This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paluszynski, J. P.
Right arrow Articles by Meinhardt, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paluszynski, J. P.
Right arrow Articles by Meinhardt, F.
Agricola
Right arrow Articles by Paluszynski, J. P.
Right arrow Articles by Meinhardt, F.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, July 2007, p. 4373-4378, Vol. 73, No. 13
0099-2240/07/$08.00+0     doi:10.1128/AEM.00271-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Pichia acaciae Killer System: Genetic Analysis of Toxin Immunity{triangledown}

John P. Paluszynski, Roland Klassen, and Friedhelm Meinhardt*

Institut für Molekulare Mikrobiologie und Biotechnologie, Westfälische Wilhelms-Universität Münster, Corrensstr. 3, D-48149 Münster, Germany

Received 2 February 2007/ Accepted 28 April 2007


arrow
ABSTRACT
 
The gene responsible for self-protection in the Pichia acaciae killer plasmid system was identified by heterologous expression in Saccharomyces cerevisiae. Resistance profiling and conditional toxin/immunity coexpression analysis revealed dose-independent protection by pPac1-2 ORF4 and intracellular interference with toxin function, suggesting toxin reinternalization in immune killer cells.


arrow
INTRODUCTION
 
Killer toxin production is a frequently realized intra- and interspecies strategy among yeasts to restrict the growth of competitors. While target cell killing is the common purpose, the structures of toxins, their mechanisms of action, and the organizations of encoding genes are rather diverse (25, 32). The Kluyveromyces lactis and Pichia acaciae toxin systems depend on double-stranded DNA elements (8, 16, 40). The two species each harbor a pair of extranuclear linear plasmids, i.e., pGKL1 (8.9 kb) and pGKL2 (13.5 kb) (K. lactis) and pPac1-1 (13.6 kb) and pPac1-2 (6.8 kb) (P. acaciae) (1, 8, 37). The larger plasmids are autonomous elements displaying almost identical gene contents that include loci essential for cytoplasmic replication, transcription, and transcript modification (14, 15). In contrast, the smaller plasmids carry structurally distinct toxin genes (32); these elements are nonautonomous and rely on the respective larger autonomous plasmid for extranuclear replication and transcription (29).

The K. lactis toxin, termed zymocin, consists of three subunits encoded by the pGKL1-borne ORF2 (the {alpha} and ß subunits) and ORF4 (the {gamma} subunit) (36). Docking to the primary cell wall receptor chitin is facilitated by the {alpha} subunit (12), and the remarkably hydrophobic ß subunit presumably assists in the uptake of the {gamma} subunit, which is a tRNase (24, 27, 37).

Like the K. lactis toxin zymocin, the P. acaciae toxin (PaT) comprises a heteromeric complex (26). The polypeptide encoded by pPac1-2 ORF1, possessing both chitin-binding and hydrophobic domains, is akin to the K. lactis counterparts; however, the intracellularly acting toxic subunit (encoded by pPac1-2 ORF2) is obviously unrelated to the K. lactis {gamma} subunit (22).

Zymocin action depends on the protein complex Elongator (4). Recently published data indicate that Elongator is instrumental in tRNA modification, i.e., in placing 5-methoxycarbonylmethyl (mcm5) and 5-carbamoylmethyl (ncm5) moieties on uridines at the wobble position (11, 24). Loss of Elongator-dependent wobble nucleoside modifications in tRNAGlu, tRNALys, and tRNAGln prevents recognition and cleavage by the zymocin {gamma} subunit and confers exotoxin resistance (13, 24).

For PaT function, in contrast, Elongator is not required, indicating the functional diversity of the toxins. Moreover, terminal toxin responses to PaT and zymocin differ: while the latter toxin arrests target cells in G1, PaT has been shown to induce S-phase arrest and DNA damage checkpoint induction followed by apoptotic cell death (20, 21). It has been shown that self-protection from zymocin is mediated by pGKL1 ORF3; however, in the pPac killer system, no homologous gene is present and no other immunity factor has been identified. Here we show that PaT immunity is mediated by pPac1-2 ORF4 and provide evidence for the intracellular function of the predicted polypeptide.


arrow
Strains, plasmids, and genetic manipulations.
 
