AEM
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Erratum for Matsuda et al., Appl. Environ. Microbiol. 73 (1) 32-39.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuda, K.
Right arrow Articles by Nomoto, K.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Matsuda, K.
Right arrow Articles by Nomoto, K.
Agricola
Right arrow Articles by Matsuda, K.
Right arrow Articles by Nomoto, K.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, October 2007, p. 6695, Vol. 73, No. 20
0099-2240/07/$08.00+0     doi:10.1128/AEM.01917-07

ERRATUM

Sensitive Quantitative Detection of Commensal Bacteria by rRNA-Targeted Reverse Transcription-PCR

Kazunori Matsuda, Hirokazu Tsuji, Takashi Asahara, Yukiko Kado, and Koji Nomoto

Yakult Central Institute for Microbiological Research, 1796 Yaho, Kunitachi, Tokyo 186-8650, Japan

Volume 73, no. 1, p. 32-39, 2007. Page 33, Table 1: "ATCC 14579T" should read "JCM 1465T."

Page 34, Table 2: The sequence for primer En-lsu3'R should read "TCAAGGACCAGTGTTCAGTGTC," the sequence for primer Ec-ssu1'F should read "CCCATCAGAAGGGGATAACACTT," and the sequence for primer Ec-ssu1R should read "ACCGCGGGTCCATCCATC."

Applied and Environmental Microbiology, October 2007, p. 6695, Vol. 73, No. 20
0099-2240/07/$08.00+0     doi:10.1128/AEM.01917-07





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuda, K.
Right arrow Articles by Nomoto, K.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Matsuda, K.
Right arrow Articles by Nomoto, K.
Agricola
Right arrow Articles by Matsuda, K.
Right arrow Articles by Nomoto, K.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Microbiol. Mol. Biol. Rev. Eukaryot. Cell All ASM Journals