This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Froquet, R.
Right arrow Articles by Cosson, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Froquet, R.
Right arrow Articles by Cosson, P.
Agricola
Right arrow Articles by Froquet, R.
Right arrow Articles by Cosson, P.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, September 2007, p. 5657-5659, Vol. 73, No. 17
0099-2240/07/$08.00+0     doi:10.1128/AEM.00908-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Alternative Host Model To Evaluate Aeromonas Virulence{triangledown}

Romain Froquet,1 Nathalie Cherix,1 Sarah E. Burr,2 Joachim Frey,2 Silvia Vilches,3 Juan M. Tomas,3 and Pierre Cosson1*

Université de Genève, Centre Médical Universitaire, Département de Physiologie et Métabolisme Cellulaire, 1 rue Michel Servet, CH-1211 Genève 4, Switzerland,1 Institute of Veterinary Bacteriology, Universität Bern, Länggassstrasse 122, Postfach, CH-3001 Berne, Switzerland,2 Departamento de Microbiologia, Facultad de Biologia, Universidad de Barcelona, Diagonal 645, 08071 Barcelona, Spain3

Received 23 April 2007/ Accepted 26 June 2007


arrow
ABSTRACT
 
Bacterial virulence can only be assessed by confronting bacteria with a host. Here, we present a new simple assay to evaluate Aeromonas virulence, making use of Dictyostelium amoebae as an alternative host model. This assay can be modulated to assess virulence of very different Aeromonas species.


arrow
INTRODUCTION
 
Bacterial virulence designates the complex array of bacterial traits that allow pathogenic bacteria to cause a disease in an infected host. Virulence factors include, for example, secreted bacterial toxins or the ability to escape the host immune system. By definition, the virulence of a given bacterial strain can only be measured by confronting it with a host. To assess the virulence of bacterial pathogens, mice are often used, based on the premise that their immune defenses are similar to those of the human body. These experiments are, however, difficult to carry out, expensive, and ethically problematic, since they inflict significant suffering on infected animals. In addition, mice are not appropriate hosts for certain pathogens such as Aeromonas salmonicida that normally infect cold-blooded vertebrates living at low temperatures. These considerations have led to the development of nonmammalian host models to study the pathogenic potential of bacteria.

Alternative hosts such as the nematode Caenorhabitis elegans and the insect Drosophila melanogaster or even unicellular Acanthamoeba castellanii or Dictyostelium discoideum ameobae have proven useful to study bacteria virulence (9, 10). The relevance of these models is based on the observation that many pathogens have a low species specificity, due to the universality of virulence factors implicated in the infectious process. It is also likely that these alternative hosts are naturally confronted with the same pathogens in their natural environment and that many of the bacterial virulence factors were developed to fight these natural predators (1).

The use of unicellular amoebae allows a very simple assessment of bacterial virulence in many different pathogens. In a typical experiment, Dictyostelium cells form a phagocytosis plaque on a lawn of nonpathogenic bacteria (Fig. 1A) but not on a lawn of pathogenic bacteria. The virulence of bacteria can thus be extrapolated from their ability to sustain Dictyostelium growth, as shown previously for Klebsiella pneumoniae (2) or Pseudomonas aeruginosa (6, 14). These previous studies also reported an excellent correlation between virulence as evaluated in a Dictyostelium host model and in a mouse infection model.


Figure 1
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 1. Virulence of Aeromonas salmonicida against Dictyostelium. (A) The ability of Dictyostelium to grow on a bacterial lawn was assessed as described previously (2) by depositing 1,000 wild-type Dictyostelium DH1-10 cells (5) on a lawn of bacteria grown on HL-5 agar medium. A phagocytosis plaque was observed 7 days later when bacteria were permissive (nonvirulent). (B) The wild-type virulent A. salmonicida strain (JF2267) did not allow growth of Dictyostelium, but T3SS-deficient strains (pVirA-negative strain JF2397 and {Delta}ascV strain JF2747) did. Complementation of {Delta}ascV mutant cells restored its virulent phenotype. The presence of the large virulence plasmid was systematically verified by PCR using the primers GCTGGTCATCTACATCAAGC and TAGTGTTCGAAGGCGTAGTC.

