Previous Article | Next Article 
Applied and Environmental Microbiology, September 2007, p. 5471-5476, Vol. 73, No. 17
0099-2240/07/$08.00+0 doi:10.1128/AEM.02707-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Metabolic Engineering of Saccharomyces cerevisiae for Conversion of D-Glucose to Xylitol and Other Five-Carbon Sugars and Sugar Alcohols
Mervi H. Toivari,1*
Laura Ruohonen,1
Andrei N. Miasnikov,2
Peter Richard,1 and
Merja Penttilä1
VTT Technical Research Centre of Finland, P.O. Box 1000, FI-02044 VTT, Espoo, Finland,1
Danisco Global Innovation, Sokeritehtaantie 20, FI-02460 Kantvik, Finland2
Received 20 November 2006/
Accepted 4 July 2007
 |
ABSTRACT
|
|---|
Recombinant Saccharomyces cerevisiae strains that produce the sugar alcohols xylitol and ribitol and the pentose sugar D-ribose from D-glucose in a single fermentation step are described. A transketolase-deficient S. cerevisiae strain accumulated D-xylulose 5-phosphate intracellularly and released ribitol and pentose sugars (D-ribose, D-ribulose, and D-xylulose) into the growth medium. Expression of the xylitol dehydrogenase-encoding gene XYL2 of Pichia stipitis in the transketolase-deficient strain resulted in an 8.5-fold enhancement of the total amount of the excreted sugar alcohols ribitol and xylitol. The additional introduction of the 2-deoxy-glucose 6-phosphate phosphatase-encoding gene DOG1 into the transketolase-deficient strain expressing the XYL2 gene resulted in a further 1.6-fold increase in ribitol production. Finally, deletion of the endogenous xylulokinase-encoding gene XKS1 was necessary to increase the amount of xylitol to 50% of the 5-carbon sugar alcohols excreted.
 |
INTRODUCTION
|
|---|
Xylitol is a naturally occurring 5-carbon sugar alcohol present in fruits and vegetables. Its sweetening power is comparable to that of sucrose, while the negative heat solution value gives a cool taste for this sugar alcohol. Xylitol inhibits dental caries and acute otitis media (18, 42) and is an ideal sweetener for diabetics because its metabolism is insulin independent. Xylitol is used in products such as chewing gums, sweets, and toothpaste. It is currently produced by chemical reduction, with a nickel catalyst, of the five-carbon sugar D-xylose from birch wood hydrolysates. D-Xylose can also be reduced to xylitol with high yields by various yeast species (9, 43). Both processes rely on the hydrolysis and/or purification of D-xylose from lignocellulosic materials.
D-Glucose, on the other hand, is a common substrate in the food industry and is, compared to D-xylose, cheap and readily available. Thus, it would be attractive if xylitol could be produced from D-glucose. However, few if any natural microorganisms that produce xylitol from D-glucose are known. The species Bacillus, Zygosaccharomyces, Aureobasidium, Torula, and Candida convert D-glucose to other sugars and sugar alcohols such as D-ribose, D-arabitol, and erythritol (1, 4, 5, 12, 36). In D-ribose-producing Bacillus and Candida strains, the precursor is D-ribose 5-phosphate, a pentose phosphate pathway (PPP) intermediate. In these strains, transketolase activity, which catalyzes the conversion of D-xylulose 5-phosphate and D-ribose 5-phosphate or erythrose 4-phosphate to C7 and C3 and C6 and C3 products, respectively, in the nonoxidative branch of the PPP, is missing or defective (5, 13, 33). It was suggested that this deficiency results in the accumulation of D-ribose 5-phosphate and its dephosphorylation and excretion as D-ribose. Similarly, the PPP intermediate D-ribulose 5-phosphate or possibly the xylulose 5-phosphate and erythrose 4-phosphate intermediates act as precursors for D-arabitol and erythritol, which are formed from the sugar phosphates by dephosphorylation and reduction reactions (1, 3, 11, 37). D-Xylulose 5-phosphate and D-ribulose 5-phosphate also serve as precursors for D-arabitol when the D-arabitol phosphate dehydrogenase from Enterococcus avium is applied (22, 24). D-Ribose, a drug precursor, and erythritol, a sweetener, are commercially produced from D-glucose by the Bacillus, Aureobasidium, and Torula species with a yield of almost 50% (wt/wt) of consumed D-glucose (5, 12, 14, 16).
