Previous Article | Next Article 
Applied and Environmental Microbiology, November 2007, p. 7110-7113, Vol. 73, No. 21
0099-2240/07/$08.00+0 doi:10.1128/AEM.01108-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Quantification of Cell Proliferation and Alpha-Toxin Gene Expression of Clostridium perfringens in the Development of Necrotic Enteritis in Broiler Chickens
Weiduo Si,1,
Joshua Gong,1*
Yanming Han,2
Hai Yu,1
John Brennan,2
Huaijun Zhou,1,
and
Shu Chen3
Food Research Program, Agriculture & Agri-Food Canada, Guelph, Ontario, Canada N1G 5C9,1
Nutreco Canada Agresearch, Guelph, Ontario, Canada N1G 4T2,2
Laboratory Services Division, University of Guelph, Guelph, Ontario, Canada N1H 8JT3
Received 9 May 2007/
Accepted 26 August 2007

ABSTRACT
Cell proliferation and alpha-toxin gene expression of
Clostridium perfringens in relation to the development of necrotic enteritis
(NE) were investigated. Unlike bacitracin-treated chickens,
non-bacitracin-treated birds exhibited typical NE symptoms and
reduced growth performance. They also demonstrated increased
C. perfringens proliferation and alpha-toxin gene expression
that were positively correlated and progressed according to
the regression model
y =
b0 +
b1X –
b2X2. The average
C. perfringens count of 5 log
10 CFU/g in the ileal digesta appears
to be a threshold for developing NE with a lesion score of 2.

INTRODUCTION
Necrotic enteritis (NE) is an enteric disease in poultry caused
predominantly by
Clostridium perfringens type A strains and
to a lesser extent type C strains (
6,
13,
19). Type A strains
produce only alpha-toxin as the major toxin, and alpha- and
beta-toxins are the two major toxins produced by type C strains
(
19). The disease is thought to occur when a pathogenic strain
of
C. perfringens, which is normally part of intestinal microbiota,
overgrows in the small intestine and produces extracellular
toxins that damage the intestine (
9,
12,
18). NE can appear
in 2- to 5-week-old broilers (
7), but outbreaks typically happen
around 17 to 18 days of age (
17). Although substantial evidence
supports the role of alpha-toxin in the pathogenesis of NE (
1,
2,
8), a recent report with alpha-toxin-defective mutants has
questioned the importance of alpha-toxin (
10). Therefore, more
studies are required to clarify the importance of alpha-toxin
and other factors in NE pathogenesis. The present study was
undertaken to quantify the relationship between cell proliferation
and alpha-toxin gene expression of
C. perfringens in the development
of NE. To this end, a specific quantitative PCR assay, including
reverse transcription (RT) and real-time PCR (Q-RT-PCR), was
developed to measure alpha-toxin gene expression, and an experimental
model for chicken infection with
C. perfringens (
3,
4,
5) was
used.

Bacteria.
A type A strain of
C. perfringens routinely used to induce NE
in broiler chickens at Nutreco Canada Agresearch by following
an established NE infection model (
3) was used for this study.
The bacterium was grown in Mueller-Hinton broth or on Mueller-Hinton
agar containing 5% (vol/vol) sheep blood at 37°C under an
anaerobic atmosphere (85% N
2, 10% CO
2, and 5% H
2).
Escherichia coli DH5

harboring plasmid pGEM-T with an alpha-toxin gene (
cpa)
from type A
C. perfringens strain D32124 was from J. Prescott
(University of Guelph, Guelph, Canada).

Chicken trial.
Broiler chickens (Ross
x Ross) were reared by following the
guidelines of the Canadian Council on Animal Care (
15). Six-hundred-day-old
chicks in 12 pens (50 birds/pen) were assigned in equal proportions
to one of two dietary treatments: (i) a typical all-vegetable
starter diet (Shur-Gain; Nutreco Canada) with zinc bacitracin
(55 mg/kg) or (ii) the same diet without bacitracin. The first
day of the trial was designated day 0. On day 18, birds were
challenged for 16 h with C.
perfringens (10
7 CFU/ml) through
the diet after 8 h of starvation (
3). Before the challenge,
12 birds from each treatment group (two birds/pen) were randomly
selected and euthanized with CO
2. The sampling was repeated
after the challenge for 4 days (days 19 to 22). Ileal digesta
were collected from each bird. Digesta (0.25 g) for RNA extraction
was mixed, immediately after dissection, with 1.75 ml RNAlater
(Ambion, Austin, TX) and stored on ice for subsequent processing.
NE lesion in the small intestine was monitored and scored for
the last 3 days (days 20 to 22) of the trial as described elsewhere
(
16). Chicken growth performance, including body weight and
feed intake, was recorded weekly prior to clostridial challenge
and daily after the challenge.
C. perfringens in the digesta
was enumerated by plating (
12).

