This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Benoit, I.
Right arrow Articles by Record, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Benoit, I.
Right arrow Articles by Record, E.
Agricola
Right arrow Articles by Benoit, I.
Right arrow Articles by Record, E.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, September 2007, p. 5624-5632, Vol. 73, No. 17
0099-2240/07/$08.00+0     doi:10.1128/AEM.00374-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Gene Overexpression and Biochemical Characterization of the Biotechnologically Relevant Chlorogenic Acid Hydrolase from Aspergillus niger{triangledown}

Isabelle Benoit,1 Michèle Asther,1 Yves Bourne,2 David Navarro,1 Stéphane Canaan,3 Laurence Lesage-Meessen,1 Marga Herweijer,4 Pedro M. Coutinho,2 Marcel Asther,1 and Eric Record1*

UMR-1163, INRA de Biotechnologie des Champignons Filamenteux, IFR86-BAIM, Universités de Provence et de la Méditerranée, ESIL, 163 avenue de Luminy, CP 965, 13288 Marseille Cedex 09, France,1 UMR 6098, Architecture et Fonction des Macromolécules Biologiques, CNRS/Universités de Provence et de la Méditerranée, 163 avenue de Luminy, CP 932, 13288 Marseille Cedex 09, France,2 UPR 9025, CNRS Laboratoire d'Enzymologie Interfaciale et de la Physiologie de la Lipolyse, 31 chemin Joseph Aiguier, 13402 Marseille Cedex 20, France,3 DSM Food Specialties, P.O. Box 1, 2600 MA Delft, The Netherlands4

Received 16 February 2007/ Accepted 30 June 2007


arrow
ABSTRACT
 
The full-length gene that encodes the chlorogenic acid hydrolase from Aspergillus niger CIRM BRFM 131 was cloned by PCR based on the genome of the strain A. niger CBS 513.88. The complete gene consists of 1,715 bp and codes for a deduced protein of 512 amino acids with a molecular mass of 55,264 Da and an acidic pI of 4.6. The gene was successfully cloned and overexpressed in A. niger to yield 1.25 g liter–1, i.e., 330-fold higher than the production of wild-type strain A. niger CIRM BRFM131. The histidine-tagged recombinant ChlE protein was purified to homogeneity via a single chromatography step, and its main biochemical properties were characterized. The molecular size of the protein checked by mass spectroscopy was 74,553 Da, suggesting the presence of glycosylation. ChlE is assembled in a tetrameric form with several acidic isoforms with pIs of around 4.55 and 5.2. Other characteristics, such as optimal pH and temperature, were found to be similar to those determined for the previously characterized chlorogenic acid hydrolase of A. niger CIRM BRFM 131. However, there was a significant temperature stability difference in favor of the recombinant protein. ChlE exhibits a catalytic efficiency of 12.5 x 106 M–1 s–1 toward chlorogenic acid (CGA), and its ability to release caffeic acid from CGA present in agricultural by-products such as apple marc and coffee pulp was clearly demonstrated, confirming the high potential of this enzyme.


arrow
INTRODUCTION
 
A variety of hydroxycinnamic acids, such as caffeic, p-coumaric, and ferulic acids, exist in many higher plants. They are often found in bound forms, generally as esters linked to sugars or quinic acid. Ferulic acid and other aromatic compounds are present in plant cell wall polysaccharides as terminal side groups esterified to different sites. In xylan, ferulic acid is attached to O-5 of terminal arabinose. In pectin, this aromatic compound is linked to O-2 of arabinose residues or O-6 of galactose residues (13). Moreover, cross-links through diferulic bridges are found in both heteroxylan and pectin, thus playing an important role in the structure of nonlignified cell walls. These compounds also exist as soluble conjugates, the best known being 5-O-caffeoyl quinic acid or chlorogenic acid (CGA), but other conjugates having been described, including monoesters (feruloylquinic and p-coumaroylquinic acids); di-, tri-, and tetraesters of caffeic acid; and mixed diesters (caffeoyl-feruloylquinic acids, caffeoyl-sinapoylquinic acids) (11, 12). Cinnamic acids can be conjugated to molecules other than quinic acid, but they have only a limited distribution. This minor category essentially includes esters of hydroxy acids, particularly malic and tartaric acids; amides of amino compounds; and esters of lipids. These compounds are present in particularly high concentrations in various foods and beverages, such as coffee, potato tubers, and apples.

Phenolics of plant origin are the most widespread dietary antioxidants, and they may play a role in the prevention of cardiovascular diseases and cancers (36). With its high bioavailability, CGA is an important and yet overlooked bioactive dietary component. Its hydrolysis product, caffeic acid, has a high antioxidant capacity, with multiple mechanisms involving free-radical scavenging, metal ion chelation, and inhibitory effects on some specific enzymes involved in free-radical formation (9, 27). CGA is naturally found in fruits and vegetables at up to several hundred milligrams per kilogram of dry weight (11). Higher concentrations of CGA are found in several agroindustrial by-products such as coffee pulp and apple marc, and enzymes allowing the release of these aromatic compounds are of special interest because of their potential industrial applications.

There is now a body of work reporting the isolation, purification, and characterization of microbial cinnamoyl esterases (EC 3.1.1.73) which are able to hydrolyze different kinds of sugar ester-linked hydroxycinnamic acids (16, 45, 46). Two cinnamoyl esterases were purified from A. niger strains cultivated in either oat-spelled xylan cultures or sugar beet pulp (SBP) cultures. The feruloyl esterase FAE-III is preferentially active on methyl esters of ferulic and sinapic acids (20), while the cinnamoyl esterase CinnAE is more active on methyl esters of caffeic and p-coumaric acids (24). In both cases, the respective genes faeA and faeB were cloned and characterized (18, 19), and more recently homologous overexpressions of both proteins have been reported (26, 35).