The strains and plasmids used in this study are listed in Table 1. For the growth conditions and medium supplementation used, see references 17 and 30. Standard cloning and molecular techniques were performed as described previously (31). Yeast linear plasmids were isolated as described previously (31). For Southern analyses (35), DNA fragments were labeled by using the digoxigenin DNA labeling and detection kit from Roche Biochemicals GmbH (Mannheim, Germany). The preparation of killer toxins and toxin-sensitive assays were carried out as described previously (22). The transformants of Saccharomyces cerevisiae were obtained according to reference 5 and selected on yeast nitrogen base agar medium (Difco, Detroit, MI).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Genotypes of strains and plasmids used


arrow
Gene disruptions and the heterologous expression of toxin and immunity genes.
 
P. acaciae pPac1-2 ORF4 was amplified via PCR using primers PO4F (5'GACCTTAGTGATGTATCAAAATTGAATGG 3') and PO4R (5'CCCCAACAGAGGGCAATCAAG 3'), including the upstream conserved sequence (UCS), and ligated with EcoRV-linearized pSK–. P. acaciae pPac1-2 ORF4 was subcloned with BamHI and HindIII and ligated into similarly cut pAR3 (33), resulting in pAR3pPac1-2 ORF4. For transformation, the in vivo recombination cassettes from pAR3 and pAR3pPac1-2 ORF4 were cut out using SacI and PstI or NheI and PstI, respectively. Transformants were subcultivated for 150 generations in yeast nitrogen base agar medium, and hybrid plasmids were detected by gel electrophoresis and Southern analysis. For the coexpression of pPac1-2 ORF2 and pPac1-2 ORF4, the latter gene, lacking its UCS and signal peptide-encoding region, was spliced out of vector pPACBX (22) using the BamHI and SalI restriction sites and fused with the methionine-repressible MET25 promoter of the low-copy-number vector pHal1 (CEN/URA3) (4). The ORF2-promoter fusion cassette was subcloned into a high-copy-number vector, YEplac195 (2µm ori/URA3) (6), utilizing KpnI and SacI restriction sites. Spot tests were performed as described in reference 30.


arrow
Zymocin immunity cannot protect against PaT.
 
In search of the genetic basis for immunity against PaT, we first verified the association of the toxin-encoding plasmid system with the immunity phenotype. For this purpose, toxin susceptibility was assayed for both the killer-plasmid-carrying strain NRRL Y-18665 and the plasmid-free derivative PARK0 (22). As depicted in Fig. 1b, the former strain proved to be resistant at all concentrations applied, whereas growth of the latter was negatively affected. Thus, in agreement with a previous report (40), the immunity function is indeed plasmid encoded.


Figure 1
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 1. (a) Toxin-encoding linear plasmid pPac1-2 of P. acaciae NRRL Y-18665. All ORFs (ORF1 to ORF4) are represented by shaded arrows and are labeled with their numbers and functions. Black triangles, terminal inverted repeats; black circles, terminal proteins. (b) PaT susceptibility tests using a P. acaciae plasmid-free strain (PARK0), a plasmid-carrying wild-type P. acaciae strain (NRRL Y-18665), a K. lactis {Delta}pGKL1 mutant (NK40), and a plasmid-carrying wild-type K. lactis strain (AWJ137). (c) Application of K. lactis toxin (zymocin) to the same strains as described for panel b. PaT and zymocin were applied in exponentially increasing doses, and relative growth levels were determined as described in Materials and Methods. Values given represent the means of results of at least three experiments, each carried out in triplicate.