Xylitol has been produced from D-glucose via D-arabitol and D-xylulose by Onishi and Suzuki, who used a three-step fermentation process (21). D-Glucose was converted to D-arabitol by Debaryomyces hansenii, then oxidized to D-xylulose by Acetobacter suboxydans, and subsequently reduced to xylitol by Candida guilliermondii. Mayer and coworkers used a similar approach but replaced the last fermentation step with an enzymatic in vitro reaction using xylitol dehydrogenase (19). These multistep processes, however, are complex and less applicable to an industrial scale. In addition, they require a high yield at each individual step to make the overall process feasible. Recently, a pentulose-producing B. subtilis strain was modified to produce xylitol from D-glucose with a yield of around 20% (wt/wt) by expressing a xylitol-phosphate dehydrogenase-encoding gene in the host strain (23).
In the present study, we were able to demonstrate that D-glucose can be converted to xylitol by the yeast Saccharomyces cerevisiae in a single fermentation step. We have shown previously that a transketolase-deficient S. cerevisiae strain accumulated D-xylulose 5-phosphate (39). We now investigated whether the accumulation of this 5-carbon sugar phosphate could be redirected to xylitol by the dephosphorylation of D-xylulose 5-phosphate and further reduction of D-xylulose to xylitol (Fig. 1a). Transketolase-deficient S. cerevisiae strains overexpressing xylitol dehydrogenase and sugar phosphate phosphatase-encoding genes were constructed. The phosphorylation of D-xylulose back to D-xylulose 5-phosphate was prevented by additionally deleting the endogenous xylulokinase-encoding gene.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1. (a) The pentose phosphate pathway of S. cerevisiae showing how xylitol could be formed from D-glucose. TKL, transketolase isoenzymes 1 and 2. (b) The suggested routes to xylitol, ribitol, and D-ribose in the metabolically engineered S. cerevisiae strains created in this study. RPE1, D-ribulose-phosphate 3-epimerase; RKI1, D-ribose-5-phosphate keto-isomerase; Ptase, sugar phosphate phosphatase (e.g., Dog1p); XDH, xylitol dehydrogenase; AldR, nonspecific aldose reductase (e.g., Gre3p). All sugars presented are in D-configuration.
|
|
 |
MATERIALS AND METHODS
|
|---|
Strains and strain constructions.
Two yeast strains were used, strain W303-1B (40) and the transketolase-deficient strain (i.e., the strain lacking transketolase activity) W303/tkl1 tkl2/2C, referred to here as the tkl1,2 strain or H1055 (34). All strains constructed and used in this study are listed in Table 1. Escherichia coli strain DH5
was used for bacterial cloning steps.
The plasmid pAOS66 containing the XYL2 gene, encoding xylitol dehydrogenase (XDH) from Pichia stipitis under the control of a modified ADH1 promoter (30) in the BamHI site of pMA91 vector (20), was used as the source of the XYL2 gene expression cassette for integration. The expression cassette was released from the plasmid pAOS66 as a 2.2-kbp BamHI fragment. To create an integration cassette targeted to the URA3 gene locus, a 1.2-kbp URA3 fragment was cloned into the HindIII site of the bacterial cloning vector BluescriptSK(–) (Stratagene, CA). The XYL2 gene fragment was blunt ended by the Klenow enzyme and ligated into the URA3 gene at the NcoI site, which was also made blunt ended with the Klenow enzyme. The resulting XYL2 integration cassette was released with the PvuII and HindIII enzymes. The HindIII fragment, containing the XYL2 expression cassette flanked by the URA3 gene sequences, was purified from an agarose gel and used to transform the yeast strain H1055. 5-Fluoroorotic acid was used to select transformants that did not have a functional URA3 gene (29). The correct integration was confirmed by measuring XDH activity from the crude cell extracts and by Southern blotting. The resulting strain was named H1506.
The 2-deoxy-glucose 6-phosphate (2-deoxy-glucose 6-P) phosphatase (Dog1p)-encoding gene DOG1 was amplified by PCR with the oligonucleotide pair 5'TGAGTAAGCTTATGGCAGAATTTTCAGCT3' and 5'TTGTCAAGCTTTTGTTTACTCAGGCCCTT3', using the vector YEp11HP as a template (31). The PCR fragment was digested with HindIII and ligated into the HindIII site located between the modified ADH1 promoter (30) and the ADH1 terminator in the Bluescribe M13 vector. The resulting ADH1 promoter-DOG1-ADH1 terminator cassette was released using the BamHI and PvuII enzymes, and the BamHI fragment was cloned into the BamHI site of the YEplac195 vector (8). The new plasmid was transformed into strain H1506, resulting in strain H1520, and into the W303-1B parental strain, resulting in strain H1514. The respective control strains with the empty YEplac195 vector, but no expression cassette, were named H1524 and H1518, respectively. The gene encoding xylulokinase was deleted as described previously (26). In short, the deletion cassette was transformed into the transketolase-deficient strain containing the integrated XYL2 gene (H1506), resulting in strain H1854, and into the transketolase-deficient strain alone, resulting in strain H1852. The YEplac195 vector alone or carrying the DOG1 gene expression cassette was also transformed into H1854 strain, resulting in strains H2284 and H2282, respectively. All yeast transformations were carried out using the lithium acetate method (7, 10).