Despite growing interest in CGA and caffeic acid, few studies have focused directly on CGA hydrolase. Schöbel and Pollmann (40, 41) isolated a tetrameric CGA esterase (EC 3.1.1.42) from a pectinolytic enzyme preparation of Aspergillus niger. A hydroxycinnamic acid ester hydrolase was purified from A. japonicus (28). Barbe and Dubourdieu (3) isolated a dimeric cinnamate esterase from an industrial pectinase preparation of A. niger able to hydrolyze CGA. More recently, Couteau et al. (15) demonstrated the ability of human colonic bacteria to raise esterase activity against CGA. No complete biochemical characterization is available for any of these enzymes, and none of the corresponding genes have been cloned. We recently described the purification and characterization of a novel specific CGA hydrolase from A. niger, and we demonstrated the efficiency of this enzyme at releasing caffeic acid from natural agroindustrial by-products (2). Here, we describe the identification, isolation, and characterization of the first gene that encodes a CGA hydrolase (ChlE) present in the A. niger CBS 513.88 genome (29). Furthermore, we achieved homologous overexpression of this gene, and the properties of the recombinant protein were compared to those of the native enzyme. In addition, a predictive structural model of CGA hydrolase is proposed.


arrow
MATERIALS AND METHODS
 
Strains and culture media.
Escherichia coli JM109 (Promega, Charbonnières, France) was used for the construction and propagation of vectors, and A. niger strain D15#26 (pyrG mutant) was used for the expression of the gene that encodes ChlE. Wild-type strain A. niger CIRM BRFM 131 (Centre International de Ressources Microbiennes, Banque de Ressources Fongiques de Marseille) was used for RNA extraction from culture medium containing SBP as a carbon source and an esterase activity inducer (2). A. niger CIRM BRFM 131 was also used for genomic DNA extraction, and the resulting DNA was used as a template for PCR amplification. A. niger transformants were grown on selective solid minimum medium (without uridine) containing 70 mM NaNO3, 7 mM KCl, 11 mM KH2HPO4, 2 mM MgSO4, 1% (wt/vol) glucose, and trace elements (1,000x stock: 76 mM ZnSO4, 25 mM MnCl2, 18 mM FeSO4, 7.1 mM CoCl2, 6.4 mM CuSO4, 6.2 mM Na2MoO4, 174 mM EDTA). For screening for CGA hydrolase production, transformants were cultivated in a standard liquid medium containing 70 mM NaNO3, 7 mM KCl, 200 mM Na2HPO4, 2 mM MgSO4, 5% (wt/vol) glucose, and trace elements.

Chemicals.
Restriction enzymes and Pfu DNA polymerase were purchased from Invitrogen (Cergy-Pontoise, France) and Promega (Charbonnières-les-Bains, France), respectively. DNA sequencing was performed by GATC Biotech (Constance, Germany). CGA was purchased from Sigma (St. Quentin Fallavier, France). Caffeic, p-coumaric, sinapic, and ferulic acid methyl esters were obtained from Apin Chemicals (Oxon, United Kingdom). 5-O p-Coumaroylquinic acid was kindly provided by Unité INRA de Recherches Cidricoles de Rennes (France). O-[5-O-(trans-Feruloyl)-{alpha}-L-Araf] and O-[5-O-(trans-feruloyl)-{alpha}-L-Araf]-(1->3)D-Xylp were purified according to Saulnier et al. (39).

Gene cloning.
The genome sequence of A. niger strain CBS 513.88 (access details are available at the DSM site [http:/www.dsm.com_US/html/dfs/genomics_acess_arr.htm]) was recently determined, and extensive analysis and annotation resulted in the prediction of 14,156 open reading frames (ORFs) (29). These ORFs were translated into a set of putative proteins. With the N-terminal sequence of M. Asther et al. (2), a 100% match was obtained by BLAST (1), with one of the putative proteins corresponding to the gene model An07g04470. The gene that encodes this protein was PCR amplified with specific upstream primer 5'ACTACCATGGTTTTGCGTCTCTGC3' (NcoI cloning site) and downstream primer 5'GGCTAAGCTTTTAGTGGTGGTGGTGGTGGTGACAATAATCATCAAATCCTC3' (HindIII cloning site) with the genomic DNA of A. niger CIRM BRFM131 used as the template. The PCR product was subcloned into the pGEM-T easy vector for sequencing control. Three clones obtained from three independent PCRs were checked by sequencing, and one clone with a correct sequence was selected for cloning into the expression vector. The verified DNA sequence was then cloned into pAN52.3 (cloning sites, NcoI and HindIII) in order to obtain the pAN52.3-chlE expression vector. In this vector, the A. nidulans glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) promoter, the 5' untranslated region of the gpdA mRNA, and the A. nidulans trpC terminator were used to drive the expression of the sequence that encodes ChlE.

Southern blot analysis.
A. niger genomic DNA (10 µg) was digested overnight with various restriction enzymes and electrophoresed on a 0.6% agarose-TAE gel (25, 38). The fractionated DNA was blotted onto a Hybond N+ membrane and probed with a digoxigenin-labeled probe consisting of the chlE gene and prepared as recommended by the manufacturer (Roche Applied Science, Meylan, France). Hybridization and posthybridization procedures were performed as described in the DIG DNA labeling and detection kit (Roche Applied Science). The most stringent posthybridization wash consisted of two 15-min incubation steps in 0.2x SSC (20x SSC is 0.3 M sodium citrate buffer [pH 7.0] with 3 M NaCl) containing 1% sodium dodecyl sulfate (SDS) at 60°C. Digoxigenin-labeled bands were detected with anti-digoxigenin-alkaline phosphatase diluted to 1:5,000 as recommended by the manufacturer. Molecular weight ladders were obtained by hybridization of digoxigenin-labeled probes of the Smart Ladder (Eurogentec, Seraing, Belgium).

Aspergillus transformation and CGA hydrolase production.
Fungal cotransformation was carried out as described by Punt and van den Hondel (32), with the pAN52.3-chlE expression vector and pAB4-1 (44) containing the pyrG selection marker, at a ratio of 10:1. Transformants were selected for uridine prototrophy on minimal medium without uridine. Cotransformants containing expression vectors were selected as described in the following section. In addition, a control was transformed with the pAB4.1 vector but without the expression vector.

Transformants were plated on a selective minimal medium (without uridine) and incubated for 10 days at 30°C. To screen for ChlE production in liquid medium, 100 ml of culture medium containing 70 mM NaNO3, 7 mM KCl, 200 mM Na2HPO4, 2 mM MgSO4, 5% (wt/vol) glucose, and trace elements was inoculated with 2 x 106 spores ml–1 in 500-ml baffled flasks; incubated at 30°C; and shaken at 130 rpm. The pH was adjusted to 6.0 daily with a 1 M citric acid solution. A 1-ml aliquot of culture medium was collected, and cells were removed by filtration (0.45 µm) for esterase assay.

Enzyme activities.
ChlE activity was assayed as previously described (2), with CGA as the substrate; activities are expressed in nanokatals. Each experiment was carried out in duplicate, and measurements were taken in triplicate. The standard deviation was less than 1% of the mean. Cinnamoyl esterase (34), lipase (8), and acetylcholine esterase (7) activities were assayed as previously described.