Next, we analyzed cross-protection between P. acaciae and K. lactis killer systems. In the latter, ORF3 of the nonautonomous pGKL1 plasmid is responsible for protection against the zymocin toxin (39). Plasmid-carrying wild-type strains of P. acaciae and K. lactis, along with their cured strains, were treated with both PaT and zymocin, revealing the zymocin resistance of P. acaciae independent of its plasmid content. In contrast, K. lactis displays plasmid-specific immunity to zymocin, whereas plasmid-carrying and plasmid-free strains are equally sensitive to PaT (Fig. 1b and c). Thus, the zymocin immunity function fails to protect against PaT. Since zymocin and PaT represent functionally distinct toxins (38), a specific adaptation of immunity factors to different toxin targets is obvious. However, it cannot be judged whether the plasmid-encoded PaT immunity function is similarly selective for PaT, since P. acaciae displays intrinsic nonsusceptibility to zymocin, as plasmid-free strains of this species are outside of the sensitivity spectrum for zymocin. This may be due to the absence of adequately modified target tRNAs in P. acaciae or, alternatively, to nonfunctional toxin import. Despite several lines of evidence for very similar uptake mechanisms in PaT and zymocin (12), there is at least one uptake-related factor (Kti6) which is required for zymocin action when the toxin is extracellular (41) but which is dispensable for PaT (26).

The entire nucleotide sequence of the autonomous plasmid pPac1-1 was recently established (14) and consists of no possible candidate gene for PaT immunity, since all genes located on this plasmid are highly conserved among other autonomous plasmids, including pGKL2 (8) and pPE1B (15), which fail to protect against PaT (Fig. 1 and data not shown). Thus, similarly to the pGKL system, PaT immunity is likely to be encoded by the nonautonomous element (pPac1-2).

Three out of the four open reading frames (ORFs) of pPac1-2 (ORF1, ORF2, and ORF3) encode secreted proteins as they carry a signal peptide and probably represent toxin subunits (Fig. 1a) (22); only Orf4p lacks a signal peptide and appeared to be the prime candidate for mediating immunity against PaT.


arrow
pPac1-2 ORF4 confers PaT resistance.
 
For checking the role of pPac1-2 ORF4 in immunity, we employed an in vivo recombination system allowing the heterologous cytoplasmic expression of genes based on the pGKL plasmids, which were established in a genetically defined Saccharomyces cerevisiae background by protoplast fusion (9, 34). The K. lactis strain carrying the pGKL system is fully sensitive to PaT (data not shown). The pPac1-2 ORF4 locus was inserted along with its cytoplasmic promoter (UCS) into pGKL1 ORF2 by making use of the cytoplasmically expressible LEU2* gene located on the in vivo recombination vector pAR3, as outlined in Fig. 2a and b. As a control, the cytoplasmically expressible LEU2* gene was inserted into the same locus without pPac1-2 ORF4. Recombination eventually resulted in strains MS1606 and MS1607, carrying the desired hybrid plasmids K1pAR3 (orf2::LEU2*) and K1pAR3pPac1-2 ORF4 (orf2::LEU2*::pPac1-2 ORF4), respectively (Fig. 2c). The presence of hybrid plasmids and the curing of native pGKL1 were proven by gel electrophoresis and Southern analyses by using LEU2* and pPac1-2 ORF4 probes (Fig. 2c).


Figure 2
View larger version (30K):
[in this window]
[in a new window]