Culture conditions.
The recombinant and nontransformed strains were cultured in 50 ml of growth medium in 250-ml Erlenmeyer flasks, with shaking at 250 rpm at 30°C. D-Glucose (20 g liter–1) was used as the carbon source in modified yeast synthetic complete (YSC) medium (35). For the selection of the plasmid and integration transformants, uracil and/or leucine was omitted from the growth medium.
Growth of yeast was monitored as the increase in the optical density of the cultures at 600 nm (OD600) at regular intervals, and supernatant samples were stored at –20°C. The ratio of one OD600 unit equal to 0.3 g liter–1 cell (dry weight) was used for biomass calculations.
Analyses of enzyme activities and metabolites.
Enzyme activities were measured from cell extracts prepared by disrupting the cells with glass beads (diameter, 425 to 600 µm; Sigma-Aldrich Corporation, MO) in a 100 mM sodium phosphate buffer (pH 7.0) solution for XDH activity and in a 50 mM imidazole-HCl, 10 mM MgCl2 (pH 6.0) buffer solution for Dog1p activity. Phenylmethylsulfonyl fluoride and pepstatin A were added as protease inhibitors in final concentrations of 0.17 mg ml–1 and 0.01 mg ml–1, respectively.
The XDH activity was determined essentially as described previously (27), with a Cobas Mira Plus automated analyzer (Roche, Switzerland). The specificities of Dog1p for D-xylulose-5-P, D-ribulose-5-P, D-ribose-5-P, and 2-deoxy-glucose 6-P were determined at substrate concentrations of 20 mM. Yeast cell extracts were prepared as described above. Cell extract (10 µl) and substrate (210 µl of 20 mM substrate) were mixed in the same buffer and incubated for 30 min at 30°C. The reaction was terminated with trichloroacetic acid (final concentration, 2% [vol/vol]), and the phosphate that was released was measured with ammonium molybdate (15 mM) and zinc acetate (100 mM) at pH 5.0. The formation of molybdenum blue was measured at 350 nm and quantified against phosphate standards (2, 31). One unit (U) refers to the amount of enzyme required to convert one micromole of substrate in 1 min.
Pentose and hexose sugars were analyzed with high-performance liquid chromatography (HPLC) from the culture supernatant. HPLC analyses were carried out with an Aminex HPX-87H ion-exclusion column (300 mm by 7.8 mm; Bio-Rad Laboratories, CA) with 2.5 mM H2SO4 in water as the mobile phase and a flow rate of 0.3 ml min–1 at 55°C. In order to see whether D-arabitol, which coeluted with D-ribose and D-ribulose in the HPX-87H column, was produced, a DIONEX DX-500 device with a CarboPac PA-10 column (Dionex Corporation, CA) was used to analyze some of the culture supernatants. Analysis conditions were as follows: the column temperature was 30°C, and the flow rate was 1 ml min–1; eluants consisted of water (A), 100 mM NaOH (B), 300 mM Na acetate and 100 mM NaOH (C), and 300 mM NaOH (D). For the first 21 min, the analysis was run with 100% A; from 21 to 40 min, the linear gradient went up to 100% B, followed by a linear gradient of up to 50% B and 50% C in 20 min. The column was washed for 4 min with 100% C and for 3 min with 100% D. After the washing steps, the column was equilibrated for 15 min before the next injection. Unless stated otherwise, analyses were performed with an Aminex HPX-87H column, for which the detection limit was 25 mg liter–1.
An Aminex HPX-87H column enabled measurement of D-glucose, ethanol, glycerol, D-xylulose, ribitol, and xylitol and the coeluted D-ribose, D-ribulose, and D-arabitol. The D-ribose (D-ribulose and D-arabitol) peak was manually integrated to separate it from the neighboring xylitol and ribitol peaks. A CarboPac PA-10 column enabled separation of D-arabitol from D-ribose and D-ribulose, but D-ribulose and D-xylulose coeluted, and their amounts were not quantifiable due to degradation in alkaline pH.
 |
RESULTS
|
|---|
Excretion of ribitol and pentose sugars by the transketolase-deficient yeast strain.