Assessing virulence of Aeromonas bacteria is challenging since different Aeromonas species (e.g., A. salmonicida and A. hydrophila) infect different hosts (fish, leeches, mice, and humans), have different growth requirements (e.g., low or high temperature), and cause very different diseases (furunculosis and septicemia in fish and wound infections, meningitis, pneumonia, gastroenteritis, and septicemia in humans). In addition, some strains of A. salmonicida lose their virulence at temperatures above 21°C, due to the thermolability of a large pVirA virulence plasmid (15). Fish can be used as hosts to evaluate virulence of A. salmonicida at low temperature, but this requires specific installations and poses significant practical problems, such as disposal of contaminated water.

In order to assess the virulence of A. salmonicida against Dictyostelium, we tested the ability of 1,000 Dictyostelium cells to grow at 17°C on a lawn of A. salmonicida (JF2267) grown on an HL-5 agar medium (12). This pathogenic strain was isolated from an arctic char with typical furunculosis (3) and was able to establish a systemic and lethal infection in rainbow trout (4). This virulent strain (Table 1) did not allow growth of Dictyostelium amoebae (Fig. 1B). On the contrary, the JF2397 strain has lost its large pVirA virulence plasmid, is incapable of synthesizing type III secretion system (T3SS) components (15), and was permissive for Dictyostelium growth (Fig. 1B). Similarly, the mutant strain JF2747 was shown previously to be nonvirulent for trout (4), due to the deletion of the ascV gene encoding an inner membrane component of the T3SS. This deletion renders that bacterium incapable of secreting T3SS toxins and effector molecules. This strain was also permissive for Dictyostelium growth (Fig. 1B). The virulence against Dictyostelium was restored by complementation with a plasmid expressing AscV (strain JF3239), which restores secretion of T3SS proteins (7) (Fig. 1B). Together, these results indicate that the T3SS-dependent virulence of A. salmonicida can be evaluated in a Dictyostelium host model.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Bacterial strains used in this study

We next tried to use the same assay to test the virulence of the mesophilic Aeromonas hydrophila strain serotype O34. Under the conditions described above, the wild-type A. hydrophila strain AH-3 was not permissive for Dictyostelium growth. However, the ascV T3SS mutant, which was shown to be avirulent in rainbow trout and mice (18), was nonpermissive (virulent) for Dictyostelium (Fig. 2A, 100% HL-5 agar). We then reasoned that slowing down the growth of bacteria might change the threshold at which a bacterial strain is permissive for Dictyostelium growth. To test this hypothesis, we reduced gradually the richness of the growth medium by diluting it. We observed that, at lower nutrient concentrations (medium diluted 10 times or more), the AH-3 wild-type strain remained nonpermissive, while the avirulent ascV mutant was permissive for Dictyostelium growth (Fig. 2A and B). This appears to be an empirical manner of adjusting the threshold at which virulence of a bacterial strain is detected.


Figure 2
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 2. Virulence of Aeromonas hydrophila against Dictyostelium can be modulated. (A) The ability of wild-type (WT) A. hydrophila (AH-3) and the isogenic T3SS-negative {Delta}ascV mutant was tested on HL-5 agar, pure or diluted, as described in the legend to Fig. 1. Only low concentrations of nutrients (10% HL5 agar or lower) allowed the detection of T3SS-dependent virulence of A. hydrophila. (B) More extensive analysis of the phenotypes shown in panel A. (C) Loss of virulence of the {Delta}ahyI and -R and {Delta}phoP mutants was also revealed in this assay (5% HL-5 agar).

In order to test whether under these newly defined conditions other virulence factors would also be in play, we tested a few other well-characterized A. hydrophila mutants in which potential virulence mechanisms distinct from the T3SS were affected. There are several very conserved pathways regulating virulence in many bacteria, in particular the quorum-sensing and the PhoP/PhoQ regulatory systems. Quorum sensing is a mechanism controlling gene expression in response to an expanding bacterial population and is essential for virulence of many gram-negative pathogens. In A. hydrophila, quorum sensing was shown in particular to control the production of exoproteases (17) and biofilm formation (11). The corresponding ahyI and ahyR mutants were permissive for growth of Dictyostelium (Fig. 2C). The two-component regulatory system involving PhoP (the transcriptional regulator) and PhoQ (the sensor kinase) transcriptionally controls some of the virulence determinants and is essential for virulence of Yersinia pestis (13) and Salmonella enterica serovar Typhimurium (8). Interestingly, an A. hydrophila phoP mutant also exhibited a loss of virulence against Dictyostelium (Fig. 2C). These results suggest that the Dictyostelium host model provides a meaningful assessment of bacterial virulence not restricted to T3SS-dependent cytotoxicity. More experiments will, however, be necessary to determine extensively which virulence traits can be assessed accurately in this Dictyostelium host model.