  		FIG. 2. Heterologous gene expression system using the pGKL1-targeting in vivo recombination vector pAR3 in S. cerevisiae F102-2. (a) Integration of pPac1-2 ORF4 in pGKL1 of S. cerevisiae F102-2 via pAR3, resulting in the 8.3-kb hybrid plasmid K1pAR3 pPac1-2 ORF4 (MS1607). (b) In vivo recombination with the empty control vector pAR3 resulted in the 7-kb hybrid plasmid K1pAR3 (MS1606). All ORFs are represented by shaded arrows. The white arrow represents the selection marker LEU2*, including a UCS allowing for cytoplasmic expression. Other symbols are depicted as described in the legend to Fig. 1. (c) Electrophoretic and Southern analyses of the hybrid plasmids K1pAR3 (7.0 kb) and K1pAR3 pPac1-2 ORF4 (8.3 kb). Fragment sizes of the {lambda} HindIII marker are given in kilobase pairs (kb) to the left of the gel. In the wild-type strain S. cerevisiae F102-2 (S.c. F102-2 wt), the larger plasmid represents pGKL2 (13.5 kb) and the smaller plasmid represents pGKL1 (8.9 kb). The smear at the top represents high-molecular-weight chromosomal DNA (hmw chrom DNA). L-dsRNA, genome of a frequently occurring virus-like particle. (d) pPac1-2 ORF4 in S. cerevisiae F102-2 confers immunity to extracellular PaT. Relative growth levels of MS1606 and MS1607 in media supplemented with Pichia acaciae toxin are depicted.

Both MS1606 and MS1607 were evaluated for their susceptibilities to increasing doses of PaT. Strain MS1607, carrying the LEU2*::pPac1-2 ORF4 insertion at pGKL1 ORF2, displays full immunity to extracellularly applied toxin, whereas the control (MS1606), carrying the LEU2* insertion at the same locus, is fully susceptible (Fig. 2d). Even when PaT was applied in great excess—exceeding the amount of toxin required for the complete inhibition of the control strain up to 1,000-fold—S. cerevisiae MS1607 still proved to be unaffected (Fig. 2d). Thus, pPac1-2 ORF4 protected S. cerevisiae against extracellular disposed PaT in a dose-independent manner.


arrow
pPac1-2 ORF4 acts intracellularly.
 
It has previously been shown that pPac1-2 Orf2p, the actual lethal factor of the P. acaciae killer system, acts intracellularly (22). However, the protective effect of pPac1-2 ORF4 might be brought about by the exclusion of the toxin, e.g., by prohibiting cellular uptake or, alternatively, by functional interference with reinternalized pPac1-2 Orf2p. To examine this possibility, PaT was expressed intracellularly in cells simultaneously expressing pPac1-2 Orf4p. Since a previously developed expression system for pPac1-2 Orf2p based on the inducible GAL10 promoter (3, 39) could not be used due to the lack of growth of S. cerevisiae F102-2 on galactose, a conditional expression system for pPac1-2 ORF2 based on the methionine-repressible promoter of MET25 was constructed.

For this purpose, a ura3 descendant of S. cerevisiae F102-2 was transformed with the pAR3 and pAR3 pPac1-2 ORF4 recombination cassettes, resulting in strains S. cerevisiae F102-2 ura3 K1pAR3 (MS1608) and S. cerevisiae F102-2 ura3 K1pAR3pPac1-2 ORF4 (MS1609), respectively. After both strains were tested with excess amounts of PaT, their phenotypes proved to be the same as those of their parent strains, MS1606 and MS1607 (data not shown).

The PaT-encoding pPac1-2 ORF2 lacking both its UCS and signal peptide was then fused to the MET25 promoter in the low- and high-copy-number vectors pHal1 and YEplac195 (Fig. 3a) (4). Both plasmid systems, along with empty vector controls, were subsequently transformed into S. cerevisiae MS1608 and MS1609, and MET25 promoter-driven pPac1-2 ORF2 expression was conducted by replica spotting 10-fold serial dilutions of expression plasmid-carrying and control strains on inducing (methionine-free) and noninducing (methionine-containing) media. pPac1-2 ORF2 expression in either single or high copy number exerted complete growth inhibition of MS1608 under inducing conditions (Fig. 3b). Interestingly, there is already a clear effect of pPac1-2 ORF2 in the high-copy-number situation under noninducing conditions, probably due to leakiness in the repression of the MET25 promoter (28), resulting in limited Orf2p accumulation under noninducing conditions, which is, however, not observable in the low-copy-number situation. Despite this, concomitant intracellular coexpression of pPac1-2 ORF4 entirely prevented detrimental growth effects of pPac1-2 ORF2 in both single and high copy numbers under inducing conditions (Fig. 3b).