Deletion of the transketolase-encoding genes results in the accumulation of D-xylulose 5-phosphate (39), which could serve as a precursor for xylitol. To study whether xylitol and/or D-xylulose is excreted by the parental or transketolase-deficient strain, the strains were cultured on YSC medium containing 20 g of D-glucose liter–1 as the carbon source. The parental strain W303-1B produced essentially no extracellular 5-carbon sugars and sugar alcohols (maximally, 20 mg liter–1; data not shown). The transketolase-deficient strain H1055, on the other hand, produced approximately 260 mg liter–1 extracellular D-ribulose plus D-ribose, which coeluted in the HPLC, and approximately 60 mg liter–1 ribitol (Fig. 2a and Table 2). The concentration of the compounds in the culture medium increased with the cultivation time. However, only a few milligrams of D-xylulose and no xylitol were observed for the culture medium (data not shown). When analyzed with a DIONEX CarboPac PA-10 column, the concentration of D-arabitol was found to be negligible.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2. Volumetric production (mg liter–1) of extracellular pentose sugars and sugar alcohols by the transketolase-deficient strain H1055 (a) and the transketolase-deficient strain H1506 containing the XYL2 gene integrated to the genome (b), grown on YSC medium with 20 g liter–1 D-glucose as a carbon source in an aerobic flask cultured with shaking. Production levels of sugar alcohols ribitol (white) and xylitol (gray) and of D-ribulose plus D-ribose (black) at 55, 78, and 100 h of culture are shown. The 5-carbon sugars were analyzed by HPLC (see Materials and Methods).
|
|
Overexpression of the xylitol dehydrogenase-encoding gene XYL2 increases the amount of excreted ribitol and xylitol in the transketolase-deficient strain.
Xylitol dehydrogenase catalyzes the reduction of D-xylulose to xylitol, and it also converts D-ribulose to ribitol, reactions in which the equilibrium of the reaction is on the sugar alcohol side. S. cerevisiae does not have measurable XDH activity when grown on D-glucose, although it possesses genes encoding xylitol and sorbitol dehydrogenases (27, 32, 41). Therefore the XYL2 gene of P. stipitis, encoding xylitol dehydrogenase, was introduced into the S. cerevisiae strain; in the XYL2-integrant strain H1506, the XDH activity was 1.3 U (mg of total soluble proteins)–1. The H1506 strain produced higher amounts of extracellular ribitol than the transketolase-deficient strain H1055 when cultured on YSC medium containing 20 g D-glucose liter–1 as the carbon source (Fig. 2). In addition, xylitol was formed; approximately 30% of the total excreted amount of xylitol plus ribitol in the medium was xylitol (Fig. 2b), in contrast to the absence of xylitol from the supernatant of the transketolase-deficient strain (Fig. 2a). The amount of total xylitol plus ribitol was 8.5-fold higher in the H1506 strain than in the H1055 strain, but the total amount of 5-carbon sugars and sugar alcohols in the medium increased only 1.6-fold, as the amount of D-ribulose plus D-ribose concomitantly decreased in the H1506 strain.
In a batch culture, the H1506 strain exhibited a clear respirofermentative mode of growth; approximately 6 g liter–1 ethanol was formed in 60 h (Fig. 3). However, the strain ceased producing biomass when around 10 g liter–1 D-glucose was present in the growth medium, whereas the production of ethanol, ribitol, and xylitol continued until D-glucose was completely consumed. The final biomass produced by the transketolase-deficient strain was lower than that of the parental strain (approximately 0.9 g liter–1 and 1.5 g liter–1, respectively), although the approximate specific growth rates of the strains did not vary much (0.11 and 0.13 g of cell dry weight h–1 for the transketolase-deficient strain and the parental strain, respectively). A reduced accumulation of biomass in the transketolase-deficient strain compared to that of the parental strain was also noticed by Sundström and coworkers (38). Possibly, the lack of transketolase activity provokes accumulation of toxic intermediates in the PPP or leads to insufficient production of NADPH and the D-ribose 5-phosphate needed for anabolic reactions. This would explain the early cessation of biomass production as well as the relatively large variation in the final biomass accumulated by the H1506 strain (Fig. 3).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3. Volumetric consumption of D-glucose (in g liter–1; circles) and production of biomass (dry weight [DW]; squares), ethanol (in g liter–1; diamonds), ribitol (in g liter–1; triangles), and xylitol (in g liter–1; crosses and stars) by the transketolase-deficient strain H1506 expressing the XYL2 gene integrated into the genome, in aerobic flasks with shaking on YSC medium with 20 g liter–1 D-glucose as a carbon source. Open and closed symbols indicate two identical, independent experiments.
|
|
Overexpression of the sugar phosphate phosphatase-encoding gene DOG1 increases the excretion of ribitol and D-ribose by the transketolase-deficient strain containing the integrated XYL2 gene.
