHI (8), HgiAI (19), BglII (3), BstLVI (50), Kpn2I (20), SmaI (12), BclI (41), and EcoRV (43). Therefore, ORF3 was designated csp231IC, which might produce a putative control protein, C.Csp231I, for the Csp231I R-M genes. However, we were unable to find a conserved nucleotide sequence that resembles the "C box" motif, which is characteristic of some C gene promoters in the upstream region (5, 36, 52). The deduced amino acid sequence of the putative product of the csp231IC gene shows 57.1% (56/98 aa) identity and 85.7% (84/98 aa) similarity to the C protein of the EcoO109I R-M system from E. coli H709c (Fig. 3C) (16). Furthermore, the specific binding sequence of C.EcoO109I [CTAAG(N)5CTTAG] has been identified 70 nt upstream of the initiation codon, ATG, for csp231IC.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The method presented in this report comprises a new approach for the cloning of genes constituting type II R-M systems. Our approach, much like the "Hungarian trick" developed in Pál Venetianer's laboratory in Szeged, Hungary (45), is based on the assumption that DNA from clones carrying a gene for a specific MTase is modified and becomes resistant to digestion by a cognate restriction ENase, which recognizes the same specific sequence. The key difference between these two methods is the procedure used for the selection of clones that produce the specific MTase. In the "Hungarian trick," selection involves in vitro digestion of the plasmid library containing cloned genomic DNA followed by its transformation into E. coli in order to recover the intact plasmids (45). If an excess of ENase was used, then the background of false-positive clones (with no MTase gene) should be minimal. In principal, however, it is typical that several cycles of digestion and transformation are needed to accomplish successful cloning. More than a hundred R-M systems have been cloned using this approach (21, 38, 55). In our procedure, to enhance the efficiency of the cloning of the R-M genes, the selection is made in vivo with the use of a lethal plasmid, pKILLER, which contains a functional ENase gene along with an inactive gene (deletion derivative) coding for the cognate MTase. The application of the pKILLER plasmid enables the efficient selection of clones carrying a gene for a specific MTase from extensive genomic libraries with a low background of nonproductive recombinants. However, the use of this method is limited to cloning only isospecific R-M systems, not systems of unknown specificity. A related, but more difficult, in vivo selection approach has been demonstrated in the cloning of the ppu21IM gene (49). That method uses a temperature-sensitive mutant of the MTase gene in an otherwise intact R-M system.

We developed our approach in order to clone R-M systems isospecific to HindIII. However, this idea could be also applied to the construction of any killer plasmid with an appropriate ENase gene. Another advantage of our method is that there is no need for the presence of a specific ENase site on the plasmid vector, as the chromosomal DNA is modified and thus becomes resistant to the action of the ENase supplied by the killer plasmid. In our opinion, the procedure is quite easy to perform, has a low background of nonproductive recombinants, and is less time-consuming than other cloning methods.

The effectiveness of this approach has been demonstrated by the successful cloning of Csp231I and BstZ1II MTase genes from the genomic libraries of Citrobacter sp. strain RFL231 and Bacillus stearothermophilus 14P, respectively. The detailed genetic and biochemical analyses of both newly cloned R-M systems are in progress.


    ACKNOWLEDGMENTS
 
This paper is dedicated in memoriam to Anna J. Podhajska.

We thank Elisabeth Raleigh and Richard J. Roberts (New England Biolabs), Arvydas Janulaitis (Fermentas, Lithuania), and Slawek Sektas (Department of Microbiology, University of Gdansk, Poland) for bacterial strains and plasmids and Robert Blumenthal and Robert Lintner (University of Toledo) for a critical reading of the manuscript.

This work was supported by grant 2P04B-013-30 from the Ministry of Science and Higher Education (Warsaw, Poland).


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, University of Gdansk, Kladki 24, 80-822 Gdansk, Poland. Phone: (48-58) 305-6242. Fax: (48-58) 320-2031. E-mail: kaczorow{at}biotech.univ.gda.pl Back