Figure 3
View larger version (45K):
[in this window]
[in a new window]

  		FIG. 3. Expression system utilizing the MET25 repressible promoter allowing for conditional intracellular toxin expression of pPac1-2 ORF2. (a) Genetic organization of high- and low-copy-number vector-based expression systems, YEplac195 and pHal1, respectively. (Diagram 1) Native pPac1-2 ORF2 with its UCS, allowing for cytoplasmic expression, and signal peptide (SP). (Diagram 2) pPac1-2 ORF2 lacking its UCS integrated in the low-copy-number vector pHal1. Depicted are the methionine-repressible promoter (MET25-P), the CYC1 terminator (t), and the centromere-autonomous replicating sequence (CEN-ARS). (Diagram 3) pPac1-2 ORF2 as in diagram 2 integrated in the high-copy-number vector YEplac195. 2µ-ori, 2µm origin of replication. (b) Intracellular toxin assays using strains MS1608 and MS1609, transformed with both high- and low-copy-number vectors containing MET25 promoter-driven pPac1-2 ORF2. (Panel 1) ORF2 represents the nuclear expression of pPac1-2 ORF2 in strain MS1608 under the control of MET25-P in low copy number. ORF4 represents strain MS1609 with pPac1-2 ORF4 expressed from the linear plasmid pGKL1. ORF2 + ORF4 represents strain MS1609 transformed with the low-copy-number expression vector pHal1 containing pPac1-2 ORF2 (MET25-P). (Panel 2) All strains tested are the same as described for panel 1 except that pPac1-2 ORF2 was expressed from the high-copy-number YEplac195 expression vector. MS1608 strains containing the empty low- and high-copy-number expression vectors served as controls. Cell dilutions ranging from 10° to 10–3 were spotted onto yeast nitrogen base agar plates with (+Met) or without (–Met) methionine.

Since the level of toxin resistance could not be determined with either an excess of extracellular PaT or intracellularly applied PaT, the conferred immunity is systemic. Assuming that Orf4p is present in levels greater than those of Orf2p under the tested conditions, this result might indicate the existence of an immunity mechanism that is distinct from the stoichiometric continuous interaction of the toxin and immunity proteins, as known for bacterial DNase toxins of the colicin type (23).

The fact that pPac1-2 Orf4p does not protect only against (exo-) PaT but also against artificial intracellularly expressed pPac1-2 Orf2p provides strong evidence for the occurrence of toxin reinternalization in PaT-immune toxin-producing P. acaciae cells as well. Very recently, immunity to the intracellularly acting K28 toxin from S. cerevisiae was shown to be mediated intracellularly by the conjugation of ubiquitin to a complex of toxin precursor molecules and reinternalized toxin (2). Thus, disarming intracellularly acting toxins at the intracellular stage rather than preventing reinternalization may be a frequently applied strategy for achieving immunity.

Though PaT and zymocin employ identical strategies to gain access to the target cell (12, 22), immunity does appear to be specific for the functionally diverse lethal factors and does not act by interfering with cellular uptake. With the exception of the Pichia inositovora killer plasmids (10, 19), the immunity function appears to be encoded almost always on the nonautonomous element, as seen for the K. lactis (37) and P. acaciae (15) killer systems and probably also for the pPac1-2 homologous killer plasmid pWR1A from Debaryomyces robertsiae, in which a pPac1-2 ORF4 homologue is present (22). Thus, the immunity factor constitutes an autoselection system for the nonautonomous element, which can otherwise be accidentally lost (7, 40).


arrow
ACKNOWLEDGMENTS
 
Thanks are due to R. Schaffrath for providing plasmids.