A possible limiting step in the production of extracellular pentose sugars is the dephosphorylation of the corresponding sugar phosphates. The only cytoplasmic phosphatases known to be active on pentose phosphates are the 2-deoxy-glucose 6-P phosphatases Dog1p and Dog2p (25). The Dog1p phosphatase was chosen for this study since it has higher activities toward D-ribose 5-phosphate and D-ribulose 5-phosphate than Dog2p does (25). Our preliminary analyses indicated that, in addition to activities toward 2-deoxy-glucose-6-P (100%), D-ribulose 5-phosphate (7%), and D-ribose 5-phosphate (42%), Dog1p also accepts D-xylulose 5-phosphate as a substrate, with ca. 15% activity compared to that of its major substrate, 2-deoxy-glucose-6-P (data not shown).
When the DOG1 gene was overexpressed in the transketolase-deficient strain H1520 with the XYL2 gene integrated into its genome, the accumulation of extracellular ribitol was 1.6-fold higher than in the strain lacking DOG1 (Table 2), whereas the fraction of D-ribulose plus D-ribose was higher by 3.8-fold (data not shown). The amount of xylitol, however, did not increase in the DOG1-overexpressing strain, suggesting that this enzyme is indeed more efficient with D-ribose 5-phosphate as a substrate. The overexpression of DOG1 had no effect on the growth of the transketolase-deficient strains cultured on YSC medium or on that of the parental strain (data not shown). The H1514 strain, a parental strain overexpressing DOG1, had phosphatase activity of 0.06 U (mg total soluble proteins)–1 compared to the activity of 0.001 U [mg total soluble proteins]–1 of the control strain with 2-deoxy-glucose 6-phosphate as a substrate.
Deletion of the xylulokinase-encoding gene (XKS1) increases the proportion of xylitol excreted in the transketolase-deficient XYL2-expressing strain.
Xylulokinase activity in the parental strain (W303-1B) is known to be low, and the strain grows slowly on D-xylulose (26). In the transketolase-deficient strain containing the XYL2 gene, deletion of the xylulokinase-encoding gene, however, increased the amount of xylitol produced 1.9-fold (Table 2) and concomitantly decreased ribitol production by 23%. The D-ribulose plus D-ribose concentration was less than 50 mg liter–1 (data not shown). Once the Dog1p phosphatase was introduced into the xylulokinase-deficient strain, the amount of D-ribulose plus D-ribose excreted increased by a factor of 4 (data not shown), and the amount of ribitol increased 1.6-fold, whereas the amount of xylitol was not affected (Table 2).
At most, 730 mg liter–1 or 3.6% of the D-glucose consumed (20 g liter–1) was converted to sugar alcohols (Table 2). The highest volumetric concentration was obtained with the strain that was deficient in the transketolase and xylulokinase activities and that expressed the XYL2 and DOG1 genes.
 |
DISCUSSION
|
|---|
An S. cerevisiae strain that is able to convert D-glucose to xylitol in a single fermentation step was constructed. The strain, deficient in both transketolase and xylulokinase activities, presumably accumulated D-xylulose 5-phosphate and redirected it to xylitol with the action of the introduced xylitol dehydrogenase. In addition, ribitol was formed.
The observation that ribitol, xylitol, and D-ribulose plus D-ribose (the latter two not separated with the methods used in this study) were synthesized simultaneously may be explained by the presence of D-xylulose 5-phosphate, D-ribulose 5-phosphate, and D-ribose 5-phosphate at similar concentrations in the cell (see Fig. 1). However, the need for NADPH and D-ribose 5-phosphate in the anabolic reactions, as well as the lack of transketolase activity itself, is likely to affect the equilibrium. Earlier studies (39) suggest that the concentration of D-xylulose 5-phosphate was about twice as high as that of D-ribulose 5-phosphate or D-ribose 5-phosphate in the transketolase-deficient strain. This is not reflected, however, by increased production of D-xylulose or xylitol. The fact that similar amounts of ribitol and xylitol were produced by the strains deficient in transketolase and xylulokinase activities and expressing the XYL2 gene (strains H1854 and H2284) suggests that an unknown phosphatase in the transketolase-deficient strains dephosphorylated D-ribose 5-phosphate and D-ribulose 5-phosphate more efficiently than it did D-xylulose 5-phosphate. The Dog1p also favored ribitol and D-ribulose plus D-ribose production, but whether the phosphatase activity in the transketolase-deficient strain is indeed Dog1p or possibly Dog2p is currently unknown.