{triangledown} Published ahead of print on 27 April 2007. Back


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Allen, M. J., A. Collick, and A. J. Jeffreys. 1994. Use of vectorette and subvectorette PCR to isolate transgene flanking DNA. PCR Methods Appl. 4:71-75.[Medline]
  2. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  3. Anton, B. P., D. F. Heiter, J. S. Benner, E. J. Hess, L. Greenough, L. S. Moran, B. E. Slatko, and J. E. Brooks. 1997. Cloning and characterization of the Bg/II restriction-modification system reveals a possible evolutionary footprint. Gene 187:19-27.[CrossRef][Medline]
  4. Arnold, C., and I. J. Hodgson. 1991. Vectorette PCR: a novel approach to genomic walking. PCR Methods Appl. 1:39-42.[Medline]
  5. Bart, A., J. Dankert, and A. van der Ende. 1999. Operator sequences for the regulatory proteins of restriction modification systems. Mol. Microbiol. 31:1277-1278.[CrossRef][Medline]
  6. Bolivar, F., R. L. Rodriguez, P. J. Greene, M. C. Betlach, H. L. Heyneker, and H. W. Boyer. 1977. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2:95-113.[Medline]
  7. Brooks, J. E., J. S. Benner, D. F. Heiter, K. R. Silber, L. A. Sznyter, T. Jager-Quinton, L. S. Moran, B. E. Slatko, G. G. Wilson, and D. O. Nwankwo. 1989. Cloning the BamHI restriction modification system. Nucleic Acids Res. 17:979-997.[Abstract/Free Full Text]
  8. Brooks, J. E., P. D. Nathan, D. Landry, L. A. Sznyter, P. Waite-Rees, C. L. Ives, L. S. Moran, B. E. Slatko, and J. S. Benner. 1991. Characterization of the cloned BamHI restriction modification system: its nucleotide sequence, properties of the methylase, and expression in heterologous hosts. Nucleic Acids Res. 19:841-850.[Abstract/Free Full Text]
  9. Bujnicki, J. M. 2001. Understanding the evolution of restriction-modification systems: clues from sequence and structure comparisons. Acta Biochim. Pol. 48:935-967.[Medline]
  10. Fomenkov, A., J. P. Xiao, D. Dila, E. Raleigh, and S. Y. Xu. 1994. The ‘endo-blue method’ for direct cloning of restriction endonuclease genes in E. coli. Nucleic Acids Res. 22:2399-2403.[Abstract/Free Full Text]
  11. Gong, W., M. O'Gara, R. M. Blumenthal, and X. Cheng. 1997. Structure of pvu II DNA-(cytosine N4) methyltransferase, an example of domain permutation and protein fold assignment. Nucleic Acids Res. 25:2702-2715.[Abstract/Free Full Text]
  12. Heidmann, S., W. Seifert, C. Kessler, and H. Domdey. 1989. Cloning, characterization and heterologous expression of the SmaI restriction-modification system. Nucleic Acids Res. 17:9783-9796.[Abstract/Free Full Text]
  13. Howard, K. A., C. Card, J. S. Benner, H. L. Callahan, R. Maunus, K. Silber, G. Wilson, and J. E. Brooks. 1986. Cloning the DdeI restriction-modification system using a two-step method. Nucleic Acids Res. 14:7939-7951.[Abstract/Free Full Text]
  14. Hsieh, P.-C., J.-P. Xiao, D. O'Loane, and S.-Y. Xu. 2000. Cloning, expression, and purification of a thermostable nonhomodimeric restriction enzyme, BslI. J. Bacteriol. 182:949-955.[Abstract/Free Full Text]
  15. Kaczorowski, T., and W. Szybalski. 1998. Genomic DNA sequencing by SPEL-6 primer walking using hexamer ligation. Gene 223:83-91.[CrossRef][Medline]
  16. Kita, K., J. Tsuda, and S. Y. Nakai. 2002. C.EcoO109I, a regulatory protein for production of EcoO109I restriction endonuclease, specifically binds to and bends DNA upstream of its translational start site. Nucleic Acids Res. 30:3558-3565.[Abstract/Free Full Text]
  17. Kobayashi, I. 2001. Behavior of restriction-modification systems as selfish mobile elements and their impact on genome evolution. Nucleic Acids Res. 29:3742-3756.[Abstract/Free Full Text]
  18. Kohda, T., and K. Taira. 2000. A simple and efficient method to determine the terminal sequences of restriction fragments containing known sequences. DNA Res. 7:151-155.[Abstract/Free Full Text]
  19. Kröger, M., E. Blum, E. Deppe, A. Dusterhoft, D. Erdmann, S. Kilz, S. Meyer-Rogge, and D. Mostl. 1995. Organization and gene expression within restriction-modification systems of Herpetosiphon giganteus. Gene 157:43-47.[CrossRef][Medline]