RNA preparation.
Each digesta sample in RNAlater was aliquoted into two Eppendorf
tubes (1 ml each), and the volume was brought to 2 ml with phosphate-buffered
saline buffer (pH 7.4). The digesta were recovered by centrifugation
(20,000 relative centrifugal force, 20 min), quickly frozen
in liquid nitrogen, and then stored at –80°C until
extraction. Total RNA was extracted from ileal digesta with
a RiboPure bacterial RNA isolation kit (Ambion) according to
the manufacturer's instructions except for using 1 ml of lysis
buffer in each tube, the application of bead beating to lyse
bacterial cells as described previously (
11), and two chloroform
extractions during RNA preparation. RNA extract was purified
using a Turbo DNA-free kit (Ambion).

Q-RT-PCR.
cDNA was synthesized from 0.5 µg purified RNA using a
Retroscript reverse transcription kit (Ambion). cDNAs were verified
by PCR with
cpa-specific primers (
14) and eubacterial universal
primers (
21).
Real-time PCR was performed on a Stratagene MX4000 thermal cycler with brilliant SYBR green Q-PCR Master Mix (Stratagene, La Jolla, CA). Previously published C. perfringens cpa gene-specific primers (cpaF, GCTAATGTTACTGCCGTTGA; cpaR, CCTCTGATACATCGTGTAAG) (14) were experimentally evaluated and used for real-time PCR. cDNA samples were diluted 10-fold, and 1 µl of each diluted sample (containing cDNAs equivalent to 2.5 ng of total RNA) was added in a 25-µl reaction mixture which contained 1x Master Mix, 150 nM of each primer, and 30 nM ROX (6-carboxy-X-rhodamine). The program was 10 min at 95°C, then 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 30 s, and finally 2 min at 72°C. Fluorescence was measured after each annealing. Recombinant cpa in a linear range from 102 to 109 copies was included as a standard in each run. To mimic digesta samples, the standards also included the same amount of cDNAs generated from samples with no C. perfringens colony counts. Tests of samples and standards were repeated three times and arranged on different well positions of the plates. The standard curves were generated by plotting threshold cycles of the standards against log10 copy numbers of cpa using GraphPad Prism version 4 (GraphPad Software Inc., San Diego, CA). The amplification efficiency was calculated as –1 + 10(–1/slope) (20).

Statistical analyses.
Statistical analyses, including
t test, correlation analysis,
and polynomial regression modeling (
y =
b0 +
b1X +
b2X2, where
y is the colony count or the copy number and
X is days postchallenge)
were performed using statistical software (SAS version 8.00;
SAS Institute Inc., Cary, NC). Since NE score is a discrete
variable, effects of the colony counts and the copy numbers
on development of NE lesions were analyzed by a logistic proportional
odds model according to the SAS logistic procedure.

Animal growth.
Two birds in the non-bacitracin-treated group died following
clostridial challenge. Significant differences (
P < 0.05)
were observed only in average daily gain, average daily feed
intake, and feed conversion ratio of postchallenge birds between
bacitracin-treated and untreated groups; in these categories,
untreated birds demonstrated a reduction in performance (Table
1).
View this table:
[in this window]
[in a new window]
|
TABLE 1. Effect of bacitracin on body weight, daily gain, daily feed intake, and feed conversion ratio of pre- and postchallenge chickensa
|

C. perfringens proliferation and NE lesions.
As summarized in Table
2, 1 and 2 out of 12 birds from bacitracin-treated
and untreated groups of chickens, respectively, had barely detectable
counts of hemolytic
C. perfringens in the ileum on day 0 (i.e.,
before challenge). Bacitracin in the diet effectively controlled
the cell proliferation of
C. perfringens and development of
NE. However, non-bacitracin-treated chickens demonstrated high
incidence and lesion of NE with a high level of
C. perfringens counts.
View this table:
[in this window]
[in a new window]
|
TABLE 2. Relationships of cell proliferation and alpha-toxin gene expression of C. perfringens in the ileal digesta of chickens on diets with or without bacitracin during the development of NEa
|