Dephosphorylation of the 5-carbon sugar phosphates D-ribose 5-phosphate, D-xylulose 5-phosphate and D-ribulose 5-phosphate results in D-ribose, D-xylulose, and D-ribulose, respectively (Fig. 1b). The xylitol dehydrogenase of P. stipitis is able to reduce D-xylulose to xylitol as well as D-ribulose to ribitol (Fig. 1b) (28), and in addition, endogenous aldose reductases, Gre3p for example (15), are able to reduce D-ribose to ribitol. Thus, the ribitol observed may be derived either from D-ribulose or from D-ribose. Interestingly, while the xylulokinase activity in the parental strain W303-1B is low (26), it still phosphorylates D-xylulose, since deletion of the endogenous xylulokinase-encoding gene resulted in higher amounts of xylitol produced. No D-xylulose, however, was detected in the medium in the transketolase-deficient strain deficient also in the xylulokinase activity.
In comparison with that of organisms that naturally produce 5-carbon sugars or those that are improved by classical mutagenesis (1, 4, 5, 12, 36) or by the previously reported processes for xylitol production from D-glucose (19, 21, 23), the amounts of 5-carbon sugars and sugar alcohols produced by the recombinant S. cerevisiae strains of this study were low. One very likely reason is the low capacity of the PPP in S. cerevisiae; less than 4% of D-glucose is channeled through this pathway during respirofermentative metabolism (6, 17). On the other hand, in this study, production conditions were not optimized, and parameters like aeration and biomass concentration are likely to affect the product yield. However, the pathway for xylitol production could be further engineered by forcing all glucose through the PPP by deleting the phosphoglucose isomerase-encoding gene and simultaneously modifying the NADPH demand by the cell by introducing a transhydrogenase reaction. Moreover, through engineering of the epimerase and isomerase reactions, the balance of PPP sugar phosphates could possibly be altered. In addition, protein engineering could provide a sugar phosphate phosphatase specific for D-xylulose 5-phosphate.
The present study demonstrates the feasibility of engineering S. cerevisiae for the production of xylitol from D-glucose. Further studies, however, are needed to improve this method before xylitol production from D-glucose by S. cerevisiae could have commercial potential.
 |
ACKNOWLEDGMENTS
|
|---|
We thank I. Schaaff-Gerstenschläger (Institut fur Mikrobiologie, Technische Hochschule Darmstadt, Germany) for providing the transketolase-deficient S. cerevisiae strain W303/tkl1 tkl2/2C and P. Sanz (Instituto de Biomedicina de Valencia CSIC, Valencia, Spain) for providing the DOG1-bearing plasmid. We also thank Marilyn Wiebe for comments on the manuscript. Technical assistance by Eila Leino and Seija Rissanen is greatly appreciated. Marjukka Perttula and Ulla Lahtinen are warmly thanked for carrying out part of the HPLC analysis.
This work was financially supported by Danisco sweeteners and Tekes, the Finnish Funding Agency for Technology and Innovation (project 4007/96).
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: VTT Technical Research Centre of Finland, P.O. Box 1000, FI-02044 VTT, Espoo, Finland. Phone: 358 20 722 7309. Fax: 358 20 722 7071. E-mail: Mervi.Toivari{at}vtt.fi 
Published ahead of print on 13 July 2007. 
 |
REFERENCES
|
|---|
- Aoki, M. A. Y., Y. G. Pastore, and K. Park. 1993. Microbial transformation of sucrose and glucose to erythritol. Biotechnol. Lett. 15:383-388.[CrossRef]
- Bencini, D. A., J. R. Wild, and G. A. O'Donovan. 1983. Linear one-step assay for the determination of orthophosphate. Anal. Biochem. 132:254-258.[CrossRef][Medline]
- Blakley, E. R., and J. F. T. Spencer. 1962. Studies on the formation of D-arabitol by osmophilic yeasts. Can. J. Biochem. Physiol. 40:1737-1748.[Medline]
- de Wulf, P., W. Soetaert, D. Schwengers, and E. J. Vandamme. 1996. Screening and mutational improvement of a D-ribose secreting Candida pelliculosa strain. J. Ferment. Bioeng. 82:1-7.