Financial support by Deutsche Forschungs Gemeinschaft grant ME 1142/5-1 is gratefully acknowledged.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institut für Molekulare Mikrobiologie und Biotechnologie, Westfälische Wilhelms-Universität Münster, Corrensstr. 3, D-48149 Münster, Germany. Phone: 49 2 51 83-3 98 25. Fax: 49 2 51 83-3 83 88. E-mail: meinhar{at}uni-muenster.de Back

{triangledown} Published ahead of print on 4 May 2007. Back


arrow
REFERENCES
 
    1
  1. Bolen, P. L., E. M. Eastman, P. L. Cihak, and G. T. Hayman. 1994. Isolation and sequence analysis of a gene from the linear DNA plasmid pPac1-2 of Pichia acaciae that shows similarity to a killer toxin gene of Kluyveromyces lactis. Yeast 10:403-414.[CrossRef][Medline]
    2. 2
  2. Breinig, F., T. Sendzik, K. Eisfeld, and M. Schmitt. 2006. Dissecting toxin immunity in virus-infected killer yeast uncovers an intrinsic strategy of self-protection. Proc. Natl. Acad. Sci. USA 103:3810-3815.[Abstract/Free Full Text]
    3. 3
  3. Butler, A. R., J. H. White, Y. Folawiyo, A. Edlin, D. Gardiner, and M. J. R. Stark. 1994. Two Saccharomyces cerevisiae genes which control sensitivity to G1 arrest induced by Kluyveromyces lactis toxin. Mol. Cell. Biol. 14:6306-6316.[Abstract/Free Full Text]
    4. 4
  4. Frohloff, F., L. Fichtner, D. Jablonowski, K. D. Breuning, and R. Schaffrath. 2001. Saccharomyces cerevisiae Elongator mutations confer resistance to the Kluyveromyces lactis zymocin. EMBO J. 20:1993-2003.[CrossRef][Medline]
    5. 5
  5. Gietz, R. D., and R. H. Schiestel. 1995. Transforming yeast with DNA. Methods Mol. Cell. Biol. 5:255-269.
    6. 6
  6. Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534.[CrossRef][Medline]
    7. 7
  7. Gunge, N., S. Takahashi, K. Fukuda, T. Ohnishi, and F. Meinhardt. 1994. UV hypersensitivity of yeast linear plasmids. Curr. Genet. 26:369-373.[CrossRef][Medline]
    8. 8
  8. Gunge, N., A. Tamaru, F. Ozawa, and K. Sakaguchi. 1981. Isolation and characterization of linear deoxyribonucleic acid plasmids from Kluyveromyces lactis and the plasmid-associated killer character. J. Bacteriol. 145:382-390.[Abstract/Free Full Text]
    9. 9
  9. Gunge, N., and K. Sakaguchi. 1981. Intergeneric transfer of deoxyribonucleic acid killer plasmids, pGKl1 and pGKl2, from Kluyveromyces lactis into Saccharomyces cerevisiae by cell fusion. J. Bacteriol. 147:155-160.[Abstract/Free Full Text]
    10. 10
  10. Hayman, G. T., and B. L. Bolen. 1991. Linear DNA plasmids of Pichia inositovora are associated with a novel killer toxin activity. Curr. Genet. 19:389-393.[CrossRef][Medline]
    11. 11
  11. Huang, B., M. J. Johansonn, and A. S. Bystrom. 2005. An early step in wobble uridine tRNA modification requires the Elongator complex. RNA 11:424-436.[Abstract/Free Full Text]
    12. 12
  12. Jablonowski, D., L. Fichtner, V. J. Martin, R. Klassen, F. Meinhardt, M. J. R. Stark, and R. Schaffrath. 2001. Saccharomyces cerevisiae cell wall chitin, the Kluyveromyces lactis zymocin receptor. Yeast 18:1285-1299.[CrossRef][Medline]
    13. 13
  13. Jablonowski, D., S. Zink, C. Mehlgarten, G. Daum, and R. Schaffrath. 2006. tRNAGln wobble uridine methylation by Trm9 identifies Elongator's key role for zymocin-induced cell death in yeast. Mol. Microbiol. 59:677-688.[CrossRef][Medline]