Enzyme purification.
Six hundred milliliters of a 7-day-old culture of the D15-ChlE16 transformant was filtered (0.45-µm pore size) and concentrated sevenfold by ultrafiltration through a PTGC membrane (Millipore, Saint-Quentin Yvelines, France) with a 30-kDa molecular mass cutoff. The medium was dialyzed overnight at 4°C against 30 mM Tris-HCl, pH 7.5, containing NaCl 150 mM (buffer A) and then loaded onto a chelating Sepharose fast-flow column (2.6 by 14 cm; GE Healthcare, Orsay, France) previously charged with nickel. After two successive washing steps (180 ml buffer A and 140 ml buffer A with 10 mM imidazole), bound proteins were eluted with 200 ml of buffer A containing 250 mM imidazole at a flow rate of 1 ml min–1.

Characterization of recombinant CGA hydrolase. (i) Protein analysis.
The homogeneity and molecular mass of the denatured protein were checked by SDS-polyacrylamide gel electrophoresis (PAGE) on 12% acrylamide slab gels (25). Proteins were stained with Coomassie blue. The molecular mass of the native form was determined by gel filtration on a Superdex 200 10/300 GL (GE Healthcare, Orsay, France) and alternatively by mass spectrometry with matrix-assisted laser desorption and ionization time-of-flight mass spectrometers on a Bruker AnchorChip 600 target. Analytical isoelectric focusing (IEF) was performed with pH 4 to 6.5 precast gels (GE Healthcare, Orsay, France) according to the manufacturer's procedure.

(ii) Signal peptide and N-glycosylation predictions.
By the method of Bendtsen et al. (4), a signal peptide of 18 amino acids was predicted. N-glycosylation sites were predicted by the CBS NetNGlyc 1.0 server at http://www.cbs.dtu.dk/services/NetNGlyc/.

(iii) N-terminal amino acid sequence determination.
The N-terminal amino acid sequence was determined according to Edman degradation from an electroblotted ChlE sample (80 µg) onto a polyvinylidene difluoride membrane (Millipore, Saint-Quentin Yvelines, France). Analyses were carried out by the proteome platform at the Institut de Biologie Structurale et de Microbiologie, IFR 88, Marseille, France.

(iv) Temperature and pH optima.
The optimal temperature for activity was determined under standard conditions (100% refers to 1.34 nkat ml–1) from 37°C to 75°C. To determine the optimal pH, activities were assayed with 100 mM citrate-phosphate buffer over a pH range of 3.85 to 8.55. Absorbance coefficient ({varepsilon}) values for chlorogenic and caffeic acids at each pH were determined in order to calculate the corresponding ChlE activities.

(v) Temperature and pH stability.
For determination of thermal stability, aliquots of the purified enzyme (100% refers to 1.34 nkat ml–1) were incubated over a temperature range of 37°C to 65°C in 100 mM MOPS buffer, pH 6.0, for up to 90 min. Thermal inactivation was stopped by cooling the protein aliquot on ice. pH stability was determined by incubating the purified enzyme in 100 mM citrate-phosphate buffer at pH values ranging from 3.8 to 8.5 at 25°C for up to 90 min. In both cases, residual activity was assayed under standard conditions at pH 6.0 and 37°C with CGA as the substrate.

(vi) Enzyme deglycosylation.
Recombinant ChlE was deglycosylated with peptide-N4-(N-acetyl-ß-glucosaminyl)asparagine amidase F (PNGase F) from Flavobacterium meningosepticum (New England BioLabs, Ozyme, Saint Quentin Yvelines, France). Thirty micrograms of purified ChlE was incubated with 2 µl (1,000 U) of PNGase F and 1 µl of 1x G7 reaction buffer supplied by the manufacturer, in a final volume of 10 µl. The reaction was performed for 4 h at 37°C. Deglycosylation efficiency was determined by SDS-PAGE and IEF analysis.

Enzymatic hydrolysis of natural substrates.
Coffee pulp was obtained from the production cooperative Bénéficio de Café (Mexico), and apple marcs were obtained from the company Val de Vire (France) and the Unité INRA de Recherches Cidricoles de Rennes (France). CGA contents were approximately 4.2 and 0.8 mg g–1 of dry matter for coffee pulp and apple marc, respectively. Enzymatic hydrolysis of agroindustrial by-products and phenolic acid content determination were performed as previously described by Benoit et al. (6). Two hundred milligrams of autoclaved dry material was incubated overnight at 37°C with 2 nkat of purified enzyme. Products were acidified and extracted in ethyl acetate. Finally, the dried samples were dissolved in 50% methanol for analysis by high-performance liquid chromatography.

Nucleotide sequence accession number.
The chlE gene of A. niger strain BRFM 131 was deposited in GenBank under accession number DQ993161.


arrow
RESULTS
 
Cloning and characterization of the gene that encodes CGA hydrolase.
The chlE gene was amplified from the A. niger CIRM BRFM 131 genomic DNA with two specific primers. The signal peptide of ChlE was conserved to target secretion of the protein. In addition, the downstream primer introduced six histidine codons to allow an efficient method of purification of the recombinant protein from the culture medium. The complete gene was PCR amplified from the genomic DNA of A. niger CIRM BRFM 131, and the corresponding sequence was determined from three clones of independent PCRs. We sequenced the complete ORF (Fig. 1) consisting of 1,715 bp that was 52.5% G+C. In addition, codon usage studies of the chlE gene (23.9% A, 24.8% G, 22.8% T, 28.5% C) showed a slight bias for G+C at 53.5% and a preference for C at the third position (34.7%). There was also a preference for pyrimidine at the third position, which is 56.7% C+T. The coding region of the chlE gene was interrupted by three introns of 54, 59, and 64 bp, respectively. The 5' and 3' splicing sites of the three introns follow the general pattern GTRMGT...YAG, except for the second G of intron 1 and the C of intron 2, which are replaced by an A and a C, respectively. The chlE gene sequence was compared to the homologous gene identified in the genome of A. niger CBS 513.88 that was used in this study to design the specific primers. These two genes are 79.7% identical, and their respective deduced proteins revealed 93% identity and 97.1% similarity, indicating that the two genes encode the same protein (Fig. 1). The four exons encode a protein of 512 amino acids with a predicted molecular mass of 55,264 Da and a predicted pI of 4.6. In addition, the first 29 amino acids of the mature protein (2) that were used to search for sequence similarity to ChlE were found to be identical between the deduced sequence of ChlE from A. niger BRFM 131 and that encoded by gene An07g04470 of A. niger CBS 513.88.