- de Wulf, P., and E. J. Vandamme. 1997. Microbial synthesis of D-ribose: metabolic deregulation and fermentation process. Adv. Appl. Microbiol. 44:167-214.
- Gancedo, J. M., and R. Lagunas. 1973. Contribution of the pentose-phosphate pathway to glucose metabolism in Saccharomyces cerevisiae: a critical analysis on the use of labeled glucose. Plant Sci. Lett. 193-200.
- Gietz, D., A. St. Jean, R. A. Woods, and R. H. Schiestl. 1992. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20:1425.[Free Full Text]
- Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534.[CrossRef][Medline]
- Hallborn, J., M. Walfridsson, U. Airaksinen, H. Ojamo, B. Hahn-Hägerdal, M. Penttilä, and S. Keränen. 1991. Xylitol production by recombinant Saccharomyces cerevisiae. Biotechnology (N.Y.) 9:1090-1095.[CrossRef]
- Hill, J., K. A. Donald, D. E. Griffiths, and G. Donald. 1991. DMSO-enhanced whole cell yeast transformation. Nucleic Acids Res. 19:5791.[Free Full Text]
- Ingram, J. M., and W. A. Wood. 1965. Enzymatic basis for D-arabitol production by Saccharomyces rouxii. J. Bacteriol. 89:1186-1193.[Abstract/Free Full Text]
- Ishizuka, H., H. Wako, T. Kasumi, and T. Sasaki. 1989. Breeding of a mutant of Aureobasidium sp. with high erythritol production. J. Ferment. Bioeng. 68:310-314.[CrossRef]
- Josephson, B. L., and D. G. Fraenkel. 1969. Transketolase mutants of Escherichia coli. J. Bacteriol. 100:1289-1295.[Abstract/Free Full Text]
- Kim, K. A., J. K. Lee, S. Y. Kim, and D. K. Oh. 2000. Optimization of culture conditions for erythritol production by Torula sp. J. Microbiol. Biotechnol. 10:69-74.
- Kuhn, A., C. van Zyl, A. van Tonder, and B. A. Prior. 1995. Purification and partial characterization of an aldo-keto reductase from Saccharomyces cerevisiae. Appl. Environ. Microbiol. 61:1580-1585.[Abstract]
- Lee, J. K., S. J. Ha, S. Y. Kim, and D. K. Oh. 2000. Increased erythritol production in Torula sp. by Mn2+ and Cu2+. Biotechnol. Lett. 22:983-986.[CrossRef]
- Maaheimo, H., J. Fiaux, Z. P. Cakar, J. E. Bailey, U. Sauer, and T. Szyperski. 2001. Central carbon metabolism of Saccharomyces cerevisiae explored by biosynthetic fractional 13C labeling of common amino acids. Eur. J. Biochem. 268:2464-2479.[Medline]
- Mäkinen, K. K. 1992. Dietary prevention of dental caries by xylitol: clinical effectiveness and safety. J. Appl. Nutr. 44:16-28.
- Mayer, G., K. D. Kulbe, and B. Nidetzky. 2002. Utilization of xylitol dehydrogenase in a combined microbial/enzymatic process for production of xylitol from D-glucose. Appl. Biochem. Biotechnol. 98-100:577-589.[CrossRef][Medline]
- Mellor, J., M. J. Dobson, N. A. Roberts, M. F. Tuite, J. S. Emtage, S. White, P. A. Lowe, T. Patel, A. J. Kingsman, and S. M. Kingsman. 1983. Efficient synthesis of enzymatically active calf chymosin in Saccharomyces cerevisiae. Gene 24:1-14.[Medline]
- Onishi, H., and T. Suzuki. 1969. Microbial production of xylitol from glucose. Appl. Microbiol. 18:1031-1035.[Medline]
- Povelainen, M., and A. N. Miasnikov. 2006. Production of D-arabitol by a metabolic engineered strain of Bacillus subtilis. Biotechnol. J. 1:214-219.[CrossRef][Medline]
- Povelainen, M., and A. N. Miasnikov. 2006. Production of xylitol by metabolically engineered strains of Bacillus subtilis. J. Biotechnol. 128:24-31.[CrossRef][Medline]
- Povelainen, M., E. V. Eneyskaya, A. A. Kulminskaya, D. R. Ivanen, N. Kalkkinen, K. N. Neustroev, and A. N. Miasnikov. 2003. Biochemical and genetic characterization of a novel enzyme of pentitol metabolism: D-arabitol-phosphate dehydrogenase. Biochem. J. 371:191-197.[CrossRef][Medline]