Alpha-toxin gene expression.
Figure
1 shows a representative standard curve for quantification
of
cpa mRNA. A linear relationship was found between 10
2 and
10
9 copies of the mRNA (
r2 = 0.99). The average real-time PCR
amplification efficiency summarized from 108 separate runs was
0.92 ± 0.14 (
n = 108). The Q-RT-PCR assay demonstrated
good reproducibility. The standard deviations from six standard
curves ranged from 0.29 to 0.98 in six separate PCR assays (triplicates
for each sample) for calibration of
cpa mRNA in the digesta
RNA samples. The detection limit of the assay with the digesta
samples was 100 copies of
cpa mRNA molecules per reaction, which
is equal to 10
4 copies/µg total RNA.
Like
C. perfringens proliferation and NE lesion, the expression
of
cpa was also effectively controlled by bacitracin treatment
(Table
2). In non-bacitracin-treated chickens, however,
cpa expression increased significantly after the challenge, reached
a peak on day 2 postchallenge, and then declined at the end
of the trial. Some birds in the same group had no detectable
level of
cpa mRNA regardless whether they had NE lesions, which
led to relatively large standard deviations for gene expression.

Quantitative relationships.
The progress of cell proliferation and
cpa expression of
C. perfringens in the ilea of non-bacitracin-treated chickens during
postchallenge days can be described by a regression model:
y =
b0 +
b1X –
b2X2 (Fig.
2). Both cell proliferation and
cpa expression demonstrated a progress trend in a parabolic
curve. The expression of
cpa was behind the cell proliferation
during the first 2 days postchallenge but reached the same level
at the last day of the trial. The level of
cpa expression was
positively correlated (
P 
0.0004) with the cell proliferation
of
C. perfringens each day postchallenge (
r = 0.87 to 0.95)
(Fig.
3). The same positive correlation (
P < 0.0001,
r =
0.91) was also observed when the data from total 46 birds examined
in the last 4 days postchallenge were used.
The relationship of the incidence of NE to the level of
cpa expression and
C. perfringens burden in the ilea of non-bacitracin-treated
chickens was also analyzed. While the development of NE lesions
was marginally explained by the level of
cpa expression (
P =
0.10), the cell proliferation of
C. perfringens can be used
to predict the incidence of NE lesion (
P = 0.0175) (Fig.
4).
The estimated probability shows that the average
C. perfringens count of 5 log
10 CFU/g in the digesta appears to be a threshold
for developing NE with a lesion score of 2.

ACKNOWLEDGMENTS
This research was supported by the Poultry Industry Council
(grant 167), Nutreco Canada Agresearch, and Agriculture &
Agri-Food Canada through its MII program. W. Si and H. Zhou
were NSERC Visiting Fellows to Canadian Federal Government laboratories,
supported by joint funding to J.G.

FOOTNOTES
* Corresponding author. Mailing address: Food Research Program, Agriculture and Agri-Food Canada, 93 Stone Road West, Guelph, Ontario, Canada N1G 5C9. Phone: (519) 780-8027. Fax: (519) 829-2600. E-mail:
gongj{at}agr.gc.ca 
Published ahead of print on 7 September 2007. 
Present address: Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada. 
Present address: Department of Poultry Science, Texas A&M University, College Station, TX. 