Figure 1
View larger version (44K):
[in this window]
[in a new window]

 
FIG. 1. Alignment of the amino acid sequences of the CGA hydrolases from A. niger CIRM BRFM 131 (ChlE) and CBS 513.88 (An07g04470) with the CLUSTAL W sequence alignment algorithm (43). Perfect matches are represented by asterisks, high amino acid similarities are represented by double dots, and low amino acid similarities are represented by single dots. A six-histidine tag was added to the sequence of recombinant ChlE to facilitate purification of the protein.

A Southern blot analysis of the A. niger BRFM 131 strain was performed with a set of seven restriction enzymes, EcoRV, which cuts once within the genomic DNA sequence of chlE gene, and PstI, EcoRI, NotI, XbaI, XhoI, and BamHI, which do not cut within the gene (Fig. 2). In the Southern blot experiment, the probe hybridized to two bands when the genomic DNA was digested with EcoRV. In the other six digestions, one band appeared, as expected.


Figure 2
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 2. Southern hybridization analysis of A. niger DNA. Approximately 10 µg of genomic DNA from A. niger CIRM BRFM131 was restricted and separated by electrophoresis on a 0.6% agarose gel. Following transfer to a nylon membrane, the blot was hybridized with a digoxigenin-labeled probe consisting of the chlE gene. Genomic DNA was digested with EcoRV (lane 1), PstI (lane 2), EcoRI (lane 3), NotI (lane 4), XbaI (lane 5), XhoI (lane 6), and BamHI (lane 7).

Transformation and screening.
In a cotransformation experiment, A. niger D15#26 was transformed with the pAN52.3-chlE expression vector and the pAB4.1 covector. Transformants were selected for the ability to grow on a minimum medium without uridine and were inoculated into liquid medium. Fifty individual clones were cultivated in standard liquid medium and assayed daily for esterase activity. Among the producing clones, results for ChlE activity ranged from 2.8 to 140 nkat ml–1 on day 13. Clone D15-ChlE16, which exhibited the highest activity, was selected for the monitoring of enzyme production over time (Fig. 3A). ChlE activity was detected on day 3 and increased gradually until day 13, when it peaked at 140 nkat ml–1. Mycelial growth was tracked in parallel, and the results indicated that ChlE was mainly produced during the secondary phase of growth. SDS-PAGE analysis of the total secreted proteins revealed a predominant band corresponding to a molecular mass of 80 kDa, as already described by Asther et al. (2) (Fig. 3A). Finally, the copy number of the expression cassettes integrated into the fungal genome of clone D15-ChlE16 was estimated by Southern blot analysis with A. niger BRFM 131 as the reference. Five to six copies were estimated to be integrated in its genome.


Figure 3
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 3. Production, purification, and characterization of CGA hydrolase from A. niger D15-ChlE16. (A1) Extracellular production of the protein in strain D15-ChlE16 over time. CGA activity ({blacktriangleup}) and mycelial dry weight (•) are shown. (A2) SDS-PAGE analysis of the culture medium (lane 1), the purified protein (lane 2), and the deglycosylated protein (lane 3) with approximately 20 µg of loaded proteins. Proteins were stained with Coomassie blue. (A3) Purification of CGA hydrolase. Effects of temperature (B1) and pH (B2) on the activity of the purified protein. Various temperatures (37°C to 75°C) and pH values (3.85 to 8.55) were tested under standard conditions. The pH tests used a 100 mM citrate-phosphate buffer for activity assay. Effects of temperature (B3) and pH (B4) on the stability of the purified protein. The selected temperatures were 37°C ({blacklozenge}), 45°C ({blacksquare}), 50°C ({blacktriangleup}), 60°C (+), and 65°C (•), and the selected pH values were 3.80 ({blacklozenge}), 4.75 (+), 6.85 ({blacksquare}), 7.85 (•), and 8.50 ({blacktriangleup}). All assays were performed with CGA as the substrate. IMAC, immobilized metal affinity chromatography.

Enzyme production and purification.
ChlE was purified by a one-step chromatographic strategy from 600 ml of recombinant strain D15-ChlE16 cultures grown under standard conditions. Growth was stopped on day 7 in order to avoid protein contamination due to cellular lysis or protein degradation due to protease secretion. The presence of a His-tagged sequence at the C-terminal end of the recombinant protein made it possible to purify ChlE on a chelating Sepharose fast-flow column. This chromatographic step led to the purification of 200 mg of ChlE with a recovery of 55% and a purification factor of 1.29 (Fig. 3A). The homogeneity of the protein was verified by SDS-PAGE, which showed one band corresponding to purified recombinant ChlE (Fig. 3A).

Biochemical and kinetic characterization of CGA hydrolase. (i) Molecular mass and isoelectric point.
The molecular mass of the monomer constituent was estimated to be around 80 kDa by SDS-PAGE. This value is in agreement with previous results (2). This measurement was confirmed by mass spectroscopy analysis, which indicated a molecular mass of 74,553 Da. In addition, the molecular mass of the native recombinant protein was estimated, after the calibration of a Superdex 200 column, to be around 250 to 300 kDa, indicating that the protein probably exists in a tetrameric form. The molecular mass of deglycosylated ChlE was verified by SDS-PAGE analysis to be approximately 55 kDa.

Analytical IEF of the protein clearly indicated the presence of at least eight bands between pHs 4.55 and 5.2. This result might be explained by the presence of multiple isoforms, as previously reported for recombinant feruloyl esterase B from A. niger (26).

(ii) N-terminal sequence.
In order to check whether recombinant ChlE was correctly processed, the first five amino acids of the recombinant protein were sequenced (DTNGE), showing that the N-terminal sequence perfectly matched that of the A. niger CIRM BRFM 131 CGA hydrolase.

(iii) Temperature and pH optima.
The temperature and pH optima were found to be 60°C and 6, respectively (Fig. 3B).

(iv) Temperature and pH stabilities.
Enzyme stability was studied at different incubation temperatures ranging from 37°C to 65°C (Fig. 3B). The recombinant protein was stable at 37°C for 90 min. Incubation for the same period of time at 45°C and 50°C led to 23% and 40% losses of activity, respectively. At 60°C, there was a 50% decrease in activity. At 65°C, ChlE was rapidly inactivated, since there was no longer activity after 20 min.

The enzyme was stable for 90 min over a pH range of 3.8 to 7.8 (Fig. 3B). At pH 8.5, there was a 75% decrease in stability after 90 min of incubation.

(v) Kinetic properties.
Purified ChlE obeyed Michaelis-Menten kinetics over the substrate concentration range used (5 to 75 µM). Km and Vmax values against CGA as the substrate were 6.5 µM and 250 nkat mg–1, respectively, as calculated from a Lineweaver-Burk plot. As for native CGA hydrolase, no activity could be detected against methyl esters of hydroxycinnamic acids.