This study demonstrates that Dictyostelium can be used as a simple host model to assess the virulence of distinct Aeromonas species. It also describes an empirical method to adjust conditions in order to set the threshold of this assay for strains with very different growth requirements. This system could allow in the future a systematic analysis of Aeromonas virulence factors. Since Dictyostelium is amenable to genetic analysis, this system might also allow analysis of host resistance mechanisms.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grants from the Fonds National Suisse de la Recherche Scientifique to P.C., from the Plan Nacional de I + D and FIS (Ministerio de Educación, Ciencia y Deporte and Ministerio de Sanidad, Spain) to J.M.T., and from the Generalitat de Catalunya to S.V. The P.C. research group participates in the NEMO Network, supported by the 3R Foundation.

We thank Maite Polo for technical assistance.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Université de Genève, Centre Médical Universitaire, Département de Physiologie et Métabolisme Cellulaire, 1 rue Michel Servet, CH-1211 Genève 4, Switzerland. Phone: (41) 22 379 5293. Fax: (41) 22 379 5338. E-mail: Pierre.Cosson{at}medecine.unige.ch Back

{triangledown} Published ahead of print on 6 July 2007. Back


arrow
REFERENCES
 
    1
  1. Barker, J., and M. R. Brown. 1994. Trojan horses of the microbial world: protozoa and the survival of bacterial pathogens in the environment. Microbiology 140:1253-1259.[Free Full Text]
    2. 2
  2. Benghezal, M., M. O. Fauvarque, R. Tournebize, R. Froquet, A. Marchetti, E. Bergeret, B. Lardy, G. Klein, P. Sansonetti, S. J. Charette, and P. Cosson. 2006. Specific host genes required for the killing of Klebsiella bacteria by phagocytes. Cell. Microbiol. 8:139-148.[CrossRef][Medline]
    3. 3
  3. Braun, M., K. Stuber, Y. Schlatter, T. Wahli, P. Kuhnert, and J. Frey. 2002. Characterization of an ADP-ribosyltransferase toxin (AexT) from Aeromonas salmonicida subsp. salmonicida. J. Bacteriol. 184:1851-1858.[Abstract/Free Full Text]
    4. 4
  4. Burr, S. E., D. Pugovkin, T. Wahli, H. Segner, and J. Frey. 2005. Attenuated virulence of an Aeromonas salmonicida subsp. salmonicida type III secretion mutant in a rainbow trout model. Microbiology 151:2111-2118.[Abstract/Free Full Text]
    5. 5
  5. Cornillon, S., E. Pech, M. Benghezal, K. Ravanel, E. Gaynor, F. Letourneur, F. Bruckert, and P. Cosson. 2000. Phg1p is a nine-transmembrane protein superfamily member involved in dictyostelium adhesion and phagocytosis. J. Biol. Chem. 275:34287-34292.[Abstract/Free Full Text]
    6. 6
  6. Cosson, P., L. Zulianello, O. Join-Lambert, F. Faurisson, L. Gebbie, M. Benghezal, C. Van Delden, L. K. Curty, and T. Köhler. 2002. Pseudomonas aeruginosa virulence analyzed in a Dictyostelium discoideum host system. J. Bacteriol. 184:3027-3033.[Abstract/Free Full Text]
    7. 7
  7. Fehr, D., C. Casanova, A. Liverman, H. Blazkova, K. Orth, D. Dobbelaere, J. Frey, and S. E. Burr. 2006. AopP, a type III effector protein of Aeromonas salmonicida, inhibits the NF-kappaB signalling pathway. Microbiology 152:2809-2818.[Abstract/Free Full Text]
    8. 8
  8. Garcia Véscovi, E., F. C. Soncini, and E. A. Groisman. 1994. The role of the PhoP/PhoQ regulon in Salmonella virulence. Res. Microbiol. 145:473-480.[Medline]