    14. 14
  14. Jeske, S., and F. Meinhardt. 2006. Autonomous cytoplasmic linear plasmid pPac1-1 of Pichia acaciae: molecular structure and expression studies. Yeast 23:479-486.[CrossRef][Medline]
    15. 15
  15. Jeske, S., F. Meinhardt, and R. Klassen. Extranuclear inheritance: virus-like DNA-elements in yeast. In K. Esser, U. Lüttge, J. Kadereit, and W. Beyschlag (ed.), Progress in botany, vol. 68, in press. Springer Verlag, Berlin, Germany.
    16. 16
  16. Jeske, S., M. Tiggemann, and F. Meinhardt. 2006. Yeast autonomous linear plasmid pGKL2: ORF9 is an actively transcribed essential gene with multiple transcription start points. FEMS Microbiol. Lett. 7:321-327.
    17. 17
  17. Kaiser, C., S. Michaelis, and A. Mitchell. 1994. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
    18. 18
  18. Kämper, J., K. Esser, N. Gunge, and F. Meinhardt. 1991. Heterologous gene expression on the linear DNA killer plasmid from Kluyveromyces lactis. Curr. Genet. 19:109-118.[CrossRef][Medline]
    19. 19
  19. Klassen, R., and F. Meinhardt. 2003. Structural and functional analysis of the killer element pPin1-3 from Pichia inositovora. Mol. Genet. Genomics 270:190-199.[CrossRef][Medline]
    20. 20
  20. Klassen, R., and F. Meinhardt. 2005. Induction of DNA damage and apoptosis in Saccharomyces cerevisiae by a yeast killer toxin. Cell. Microbiol. 7:393-401.[CrossRef][Medline]
    21. 21
  21. Klassen, R., D. Jablonowski, M. J. R. Stark, R. Schaffrath, and F. Meinhardt. 2006. Mating-type locus control of killer toxins from Kluyveromyces lactis and Pichia acaciae. FEMS Yeast Res. 3:404-413.
    22. 22
  22. Klassen, R., S. Teichert, and F. Meinhardt. 2004. Novel yeast killer toxins provoke S-phase arrest and DNA damage checkpoint activation. Mol. Microbiol. 53:263-273.[CrossRef][Medline]
    23. 23
  23. Kleanthous, C., A. M. Hemmings, G. R. Moore, and R. James. 1998. Immunity proteins and their specificity for endonuclease colicins: telling right from wrong in protein-protein recognition. Mol. Microbiol. 28:227-233.[CrossRef][Medline]
    24. 24
  24. Lu, J., B. Huang, A. Esberg, M. J. O. Johansson, and A. S. Byström. 2005. The Kluyveromyces lactis {gamma} toxin targets tRNA anticodons. RNA 11:1648-1654.[Abstract/Free Full Text]
    25. 25
  25. Magliani, W., S. Conti, M. Gerloni, D. Bertolotti, and L. Polonelli. 1997. Yeast killer systems. Clin. Microbiol. Rev. 10:369-400.[Abstract]
    26. 26
  26. McCracken, D. A., V. J. Martin, M. J. R. Stark, and P. L. Bolen. 1994. The linear-plasmid-encoded toxin produced by the yeast Pichia acaciae: characterization and comparison with the toxin of Kluyveromyces lactis. Microbiology 140:425-431.[Abstract/Free Full Text]
    27. 27
  27. Mehlgarten, C., and R. Schaffrath. 2004. After chitin docking, toxicity of Kluyveromyces lactis zymocin requires Saccharomyces cerevisiae plasma membrane H+-ATPase. Cell. Microbiol. 6:569-580.[CrossRef][Medline]
    28. 28
  28. Mumburg, D., R. Muller, and M. Funk. 1994. Regulatable promoters of Saccharomyces cerevisiae: comparison of transcriptional activity and their use for heterologous expression. Nucleic Acids Res. 22:5767-5768.[Free Full Text]
    29. 29