  20. Lubys, A., S. Jurenaite, and A. Janulaitis. 1999. Structural organization and regulation of the plasmid-borne type II restriction-modification system Kpn2I from Klebsiella pneumoniae RFL2. Nucleic Acids Res. 27:4228-4234.[Abstract/Free Full Text]
  21. Lunnen, K. D., J. M. Barsomian, R. R. Camp, C. O. Card, S. Z. Chen, R. Croft, M. C. Looney, M. M. Meda, L. S. Moran, D. O. Nwankwo, et al. 1988. Cloning type-II restriction and modification genes. Gene 74:25-32.[CrossRef][Medline]
  22. Madsen, A., and J. Josephsen. 1998. Characterization of LlaCI, a new restriction-modification system from Lactococcus lactis subsp. cremoris W15. Biol. Chem. 379:443-449.[Medline]
  23. Malone, T., R. M. Blumenthal, and X. Cheng. 1995. Structure-guided analysis reveals nine sequence motifs conserved among DNA amino-methyltransferases, and suggests a catalytic mechanism for these enzymes. J. Mol. Biol. 253:618-632.[CrossRef][Medline]
  24. Margolis, P. S., A. Driks, and R. Losick. 1993. Sporulation gene spoIIB from Bacillus subtilis. J. Bacteriol. 175:528-540.[Abstract/Free Full Text]
  25. Mruk, I., and T. Kaczorowski. 2003. Genetic organization and molecular analysis of the EcoVIII restriction-modification system of Escherichia coli E1585-68 and its comparison with isospecific homologs. Appl. Environ. Microbiol. 69:2638-2650.[Abstract/Free Full Text]
  26. Mruk, I., M. Sektas, and T. Kaczorowski. 2001. Characterization of pEC156, a ColE1-type plasmid from Escherichia coli E1585-68 that carries genes of the EcoVIII restriction-modification system. Plasmid 46:128-139.[CrossRef][Medline]
  27. Noren, C. J., R. J. Roberts, J. Patti, D. R. Byrd, and R. D. Morgan. March 1999. Method for screening restriction endonucleases. U.S. patent WO9911821.
  28. Nwankwo, D. O., L. S. Moran, B. E. Slatko, P. A. Waite-Rees, L. F. Dorner, J. S. Benner, and G. G. Wilson. 1994. Cloning, analysis and expression of the HindIII R-M-encoding genes. Gene 150:75-80.[CrossRef][Medline]
  29. Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-623.[Abstract/Free Full Text]
  30. Old, R., K. Murray, and G. Boizes. 1975. Recognition sequence of restriction endonuclease III from Hemophilus influenzae. J. Mol. Biol. 92:331-339.[CrossRef][Medline]
  31. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M. T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga, L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D. Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis, J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S. Leather, S. Moule, H. Norberczak, S. O'Neil, D. Ormond, C. Price, E. Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M. Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead, B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat. Genet. 35:32-40.[CrossRef][Medline]
  32. Piekarowicz, A., R. Yuan, and D. C. Stein. 1991. A new method for the rapid identification of genes encoding restriction and modification enzymes. Nucleic Acids Res. 19:1831-1835.[Abstract/Free Full Text]
  33. Pingoud, A., and A. Jeltsch. 1997. Recognition and cleavage of DNA by type-II restriction endonucleases. Eur. J. Biochem. 246:1-22.[Medline]
  34. Pingoud, A., and A. Jeltsch. 2001. Structure and function of type II restriction endonucleases. Nucleic Acids Res. 29:3705-3727.[Abstract/Free Full Text]
  35. Reece, K. S., and G. J. Phillips. 1995. New plasmids carrying antibiotic-resistance cassettes. Gene 165:141-142.[CrossRef][Medline]
  36. Rimseliene, R., R. Vaisvila, and A. Janulaitis. 1995. The eco72IC gene specifies a trans-acting factor which influences expression of both DNA methyltransferase and endonuclease from the Eco72I restriction-modification system. Gene 157:217-219.[CrossRef][Medline]
  37. Roberts, R. J. 2005. How restriction enzymes became the workhorses of molecular biology. Proc. Natl. Acad. Sci. USA 102:5905-5908.[Abstract/Free Full Text]
  38. Roberts, R. J., T. Vincze, J. Posfai, and D. Macelis. 2007. REBASE—enzymes and genes for DNA restriction and modification. Nucleic Acids Res. 35:D269-D270.[CrossRef][Medline]