Substrate specificity of CGA hydrolase.
To investigate the substrate specificity of ChlE, a set of typical model compounds for cinnamoyl esterase and lipase activities were tested (Fig. 4). Besides CGA, which is the substrate used to screen for ChlE activity, another quinic ester derivative, 5-O-p-coumaroyl quinic acid, and another caffeic ester derivative, rosmarinic acid, were assayed, but no activity could be detected on either substrate.


Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 4. Model substrates tested for esterase activity. The backbone of cinnamic acid is replaced with R1, R2, and R3. FA is O-[5-O-(trans-feruloyl)-{alpha}-L-Araf], and FAX is O-[5-O-(trans-feruloyl)-{alpha}-L-Araf]-(1->3)D-Xylp.

Assays were run on two naturally feruloylated oligosaccharides, i.e., O-[5-O-(trans-feruloyl)-{alpha}-L-Araf] and O-[5-O-(trans-feruloyl)-{alpha}-L-Araf]-(1->3)D-Xylp, classically used to check cinnamoyl esterase activities, and no activity could be detected for either one.

ChlE was assayed for acetylcholine esterase activity on acetylthiocholine and butyrylthiocholine and for lipase activity on short-chain vinyl esters (vinyl acetate, propionate, and butyrate) and triacylglycerols (triacetin, tripropionin, and tributyrin). ChlE displayed no detectable activity on any of these substrates.

Enzymatic hydrolysis of natural substrates.
Studies were conducted on the efficiency with which purified recombinant ChlE releases caffeic acid from CGA contained in natural substrates such as apple marc and coffee pulp. After overnight incubation, 100% of the initial CGA was hydrolyzed with a concomitant release of caffeic acid.

Sequence analysis.
BLAST searches against a nonredundant database revealed that ChlE shows sequence similarity (e values in the 10 to 80 range) to fungal carboxylesterase and cholinesterase, which showed 41% and 35% sequence identity, respectively. Moreover, BLAST searches against the Protein Data Bank identified mouse acetylcholinesterase as the closest structural homolog, with a sequence identity of 36%. These observations indicate that ChlE may represent a new member of the {alpha}/ß hydrolase fold family. Indeed, a sequence alignment of ChlE and two other members of this family (EstA and AChE; Fig. 5) for which a crystal structure is available revealed the locations of functional regions within ChlE, i.e., (i) a catalytic triad made of Ser204, Glu325, and His390 that was confirmed by the predicted structural model (Fig. 6) (His401 was discarded because of its distance from Ser204 and Glu325) and (ii) an acyl pocket lined with small aliphatic side chains consistent with the large size of the caffeic acid leaving group (Fig. 5). In addition, nine N-glycosylation sites were predicted following the consensus sequence (Asn-Xaa-Ser/Thr) and six potential sites are predicted to occur within surface loop regions (amino acid positions 21, 54, 72, 302, 365, and 448) (Fig. 6).


Figure 5
View larger version (50K):
[in this window]
[in a new window]

 
FIG. 5. Sequence alignment of ChlE with the fungal esterase EstA and mouse esterase AChE. Asterisks denote residues of the catalytic triad, solid circles indicate residues of the acyl pocket, and solid triangles indicate the potentially glycosylated amino acids. The secondary structural elements of EstA (PDB accession no. 1UKC) are indicated above the sequences.


Figure 6
View larger version (65K):
[in this window]
[in a new window]

 
FIG. 6. Overall view of the predicted structure of ChlE. The image was generated with PyMOL (DeLano Scientific, San Carlos, CA). The ribbon diagram shows the 11 central stranded ß sheets in blue and the surrounding {alpha} helix in brown. The hypothetical Asn-linked glycan moieties are displayed in purple. The catalytic triad residues are displayed in red at the center of the ChlE molecule. term, terminus.


arrow
DISCUSSION
 
To our knowledge, this is the first work to describe the cloning, characterization, and overexpression of a gene that encodes a CGA hydrolase. This study also focused on the physical-chemical and biochemical characterization of the recombinant protein in order to study the potential of this enzyme for biotechnological applications. The gene that encodes ChlE was cloned from A. niger CIRM BRFM 131 and consists of an ORF of 1,715 bp with a G+C content of 52.5%, i.e., less rich in G+C than highly expressed genes from A. niger such as that for glucoamylase (glaA) at 59% (22) or that for glyceraldehyde-3-phosphate-dehydrogenase (gdpA) at 70% (33). For comparison with the cinnamoyl esterases, the genes that encode FaeA and FaeB have G+C contents of 52.5% and 56.4%, respectively. The gene that encodes ChlE is interrupted by three introns, while the faeA and faeB genes contain only one intron. In an attempt to estimate the number of genes that encode ChlE, a Southern blot analysis of the genomic DNA from A. niger was performed with a set of restriction enzymes. All of the restriction profiles used in experimental analysis were found to be consistent with the theoretical profile expected from the chlE gene, suggesting that only one gene codes for ChlE. In addition, a Northern blot analysis was also performed on days 7 and 9 of growth and a unique band was observed on the blot (data not shown). This result indicates that the gene is functional under a medium containing an inducer such as SBP. The protein deduced from the four exons contains 512 amino acids with a predicted signal peptide of 18 amino acids, and then an extra sequence of 8 amino acids follows just before the mature protein.

For ChlE production, the leader peptide of 26 amino acids was conserved to target protein secretion and the gene was expressed in A. niger D15#26. The activities of the various transformants were measured with CGA, and a clone producing high levels of CGA hydrolase activity (140 nkat ml–1 after 13 days of growth) was isolated. Its production level was estimated to be at least 300-fold higher than that of wild-type strain A. niger BRFM CIRM 131 grown on SBP (2). The copy number of the expression vectors integrated into the genome was estimated to be around six copies. Considering the specific activity of the purified protein, ChlE production was estimated to reach 1.25 g liter–1. This result is in good agreement with other results from homologous overexpression studies. For example, homologous overproduction of FAEA in A. niger was estimated at 1 g liter–1 (35), and that of FAEB was 100 mg liter–1 (26), with their own signal peptide. FAEA was also produced in Pichia pastoris (23) at up to 300 mg liter–1. FAEC from Talaromyces stipitatus was also produced in P. pastoris, and the secretion yield was within the 200-to-300-mg ml–1 range, depending on the nature of the signal peptide used (17).