- Randez-Gil, F., A. Blasco, J. A. Prieto, and P. Sanz. 1995. DOGR1 and DOGR2: two genes from Saccharomyces cerevisiae that confer 2-deoxyglucose resistance when overexpressed. Yeast 11:1233-1240.[CrossRef][Medline]
- Richard, P., M. H. Toivari, and M. Penttilä. 2000. The role of xylulokinase in Saccharomyces cerevisiae xylulose catabolism. FEMS Microbiol. Lett. 190:39-43.[CrossRef][Medline]
- Richard, P., M. H. Toivari, and M. Penttilä. 1999. Evidence that the gene YLR070c of Saccharomyces cerevisiae encodes a xylitol dehydrogenase. FEBS Lett. 457:135-138.[CrossRef][Medline]
- Rizzi, M., K. Harwart, N.-A. Bui-Thanh, and H. Dellweg. 1989. A kinetic study of the NAD+-xylitol-dehydrogenase from the yeast Pichia stipitis. J. Ferment. Bioeng. 67:25-30.[CrossRef]
- Rose, M. D., F. Winston, and P. Hieter. 1994. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- Ruohonen, L., M. K. Aalto, and S. Keränen. 1995. Modifications to the ADH1 promoter of Saccharomyces cerevisiae for efficient production of heterologous proteins. J. Biotechnol. 39:193-203.[CrossRef][Medline]
- Sanz, P., F. Randez-Gil, and J. A. Prieto. 1994. Molecular characterization of a gene that confers 2-deoxyglucose resistance in yeast. Yeast 10:1195-1202.[CrossRef][Medline]
- Sarthy, A. V., C. Schopp, and K. B. Idler. 1994. Cloning and sequence determination of the gene encoding sorbitol dehydrogenase from Saccharomyces cerevisiae. Gene 140:121-126.[CrossRef][Medline]
- Sasajima, K., I. Nogami, and M. Yoneda. 1970. Carbohydrate metabolism mutants of a Bacillus species. Part I. Isolation of mutants and their inosine formation. Agric. Biol. Chem. 34:381-389.
- Schaaff-Gerstenschläger, I., G. Mannhaupt, I. Vetter, F. K. Zimmermann, and H. Feldmann. 1993. TKL2, a second transketolase gene of Saccharomyces cerevisiae. Cloning, sequence and deletion analysis of the gene. Eur. J. Biochem. 217:487-492.[Medline]
- Sherman, F., G. Fink, and J. B. Hicks. 1983. Methods in yeast genetics. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- Spencer, J. F. T., and H. R. Sallans. 1956. Production of polyhydric alcohols by osmophilic yeasts. Can. J. Microbiol. 2:72-79.[Medline]
- Spencer, J. F. T., A. C. Neish, A. C. Blackwood, and H. R. Sallans. 1956. Polyhydric alcohol production by osmophilic yeasts: studies with C14-labeled glucose. Can. J. Biochem. Physiol. 34:495-501.[Medline]
- Sundström, M., Y. Lindqvist, G. Schneider, U. Hellman, and H. Ronne. 1993. Yeast TKL1 gene encodes a transketolase that is required for efficient glycolysis and biosynthesis of aromatic amino acids. J. Biol. Chem. 268:24346-24352.[Abstract/Free Full Text]
- Teleman, A., P. Richard, M. Toivari, and M. Penttilä. 1999. Identification and quantitation of phosphorus metabolites in yeast neutral pH extracts by nuclear magnetic resonance spectroscopy. Anal. Biochem. 272:71-79.[CrossRef][Medline]
- Thomas, B. J., and R. Rothstein. 1989. Elevated recombination rates in transcriptionally active DNA. Cell 56:619-630.[CrossRef][Medline]
- Toivari, M. H., L. Salusjärvi, L. Ruohonen, and M. Penttilä. 2004. Endogenous xylose pathway in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 70:3681-3686.[Abstract/Free Full Text]
- Uhari, M., T. Kontiokari, M. Koskela, and M. Niemelä. 1996. Xylitol chewing gum in prevention of acute otitis media: double blind randomised trial. Br. Med. J. 313:1180-1184.[Abstract/Free Full Text]
- Winkelhausen, E., and S. Kuzmanova. 1998. Microbial conversion of D-xylose to xylitol. J. Ferment. Bioeng. 86:1-14.[CrossRef]
Applied and Environmental Microbiology, September 2007, p. 5471-5476, Vol. 73, No. 17
0099-2240/07/$08.00+0 doi:10.1128/AEM.02707-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.