    9. 9
  9. Goy, G., V. Thomas, K. Rimann, K. Jaton, G. Prod'hom, and G. Greub. 2007. The Neff strain of Acanthamoeba castellanii, a tool for testing the virulence of Mycobacterium kansasii. Res. Microbiol. 158:393-397.[Medline]
    10. 10
  10. Kurz, C. L., and J. J. Ewbank. 2007. Infection in a dish: high-throughput analyses of bacterial pathogenesis. Curr. Opin. Microbiol. 10:10-16.[CrossRef][Medline]
    11. 11
  11. Lynch, M. J., S. Swift, D. F. Kirke, C. W. Keevil, C. E. Dodd, and P. Williams. 2002. The regulation of biofilm development by quorum sensing in Aeromonas hydrophila. Environ. Microbiol. 4:18-28.[CrossRef][Medline]
    12. 12
  12. Mercanti, V., S. J. Charette, N. Bennett, J. J. Ryckewaert, F. Letourneur, and P. Cosson. 2006. Selective membrane exclusion in phagocytic and macropinocytic cups. J. Cell Sci. 119:4079-4087.[Abstract/Free Full Text]
    13. 13
  13. Oyston, P. C. F., N. Dorrell, K. Williams, S.-R. Li, M. Green, R. W. Titball, and B. W. Wren. 2000. The response regulator PhoP is important for survival under conditions of macrophage-induced stress and virulence in Yersinia pestis. Infect. Immun. 68:3419-3425.[Abstract/Free Full Text]
    14. 14
  14. Pukatzki, S., R. H. Kessin, and J. J. Mekalanos. 2002. The human pathogen Pseudomonas aeruginosa utilizes conserved virulence pathways to infect the social amoeba Dictyostelium discoideum. Proc. Natl. Acad. Sci. USA 99:3159-3164.[Abstract/Free Full Text]
    15. 15
  15. Stuber, K., S. E. Burr, M. Braun, T. Wahli, and J. Frey. 2003. Type III secretion genes in Aeromonas salmonicida subsp. salmonicida are located on a large thermolabile virulence plasmid. J. Clin. Microbiol. 41:3854-3856.[Abstract/Free Full Text]
    16. 16
  16. Swift, S., A. V. Karlyshev, L. Fish, E. L. Durant, M. K. Winson, S. R. Chhabra, P. Williams, S. Macintyre, and G. S. A. B. Stewart. 1997. Quorum sensing in Aeromonas hydrophila and Aeromonas salmonicida: identification of the LuxRI homologs AhyRI and AsaRI and their cognate N-acylhomoserine lactone signal molecules. J. Bacteriol. 179:5271-5281.[Abstract/Free Full Text]
    17. 17
  17. Swift, S., M. J. Lynch, L. Fish, D. F. Kirke, J. M. Tomás, G. S. A. B. Stewart, and P. Williams. 1999. Quorum sensing-dependent regulation and blockade of exoprotease production in Aeromonas hydrophila. Infect. Immun. 67:5192-5199.[Abstract/Free Full Text]
    18. 18
  18. Vilches, S., C. Urgell, S. Merino, M. R. Chacón, L. Soler, G. Castro-Escarpulli, M. J. Figueras, and J. M. Tomás. 2004. Complete type III secretion system of a mesophilic Aeromonas hydrophila strain. Appl. Environ. Microbiol. 70:6914-6919.[Abstract/Free Full Text]

Applied and Environmental Microbiology, September 2007, p. 5657-5659, Vol. 73, No. 17
0099-2240/07/$08.00+0     doi:10.1128/AEM.00908-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Arya, R., Bhattacharya, A., Saini, K. S. (2008). Dictyostelium discoideum--a promising expression system for the production of eukaryotic proteins. FASEB J. 22: 4055-4066 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Froquet, R.
Right arrow Articles by Cosson, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Froquet, R.
Right arrow Articles by Cosson, P.
Agricola
Right arrow Articles by Froquet, R.
Right arrow Articles by Cosson, P.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»