SDS-PAGE analysis of the culture supernatant revealed the presence of a major secreted protein of approximately 80 kDa. The purified ChlE protein was characterized, and the properties of the recombinant protein are close to those obtained from the CGA hydrolase of the wild-type strain. They were identical with respect to molecular mass, i.e., 80,000 Da and 74,553 Da, as found by SDS-PAGE and mass spectrometry analysis, respectively. The chlE gene encodes a mature protein of 486 amino acids which corresponds to a calculated molecular mass of 52,514 Da. The protein contains nine putative N-glycosylation sites, of which six were found to be potentially glycosylated given their positions in the predicted structural model. Treatment of the mature protein with PNGase resulted in a protein of approximately 55 kDa, which is close to the calculated mass, indicating that the enzymatic deglycosylation was almost complete and that the oligosaccharides are mainly N linked. IEF analysis of the mature protein indicated the presence of numerous bands ranging from pI 4.55 to 5.2, while for the previously described CGA hydrolase only one band of pI 6.0 was detected. Interestingly, after ChlE deglycosylation, only one major band was detected with a higher pI of 5.9. This result confirms that the different forms correspond to different glycosylated forms. Similar results have previously been reported for other proteins such as esterases from the brown planthopper Nilaparvata lugens (42). In this organism, the five esterase isoenzymes resolved by IEF were reduced to only two forms after deglycosylation, also with a significant increase in pI. Similar results were described for an endoglucanase from Trichoderma reesei (21). As far as protein overproduction is concerned, the glycosylation processing machinery may be more or less modified simply because of the increased protein flux through the secretion pathway (14, 30). Some of the glycosylation processing steps may have their regulation altered. Polymorphic characteristics may be due to differential attachment of N-linked glycans and could explain the differences observed between recombinant ChlE and the CGA hydrolase from the wild-type strain. In addition, the native form of ChlE was suggested to exist in a tetrameric form, as has been found for the CGA esterase (39, 41). On the basis of previously reported results (2), it was suggested that the 160-kDa protein exists in a dimeric form. The 300-fold overproduction of ChlE in A. niger D15#26 compared to the wild-type strain could result in a slightly different maturation process, especially in terms of the final oligomerization (31).

Other characteristics of the recombinant protein, in particular, temperature and pH optima, are quite similar to those of the CGA hydrolase from A. niger CIRM BRFM 131. There was, however, a significant difference in the thermostability of the protein, with the recombinant protein being more thermostable. Indeed, the native protein was completely inactivated by 10 min of incubation at 55°C while the recombinant protein conserved half of its activity after 90 min at 60°C. This difference could be explained by the higher degree of glycosylation of the recombinant protein. Previous work conducted on different enzymes suggested a probable role for the carbohydrate moiety in stabilizing the three-dimensional structure of the enzyme, making it more resistant to different denaturants such as high temperatures (10, 46). A recent comparison of the structure of recombinant feruloyl esterase FAEA produced in A niger and recombinant FAEA produced in E. coli revealed that the sugar motif observed in the A. niger form had no influence on protein structure. Indeed, the two forms have identical three-dimensional structures, which is consistent with their identical kinetic properties. The main difference between the two proteins was the higher thermostability of the glycosylated form (5). Moreover, the shift in the oligomerization state from the native to the recombinant protein could be responsible for differences in thermostability. In addition, in some cases, the histidine tag was shown to alter the enzymatic properties of the recombinant protein (37).

In order to better understand the specificity of ChlE, different kinds of substrates were used in order to evaluate the respective importance of the different partners of the ester linkage. With these substrates, we examined different substrate specificities as follows: (i) specificity for hydroxylated cinnamic acids esterified to quinic acid with p-coumaroyl-quinic acid naturally extracted from cider; (ii) specificity for methoxylated aromatic substrates similar to ferulic acid esterified to methanol or sugars with ferulic acid methyl ester, O-[5-O-(trans-feruloyl)-{alpha}-L-Araf], and O-[5-O-(trans-feruloyl)-{alpha}-L-Araf]-(1->3)D-Xylp; and (iii) specificity for substrates conventionally used for esterases and lipase, such as short-chain vinyl esters and various triacylglycerols.

None of these substrates was efficiently used by the CGA hydrolase, indicating that the specificity of this enzyme is particularly high. Schöbel and Pollmann (41) examined the activity of the CGA hydrolase with a range of substrates specific to a tannase and a carboxylesterase from pig liver but were unable to detect any activity. There are only a few literature reports focusing on the activity on CGA, where catalytic efficiency was evaluated as kcat/Km, i.e., 0.25 x 106 M–1 s–1 for A. niger FAEB (6) and 0.29 x 106 M–1 s–1 for the type B feruloyl esterase from Neurospora crassa. ChlE exhibits a 40-fold higher catalytic efficiency (12.5 x 106 M–1 s–1 toward CGA) than these proteins, and its ability to release caffeic acid from CGA of agricultural by-products such as apple marc and coffee pulp was clearly demonstrated, thus confirming the high potential of this enzyme in biological applications. Several studies have demonstrated that esterified caffeic acid, as for CGA, shows markedly reduced absorption properties (27); in this context, ChlE should prove an interesting biotechnological tool.


arrow
ACKNOWLEDGMENTS
 
This research was supported by a Ph.D. grant from the Conseil Régional Provence Côte d'Azur, France; by Tembec S.A. France; and by European Integrated Project no. 019882 (New Improvements for Lignocellulosic Ethanol).

We thank Pascale Marchot for help with the kinetic assays, Christophe Flaudrops for mass spectroscopy measurements, and DSM for providing the A. niger strain CBS 513.88 genome sequence.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: UMR 1163 INRA/Université de Provence de Biotechnologie des Champignons Filamenteux, IFR-IBAIM, Universités de Provence et de la Méditerranée, ESIL, 163 avenue de Luminy, Case Postale 925, 13288 Marseille Cedex 09, France. Phone: 33 (0)4 91 82 86 07. Fax: 33 (0)4 91 82 86 01. E-mail: eric.record{at}esil.univmed.fr Back