  39. Roy, P. H., and H. O. Smith. 1973. DNA methylases of Hemophilus influenzae Rd. I. Purification and properties. J. Mol. Biol. 81:427-444.[CrossRef][Medline]
  40. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  41. Sawaya, M. R., Z. Zhu, F. Mersha, S. H. Chan, R. Dabur, S. Y. Xu, and G. K. Balendiran. 2005. Crystal structure of the restriction-modification system control element C.Bcll and mapping of its binding site. Structure 13:1837-1847.[Medline]
  42. Schumann, J., J. Walter, J. Willert, C. Wild, D. Koch, and T. A. Trautner. 1996. M.BssHII, a multispecific cytosine-C5-DNA-methyltransferase with unusual target recognizing properties. J. Mol. Biol. 257:949-959.[CrossRef][Medline]
  43. Semenova, E., L. Minakhin, E. Bogdanova, M. Nagornykh, A. Vasilov, T. Heyduk, A. Solonin, M. Zakharova, and K. Severinov. 2005. Transcription regulation of the EcoRV restriction-modification system. Nucleic Acids Res. 33:6942-6951.[Abstract/Free Full Text]
  44. Shulami, S., O. Gat, A. L. Sonenshein, and Y. Shoham. 1999. The glucuronic acid utilization gene cluster from Bacillus stearothermophilus T-6. J. Bacteriol. 181:3695-3704.[Abstract/Free Full Text]
  45. Szomolányi, E., A. Kiss, and P. Venetianer. 1980. Cloning the modification methylase gene of Bacillus sphaericus R in Escherichia coli. Gene 10:219-225.[CrossRef][Medline]
  46. Tao, T., J. C. Bourne, and R. M. Blumenthal. 1991. A family of regulatory genes associated with type II restriction-modification systems. J. Bacteriol. 173:1367-1375.[Abstract/Free Full Text]
  47. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
  48. Trautner, T. A., T. Balganesh, K. Wilke, M. Noyer-Weidner, E. Rauhut, R. Lauster, B. Behrens, and B. Pawlek. 1988. Organization of target-recognizing domains in the multispecific DNA (cytosine-5)methyltransferases of Bacillus subtilis phages SPR and phi 3T. Gene 74:267.[CrossRef][Medline]
  49. Vaisvila, R., Z. Sliesaraviciute, S. Kulakauskas, and A. Janulaitis. 1995. Cloning of the ppu21IM gene using a in vivo selection method. Gene 157:55-57.[CrossRef][Medline]
  50. Vásquez, C. C., C. P. Saavedra, and S. E. Pichuantes. 2000. Nucleotide sequence of the gene encoding the BstLVI DNA methyltransferase: comparison with other amino-DNA methyltransferases. Curr. Microbiol. 40:114-118.[CrossRef][Medline]
  51. Venter, J. C., K. Remington, J. F. Heidelberg, A. L. Halpern, D. Rusch, J. A. Eisen, D. Wu, I. Paulsen, K. E. Nelson, W. Nelson, D. E. Fouts, S. Levy, A. H. Knap, M. W. Lomas, K. Nealson, O. White, J. Peterson, J. Hoffman, R. Parsons, H. Baden-Tillson, C. Pfannkoch, Y. H. Rogers, and H. O. Smith. 2004. Environmental genome shotgun sequencing of the Sargasso Sea. Science 304:66-74.[Abstract/Free Full Text]
  52. Vijesurier, R. M., L. Carlock, R. M. Blumenthal, and J. C. Dunbar. 2000. Role and mechanism of action of C · PvuII, a regulatory protein conserved among restriction-modification systems. J. Bacteriol. 182:477-487.[Abstract/Free Full Text]
  53. Wilke, K., E. Rauhut, M. Noyer-Weidner, R. Lauster, B. Pawlek, B. Behrens, and T. A. Trautner. 1988. Sequential order of target-recognizing domains in multispecific DNA-methyltransferases. EMBO J. 7:2601-2609.[Medline]
  54. Wilson, G. G. 1992. Amino acid sequence arrangements of DNA-methyltransferases. Methods Enzymol. 216:259-279.[Medline]
  55. Wilson, G. G. 1991. Organization of restriction-modification systems. Nucleic Acids Res. 19:2539-2566.[Abstract/Free Full Text]


Applied and Environmental Microbiology, July 2007, p. 4286-4293, Vol. 73, No. 13
0099-2240/07/$08.00+0     doi:10.1128/AEM.00119-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AEM.00119-07v1
73/13/4286    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mruk, I.
Right arrow Articles by Kaczorowski, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mruk, I.
Right arrow Articles by Kaczorowski, T.
Agricola
Right arrow Articles by Mruk, I.
Right arrow Articles by Kaczorowski, T.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Microbiol. Mol. Biol. Rev. Eukaryot. Cell All ASM Journals