Novel Role for Aeromonas jandaei as a Digestive Tract Symbiont of the North American Medicinal Leech

The gut bacteria of the North American medicinal leech, Macrobdelladecora, were characterized. Biochemical tests and DNA sequencesindicated that Aeromonas jandaei is the dominant culturablesymbiont in leeches from a broad geographic area. In this workwe identified a new habitat for A. jandaei, and here we suggestthat there is unexpected specificity between leeches and Aeromonasspecies.

INTRODUCTION

Top

Introduction

Symbiotic bacteria of leeches recently have been the subjectof studies to determine both the specific identities of microbesand the nature of the symbiotic relationships (9). A particularlyinteresting model symbiosis is the symbiosis between Europeanmedicinal leeches and their gut symbiont, Aeromonas veroniibiovar sobria (8, 9), which was once considered a unique species,Pseudomonas hirudinis (4). A. veronii biovar sobria is the singlecultured symbiont with clinical significance residing in thecrop of the digestive tract with an uncultured member of theBacteroidetes (30). It is unclear how widespread Aeromonas speciesare in the guts of different leech species.

The potential for aeromonad infections due to postoperativeleech use was quickly recognized (29), and concern for appropriateprophylaxis with third-generation cephalosporins soon followedthis recognition (11). Meanwhile, following the use of medicinalleeches, the digestive tract symbiont has been implicated incellulitis and loss of replanted tissue (7, 15), as well assepticemia and meningitis (6, 19). The incidence of such infectionscan be reduced by preemptive antibiotic treatment.

European medicinal leeches in the genus Hirudo are not the onlyleeches being used for the relief of venous congestion. In Asia,Hirudinaria manillensis is more commonly encountered, whereasAliolimnatis michaelseni is the leech of choice in South Africa(2, 27). The dominant gut symbiont of leeches was reported byMackay et al. to be Aeromonas caviae, not A. veronii biovarsobria (16), but considering the difficulty of accurately identifyingenvironmental Aeromonas isolates to the species level with biochemicaltests, this result should be considered preliminary. Here, weinvestigated the aeromonad gut flora of the common North Americanmedicinal leech, Macrobdella decora, a species often encounteredin freshwater environments by swimmers and anglers across NorthAmerica (14).

Isolates.

Top

Isolates.

Leeches (M. decora) were collected from four localities usingthe traditional method of wading into water bare legged andretrieving them either with a dip net as they approached orafter they attached to bare skin but prior to the onset of bloodfeeding. These localities were Broadwing Lake, Ontario, Canada(45°35'50"N, 78°31'42"W); Douglas Lake, MI (45°34'49"N, 84°40'12"W); a pond in Storrs, CT (41°49'2.80"N,72°15'32.12"W); and Horseshoe Pond in Chester, VT (43°14'19.27"N,72 34'22.39"W). European medicinal leeches were obtained fromLeechesUSA (Westbury, NY). Leeches were rinsed with distilledwater and washed with bleach. A longitudinal incision was madein the ventral surface, and intraluminal fluid of the crop wascollected and serially diluted in saline (0.85% NaCl). Intraluminalfluid dilutions were streaked onto sheep blood agar (Becton-Dickinson,Sparks, MD) using sterile swabs and incubated aerobically at30°C. Multiple colonies were subcultured on blood agar forisolation.

Amplification, sequencing, and phylogenetic analyses.

Top

Amplification, sequencing, and...

DNA was isolated from luminal contents of the crop ceca of leechesusing a DNeasy tissue kit (QIAGEN Inc., Valencia, CA). A portionof the 16S rRNA gene was amplified using universal primers AGAGTTTGATCCTGGCTCAGand ATTACCGCGGCTGCTGGC and a cycling program consisting of 94°Cfor 4 min and then 35 cycles of 94°C for 15 s, 57°Cfor 15 s, and 72°C for 30 s, followed by 72°C for 7min. A portion of the gyrB locus was amplified using specificprimers TGTTGCTGACCATTCGTCGTAAC and TTGGCATCGCTCGGGTTTTC anda cycling program consisting of 94°C for 4 min and then35 cycles of 94°C for 15 s, 50°C for 15 s, and 72°Cfor 30 s, followed by 72°C for 7 min. For all amplificationswe used Ready-To-Go PCR beads (Amersham Pharmacia Biotech, Piscataway,NJ), 0.5 µl of each primer at a concentration of 10 µM,1 µl DNA template, and 23 µl RNase-free H₂O. Productswere sequenced in both directions. Each sequencing reactionmixture contained 1 µl BigDye (Applied Biosystems, Perkin-ElmerCorporation), 1 µl of primer at a concentration of 1 µM(a single primer was used for each direction), and 3 µlof DNA template, and the reaction was performed by using 40cycles consisting of 96°C for 15 s, 50°C for 30 s, and60°C for 4 min. Sequences were purified by ethanol precipitationand electrophoresed in an ABI Prism 3730 sequencer (AppliedBiosystems). Sequences of complementary strands were editedand reconciled using CodonCode Aligner (CodonCode, Dedham, MA).In addition to sequences obtained from direct sequencing ofDNA from freshly collected specimens, gyrB data were obtainedfrom GenBank for taxa as described in previous analyses (25,31) and for three outgroup taxa. The gyrB sequences required12-nucleotide insertion/deletion sites. These sites correspondedto one amino acid insertion for Aeromonas simiae, another aminoacid insertion shared by nine Aeromonas species, and two aminoacid indels for only the outgroup taxa.

Parsimony analyses were conducted with PAUP* (26). ModelTest(21) suggested a GTR+I+ ${Gamma}$ nucleotide substitution model for gyrB.Maximum likelihood analyses were conducted with the separatedata sets using PhyML (10). The Bayesian method was employedwith MrBayes (12) for 1,000,000 generations (the last 500,000generations of which were used for clade credibility values).