{triangledown} Published ahead of print on 13 July 2007. Back


arrow
REFERENCES
 
    1
  1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  2. 2
  3. Asther, M., M. I. Estrada Alvarado, M. Haon, D. Navarro, M. Asther, L. Lesage-Meessen, and E. Record. 2005. Purification and characterization of a chlorogenic acid hydrolase from Aspergillus niger catalysing the hydrolysis of chlorogenic acid. J. Biotechnol. 115:47-56.[CrossRef][Medline]
  4. 3
  5. Barbe, C., and D. Dubourdieu. 1998. Characterization and purification of a cinnamate esterase from Aspergillus niger industrial pectinase preparation. J. Sci. Food Agric. 78:471-478.[CrossRef]
  6. 4
  7. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340:783-795.[CrossRef][Medline]
  8. 5
  9. Benoit, I., M. Asther, G. Sulzenbacher, E. Record, L. Marmuse, G. Parsiegla, I. Gimbert, M. Asther, and C. Bignon. 2006. Respective importance of protein folding and glycosylation in the thermal stability of recombinant feruloyl esterase. FEBS Lett. 580:5815-5821.[CrossRef][Medline]
  10. 6
  11. Benoit, I., D. Navarro, N. Marnet, N. Rakotomanomana, L. Lesage-Meessen, J.-C. Sigoillot, M. Asther, and M. Asther. 2006. Feruloyl esterase as a tool for the release of phenolic compounds from agro-industrial by-products. Carbohydr. Res. 341:1820-1827.[CrossRef][Medline]
  12. 7
  13. Bourne, Y., A. A. Hasper, H. Chahinian, M. Juin, L. H. de Graaff, and P. Marchot. 2004. Aspergillus niger protein EstA defines a new class of fungal esterases within the alpha/beta hydrolase fold superfamily of proteins. Structure 12:677-687.[Medline]
  14. 8
  15. Chahinian, H., L. Nini, E. Boitard, J. P. Dubes, L. Sarda, and L. C. Comeau. 2000. Kinetic properties of Penicillium cyclopium lipases studied with vinyl esters. Lipids 35:919-925.[CrossRef][Medline]
  16. 9
  17. Chen, J. H., and C. T. Ho. 1997. Antioxidant activities of caffeic acid and its related hydroxycinnamic acid compounds. J. Agric. Food Chem. 45:2374-2378.[CrossRef]
  18. 10
  19. Chu, F. K., R. B. Trimble, and F. Maley. 1978. The effect of carbohydrate depletion on the properties of yeast external invertase. J. Biol. Chem. 253:8691-8693.[Free Full Text]
  20. 11
  21. Clifford, M. N. 1999. Chlorogenic acids and other cinnamates—nature, occurrence and dietary burden. J. Sci. Food Agric. 79:362-372.[CrossRef]
  22. 12
  23. Clifford, M. N. 2000. Chlorogenic acids and other cinnamates—nature, occurrence, dietary burden, absorption and metabolism. J. Sci. Food Agric. 80:1033-1043.[CrossRef]
  24. 13
  25. Colquhoun, I. J., M.-C. Ralet, J.-F. Thibault, C. B. Faulds, and G. Williamson. 1994. Structure identification of feruloylated oligosaccharides from sugar-beet pulp by NMR spectroscopy. Carbohydr. Res. 263:243-256.[CrossRef][Medline]
  26. 14
  27. Conesa, A., P. J. Punt, N. van Luijk, and C. A. van den Hondel. 2001. The secretion pathway in filamentous fungi: a biotechnological view. Fungal Genet. Biol. 33:155-171.[CrossRef][Medline]
  28. 15
  29. Couteau, D., A. L. McCartney, G. R. Gibson, G. Williamson, and C. B. Faulds. 2001. Isolation and characterization of human bacteria able to hydrolyse chlorogenic acid. J. Appl. Microbiol. 90:873-881.[CrossRef][Medline]
  30. 16
  31. Crepin, V. F., C. B. Faulds, and I. F. Connerton. 2004. Functional classification of the microbial feruloyl esterases. Appl. Microbiol. Biotechnol. 63:647-652.[CrossRef][Medline]
  32. 17
  33. Crepin, V. F., C. B. Faulds, and I. F. Connerton. 2003. A non-modular type B feruloyl esterase from Neurospora crassa exhibits concentration-dependent substrate inhibition. Biochem. J. 370:417-427.[CrossRef][Medline]
  34. 18
  35. de Vries, R. P., B. Michelsen, C. H. Poulsen, P. A. Kroon, R. H. H. van den Heuvel, C. B. Faulds, G. Williamson, J. P. T. W. van den Homberg, and J. Visser. 1997. The faeA genes from Aspergillus niger and Aspergillus tubingensis encode ferulic acid esterases involved in degradation of complex cell wall polysaccharides. Appl. Environ. Microbiol. 63:4638-4644.[Abstract]
  36. 19
  37. de Vries, R. P., P. A. VanKuyk, H. C. M. Kester, and J. Visser. 2002. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds. Biochem. J. 363:377-386.[CrossRef][Medline]
  38. 20
  39. Faulds, C. B., and G. Williamson. 1994. Purification and characterization of a ferulic acid esterase (FAE-III) from Aspergillus niger specificity for the phenolic moiety and binding to microcrystalline cellulose. Microbiology 140:779-787.[Abstract/Free Full Text]
  40. 21
  41. Garcia, R., J. A. Cremata, O. Quintero, R. Montesino, K. Benkestock, and J. Stahlberg. 2001. Characterization of protein glycoforms with N-linked neutral and phosphorylated oligosaccharides: studies on the glycosylation of endoglucanase 1 (Cel7B) from Trichoderma reesei. Biotechnol. Appl. Biochem. 33:141-152.[CrossRef][Medline]
  42. 22
  43. Hata, Y., K. Tsuchiya, K. Kitamoto, K. Gomi, C. Kumagai, G. Tamura, and S. Hara. 1991. Nucleotide sequence and expression of the glucoamylase-encoding gene (glaA) from Aspergillus oryzae. Gene 108:145-150.[CrossRef][Medline]
  44. 23
  45. Juge, N., G. Williamson, A. Puigserver, N. J. Cummings, I. F. Connerton, and C. B. Faulds. 2001. High-level production of recombinant Aspergillus niger cinnamoyl esterase (FAEA) in the methylotrophic yeast Pichia pastoris. FEMS Yeast Res. 1:127-132.[CrossRef][Medline]
  46. 24
  47. Kroon, P. A., C. B. Faulds, and G. Williamson. 1996. Purification and characterization of a novel esterase induced by growth of Aspergillus niger on sugar-beet pulp. Biotechnol. Appl. Biochem. 23:255-262.
  48. 25
  49. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
  50. 26
  51. Levasseur, A., I. Benoit, M. Asther, M. Asther, and E. Record. 2004. Homologous expression of the feruloyl esterase B gene from Aspergillus niger and characterization of the recombinant enzyme. Protein Expr. Purif. 37:126-133.[CrossRef][Medline]