  29. Niwa, O., K. Sakaguchi, and N. Gunge. 1981. Curing of the killer deoxyribonucleic acid plasmids of Kluyveromyces lactis. J. Bacteriol. 148:988-990.[Abstract/Free Full Text]
    30. 30
  30. Paluszynski, J. P., R. Klassen, M. Rohe, and F. Meinhardt. 2006. Various cytosine/adenine permease homologues are involved in the toxicity of 5-fluorocytosine in Saccharomyces cerevisiae. Yeast 23:707-715.[CrossRef][Medline]
    31. 31
  31. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
    32. 32
  32. Schaffrath, R., and F. Meinhardt. 2004. Kluyveromyces lactis zymocin and other plasmid-encoded yeast killer toxins. Top. Curr. Genet. 11:133-155.
    33. 33
  33. Schickel, J., C. Helming, and F. Meinhardt. 1996. Kluyveromyces lactis killer system. Analysis of cytoplasmic promoters of linear plasmids. Nucleic Acids Res. 24:1879-1886.[Abstract/Free Full Text]
    34. 34
  34. Schründer, J., N. Gunge, and F. Meinhardt. 1996. Extranuclear expression of the bacterial xylose isomerase (xylA) and the UDP-glucose dehydrogenase (hasB) genes in yeast with Kluyveromyces lactis linear killer plasmids as vectors. Curr. Microbiol. 33:323-330.[CrossRef][Medline]
    35. 35
  35. Southern, E. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517.[CrossRef][Medline]
    36. 36
  36. Stark, M. J. R., and A. Boyd. 1986. The killer plasmid of Kluyveromyces lactis: characterization of the toxin subunits and identification of the genes which encode them. EMBO J. 5:1995-2002.[Medline]
    37. 37
  37. Stark, M. J. R., A. Boyd, H. J. Mileham, and M. A. Romanos. 1990. The plasmid-encoded killer system of Kluyveromyces lactis: a review. Yeast 6:1-29.[CrossRef][Medline]
    38. 38
  38. Tokunaga, M., N. Wada, and F. Hishinuma. 1987. Expression and identification of immunity determinants on linear DNA killer plasmids pGKL1 and pGKL2 in Kluyveromyces lactis. Nucleic Acids Res. 15:1031-1046.[Abstract/Free Full Text]
    39. 39
  39. Tokunaga, M., A. Kawamura, and F. Hishinuma. 1989. Expression of pGKL1 killer 28K subunit in Saccharomyces cerevisiae: identification of 28K subunit as a killer protein. Nucleic Acids Res. 17:3435-3446.[Abstract/Free Full Text]
    40. 40
  40. Worsham, P. L., and P. L. Bolen. 1990. Killer toxin production in Pichia acaciae is associated with linear DNA plasmids. Curr. Genet. 18:77-80.[CrossRef][Medline]
    41. 41
  41. Zink, S., C. Mehlgarten, H. K. Kitamoto, J. Nagase, D. Jablonowski, R. C. Dickson, M. J. R. Stark, and R. Schaffrath. 2005. Mannosyl-diinositolphospho-ceramide, the major yeast plasma membrane sphingolipid, governs toxicity of Kluyveromyces lactis zymocin. Eukaryot. Cell 4:879-889.[Abstract/Free Full Text]

Applied and Environmental Microbiology, July 2007, p. 4373-4378, Vol. 73, No. 13
0099-2240/07/$08.00+0     doi:10.1128/AEM.00271-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Frank, A. C., Wolfe, K. H. (2009). Evolutionary Capture of Viral and Plasmid DNA by Yeast Nuclear Chromosomes. Eukaryot Cell 8: 1521-1531 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paluszynski, J. P.
Right arrow Articles by Meinhardt, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paluszynski, J. P.
Right arrow Articles by Meinhardt, F.
Agricola
Right arrow Articles by Paluszynski, J. P.
Right arrow Articles by Meinhardt, F.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»