Amplification of the 16S rRNA gene and gyrB generated sequencedfragments up to 603 and 717 bp long, respectively. PCR ampliconsobtained from M. decora were identical to each other at bothloci regardless of the geographic origin. The 16S rRNA genesof the isolates were identical to 16S rRNA gene of Aeromonasjandaei strain ATCC 49568 (GenBank accession no. X74678). ThegyrB sequence obtained from the crop contents of M. decora corroboratedthis identification by most closely matching the A. jandaeisequence (GenBank accession no. AJ868391). In contrast, thegyrB sequence obtained for isolates from European medicinalleeches most closely matched that obtained for A. veronii strainMTCC 3249 substrain SH (GenBank accession no. AY130993; originallydescribed as Aeromonas culicicola before more recent phylogeneticwork [22]).

Parsimony analysis of gyrB yielded one tree with a length of1,136 steps and a retention index of 0.591 (Fig. 1A). Maximumlikelihood analysis also generated a single tree with a log(L)value of –6397.199 for gyrB (Fig. 1B). Notably, the isolatesfrom M. decora grouped together with A. jandaei with high supportvalues in all analyses. As expected, the isolates from the Europeanmedicinal leech were identified as A. veronii.

View larger version (16K):
[in this window]
[in a new window]

FIG. 1. Results of phylogenetic analyses. (A) Tree with bootstrap support values resulting from parsimony analysis. (B) Tree with the highest likelihood, including both bootstrap support values (upper numbers at the nodes) and Bayesian clade credibility values (lower numbers at the nodes).

Phenotypic tests.

Top

Phenotypic tests.

Bacteria were successfully cultured from two M. decora individuals,and five isolates were characterized further using biochemicaltests as described previously (1, 8). Only colonies resemblingAeromonas colonies were observed after 48 h. The sensitivitiesof three isolates to antibiotics were evaluated using Sensi-Discs(Becton-Dickinson and Company, Sparks, MD). All isolates weresensitive to cefotaxime (30 µg), cefuroxime (30 µg),chloramphenicol (30 µg), ciprofloxacin (5 µg), gentamicin(10 µg), nalidixic acid (30 µg), and trimethoprim-sulfamethoxazole(1.25/23.75 µg). One of the isolates was resistant tocephalothin (30 µg), and another isolate exhibited intermediateresistance, indicating that cephalothins are not an appropriatechoice for antibiotic therapy. The results of biochemical testsfor five isolates were identical. Consistent results (positiveor negative for >90% of colonies) favored identificationas either Aeromonas hydrophila, A. jandaei, or A. caviae (Table1). Overall, the inability to utilize citrate was shared onlywith Aeromonas eucrenophila. Overall, the failure to fermentsucrose was shared only with A. jandaei. Together, our dataare consistent with the hypothesis that A. jandaei is the dominantculturable symbiont of the North American medicinal leech.

View this table:
[in this window]
[in a new window]

TABLE 1. Biochemical tests distinguishing M. decora crop isolates from selected Aeromonas spp.

It seems remarkable that two ecologically similar leech speciescontain distinct Aeromonas species as the dominant culturablebacterial symbionts in the gut lumen, with consistency acrossthe geographic ranges of the leeches. Both A. jandaei and A.veronii are ubiquitous and global in terms of their known distributions(5, 28) and even have been found coinfecting the same wound(13). There seems to be little reason to contemplate that thereis a geographic or ecological barrier excluding either speciesof symbiont from either species of leech. Like the Europeanleech symbiont, A. jandaei has been implicated in several pathologicalcases, usually involving the exposure of wounds to a freshwaterenvironment (13, 23, 28), although its involvement is less commonthan the involvement of other aeromonads.

The phylogenetic results obtained here are in agreement (wheresupport values are strong) with those obtained previously forthis group of bacteria (25, 31). Whereas genetic and phylogeneticcharacterization of the gut symbiont of M. decora was clear,like the previous characterization of Aeromonas from Hirudospecies, the biochemical results did not agree unambiguouslywith the previously published biochemical results for any singleAeromonas species. Such difficulties in identifying environmentalAeromonas strains have been reported previously (18) and mayreflect the source of most of the characterized isolates orperhaps the possibility that a different subset of strains inhabitsleeches.

M. decora, although not yet used clinically, produces a usefulplatelet aggregation inhibitor, decorsin (24), and it belongsto an evolutionary lineage that is distinct from the Old Worldmedicinal leeches (3). Moreover, it is a widespread, commonlyencountered species in freshwater environments, where its typicalhosts, besides the occasional human, are frogs and fish. Differentspecies of Aeromonas have different susceptibilities to availableantimicrobial agents (17, 28). Notably, A. jandaei may be themost resistant species of Aeromonas both in terms of the extentof multiple-antibiotic resistance and in terms of the frequencywith which such resistance is found in clinical isolates (20).The spectrum of Aeromonas species dominating the gut lumen ofvarious leeches commonly encountered around the world deservescloser scrutiny, particularly for the leech species that areused locally for the relief of venous congestion or simple hematomas.

ACKNOWLEDGMENTS

This research was supported by grants from NSF (grant DEB 0119329)and NIH (grant NIGMS 5R01GM062351) to M.E.S. and by grant MCB0448052 from NSF to J.G.

FOOTNOTES

* Corresponding author. Mailing address: Division of Invertebrate Zoology, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024. Phone: (212) 769-5638. Fax: (212) 769-5277. E-mail: siddall{at}amnh.org.

Published ahead of print on 17 November 2006.

REFERENCES

Top