  52. 27
  53. Mateos, R., L. Goya, and L. Bravo. 2006. Uptake and metabolism of hydroxycinnamic acids (chlorogenic, caffeic, ferulic acids) by HepG2 cells as a model of the human liver. J. Agric. Food Chem. 54:8724-8732.[CrossRef][Medline]
  54. 28
  55. Okamura, S., and M. Watanabe. 1982. Purification and properties of hydroxycinnamic ester hydrolase from Aspergillus japonicus. Agric. Biol. Chem. 46:1839-1848.
  56. 29
  57. Pel, H. J., J. H. de Winde, D. B. Archer, P. S. Dyer, G. Hofmann, P. J. Schaap, G. Turner, R. P. de Vries, R. Albang, K. Albermann, M. R. Andersen, J. D. Bendtsen, J. A. E. Benen, M. van den Berg, S. Breestraat, M. X. Caddick, R. Contreras, M. Cornell, P. M. Coutinho, E. G. J. Danchin, A. J. M. Debets, P. Dekker, P. W. M. van Dijck, A. van Dijk, L. Dijkhuizen, A. J. M. Driessen, C. d'Enfert, S. Geysens, C. Goosen, G. S. P. Groot, P. W. J. de Groot, T. Guillemette, B. Henrissat, M. Herweijer, J. P. T. W. van den Hombergh, C. A. M. J. J. van den Hondel, R. T. J. M. van der Heijden, R. M. van der Kaaij, F. M. Klis, H. J. Kools, C. P. Kubicek, P. A. van Kuyk, J. Lauber, X. Lu, M. J. E. C. van der Maarel, R. Meulenberg, H. Menke, A. M. Mortimer, J. Nielsen, S. G. Oliver, M. Olsthoorn, K. Pal, N. N. M. E. van Peij, A. F. J. Ram, U. Rinas, J. A. Roubos, C. M. J. Sagt, M. Schmoll, J. Sun, D. Ussery, J. Varga, W. Vervecken, P. J. I. van de Vondervoort, H. Wedler, H. A. B. Wösten, A.-P. Zeng, A. J. J. van Ooyen, J. Visser, and H. Stam. 2007. Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88. Nat. Biotechnol. 25:221-231.[CrossRef][Medline]
  58. 30
  59. Punt, P. J., M. A. Dingemanse, B. J. M. Jacobs-Meijsing, P. H. Pouwels, and C. A. M. J. J. van den Hondel. 1988. Isolation and characterization of the glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. Gene 69:49-57.[CrossRef][Medline]
  60. 31
  61. Punt, P. J., N. van Biezen, A. Conesa, A. Albers, J. Mangnus, and C. van den Hondel. 2002. Filamentous fungi as cell factories for heterologous protein production. Trends Biotechnol. 20:200-206.[CrossRef][Medline]
  62. 32
  63. Punt, P. J., and C. A. van den Hondel. 1992. Transformation of filamentous fungi based on hygromycin B and phleomycin resistance markers. Methods Enzymol. 216:447-457.[Medline]
  64. 33
  65. Punt, P. J., I. A. van Gemeren, J. Drint-Kuijvenhoven, J. G. Hessing, G. M. van Muijlwijk-Harteveld, A. Beijersbergen, C. T. Verrips, and C. A. van den Hondel. 1998. Analysis of the role of the gene bipA, encoding the major endoplasmic reticulum chaperone protein in the secretion of homologous and heterologous proteins in black Aspergilli. Appl. Microbiol. Biotechnol. 50:447-454.[CrossRef][Medline]
  66. 34
  67. Ralet, M. C., C. B. Faulds, G. Williamson, and J. F. Thibault. 1994. Degradation of feruloylated oligosaccharides from sugar-beet pulp and wheat bran by ferulic acid esterases from Aspergillus niger. Carbohydr. Res. 263:257-269.[CrossRef][Medline]
  68. 35
  69. Record, E., M. Asther, C. Sigoillot, S. Pagès, P. J. Punt, M. Delattre, M. Haon, C. A. M. J. J. van den Hondel, J. C. Sigoillot, L. Lesage-Meessen, and M. Asther. 2003. Overproduction of the Aspergillus niger feruloyl esterase for pulp bleaching application. Appl. Microbiol. Biotechnol. 62:349-355.[CrossRef][Medline]
  70. 36
  71. Rice-Evans, C. A., N. J. Miller, and G. Paganga. 1996. Structure-antioxidant activity relationships of flavonoids and phenolic acids. Free Radic. Biol. Med. 20:933-956.[CrossRef][Medline]
  72. 37
  73. Rumlová, M., J. Benedikova, R. Cubinkova, I. Pichova, and T. Ruml. 2001. Comparison of classical and affinity purification techniques of Mason-Pfizer monkey virus capsid protein: the alteration of the product by an affinity tag. Protein Expr. Purif. 23:75-83.[CrossRef][Medline]
  74. 38
  75. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, p. 7.43-7.45. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  76. 39
  77. Saulnier, L., C. Marot, M. Elgorriaga, E. Bonnin, and J. F. Thibault. 2001. Thermal and enzymatic treatments for the release of free ferulic acid from maize bran. Carbohydr. Polym. 45:269-275.[CrossRef]
  78. 40
  79. Schöbel, B., and W. Pollmann. 1980. Isolation and characterization of a chlorogenic acid esterase from Aspergillus niger. Z. Naturforsch. 35c:209-212.
  80. 41
  81. Schöbel, B., and W. Pollmann. 1980. Further characterization of a chlorogenic acid hydrolase from Aspergillus niger. Z. Naturforsch. 35c:699-701.
  82. 42
  83. Small, G. J., and J. Hemingway. 2000. Differential glycosylation produces heterogeneity in elevated esterases associated with insecticide resistance in the brown planthopper Nilaparvata lugens Stal. Insect Biochem. Mol. Biol. 30:443-453.[CrossRef][Medline]
  84. 43
  85. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
  86. 44
  87. van Hartingsveldt, W., I. E. Mattern, C. M. van Zeijl, P. H. Pouwells, and C. A. van den Hondel. 1987. Development of a homologous transformation system for Aspergillus niger based on the pyrG gene. Mol. Gen. Genet. 206:71-75.[CrossRef][Medline]
  88. 45
  89. Wong, D. W. 2006. Feruloyl esterase: a key enzyme in biomass degradation. Appl. Biochem. Biotechnol. 133:87-112.[CrossRef][Medline]
  90. 46
  91. Wyss, D. F., and G. Wagner. 1996. The structural role of sugars in glycoproteins. Curr. Opin. Biotechnol. 7:409-416.[CrossRef][Medline]


Applied and Environmental Microbiology, September 2007, p. 5624-5632, Vol. 73, No. 17
0099-2240/07/$08.00+0     doi:10.1128/AEM.00374-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Benoit, I.
Right arrow Articles by Record, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Benoit, I.
Right arrow Articles by Record, E.
Agricola
Right arrow Articles by Benoit, I.
Right arrow Articles by Record, E.