REFERENCES
1 - Al-Sheikhly, F., and R. B. Truscott. 1977. The pathology of necrotic enteritis of chickens following infusion of broth cultures of Clostridium perfringens into the duodenum. Avian Dis. 21:230-240.[CrossRef][Medline]
2 - Al-Sheikhly, F., and R. B. Truscott. 1977. The pathology of necrotic enteritis of chickens following infusion of crude toxins of Clostridium perfringens into the duodenum. Avian Dis. 21:241-255.[CrossRef][Medline]
3 - Brennan, J., R. Bagg, D. Barnum, J. Wilson, and P. Dick. 2001. Efficacy of narasin in the prevention of necrotic enteritis in broiler chickens. Avian Dis. 45:210-214.[CrossRef][Medline]
4 - Brennan, J., G. Moore, S. E. Poe, A. Zimmermann, G. Vessie, D. A. Barnum, and J. Wilson. 2001. Efficacy of in-feed Tyloson phosphate for the treatment of necrotic enteritis in broiler chickens. Poultry Sci. 80:1451-1454.[Abstract/Free Full Text]
5 - Brennan, J., J. Skinner, D. A. Barnum, and J. Wilson. 2003. The efficacy of bacitracin methylene disalicylate when fed in combination with narasin in the management of necrotic enteritis in broiler chickens. Poultry Sci. 82:360-363.[Abstract/Free Full Text]
6 - Dahiya, J. P., D. C. Wilkie, A. G. Van Kessel, and M. D. Drew. 2006. Potential strategies for controlling necrotic enteritis in broiler chickens in post-antibiotic era. Anim. Feed Technol. 129:60-88.[CrossRef]
7 - Ficken, M. D., and D. P. Wages. 1997. Necrotic enteritis, p. 261-264. In B. W. Calnek (ed.), Disease of poultry, 10th ed. Iowa State University Press, Ames.
8 - Fukata, T., Y. Hadate, E. Baba, T. Uemura, and A. Arakawa. 1988. Influence of Clostridium perfringens and its toxin in germ-free chickens. Res. Vet. Sci. 44:68-70.[Medline]
9 - Hein, H., and L. Timms. 1972. Bacterial flora in the alimentary tract of chickens infected with Eimeria brunetti and in chickens immunized with Eimeria maxima and cross-infected with Eimeria brunetti. Exp. Parasitol. 31:188-193.[CrossRef][Medline]
10 - Keyburn, A. L., S. A. Sheedy, M. E. Ford, M. M. Williamson, M. M. Awad, J. I. Rood, and R. J. Moore. 2006. Alpha-Toxin of Clostridium perfringens is not an essential virulence factor in necrotic enteritis in chickens. Infect. Immun. 74:6496-6500.[Abstract/Free Full Text]
11 - Li, M., J. Gong, M. Cotrill, H. Yu, C. F. M. de Lange, J. Burton, and E. Topp. 2003. Evaluation of QIAamp® DNA Mini Stoll Kit for microbial ecological studies. J. Microbiol. Methods 54:13-20.[CrossRef][Medline]
12 - Long, J. R., and R. B. Truscott. 1976. Necrotic enteritis in broiler chickens. III. Reproduction of the disease. Can. J. Comp. Med. 40:53-59.[Medline]
13 - McDevitt, R. M., J. D. Brooker, T. Acamovic, and N. H. C. Sparks. 2006. Necrotic enteritis; a continuing challenge for the poultry industry. World Poultry Sci. J. 62:221-247.[CrossRef]
14 - Meer, R. R., and J. G. Songer. 1997. Multiplex PCR method for genotyping Clostridium perfringens. Am. J. Vet. Res. 58:702-705.[Medline]
15 - Olfert, E. D., B. M. Cross, and A. A. McWilliam. 1993. Canadian Council on Animal Care—guide to the care and use of experimental animals, vol. 1, 2nd ed. Bradda Printing Services Inc., Ottawa, Ontario, Canada.
16 - Prescott, J. F. 1979. The prevention of experimentally induced necrotic enteritis in chickens by avoparcin. Avian Dis. 23:1072-1074.[CrossRef][Medline]
17 - Ross Tech. 1999. Necrotic enteritis and associated conditions in broiler chickens. World Poultry 15:44-47.
18 - Shane, S. M., D. G. Koetting, and K. S. Harrington. 1984. The occurrence of Clostridium perfringens in the intestine of chicks. Avian Dis. 28:1120-1124.[CrossRef][Medline]
19 - Songer, J. G. 1996. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 9:216-234.[Medline]
20 - Ståhlberg, A., P. Åman, B. Ridell, P. Mostad, and M. Kubista. 2003. A quantitative real-time PCR method for detection of B-lymphocyte monoclonality by comparison of kappa and lambda immunoglobulin light chain expression. Clin. Chem. 49:51-59.[Abstract/Free Full Text]
21 - Walter, J., G. W. Tannock, A. Tilsala-Timisjarvi, S. Rodtong, D. M. Loach, K. Munro, and T. Alatossava. 2000. Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers. Appl. Environ. Microbiol. 66:297-303.[Abstract/Free Full Text]
Applied and Environmental Microbiology, November 2007, p. 7110-7113, Vol. 73, No. 21
0099-2240/07/$08.00+0 doi:10.1128/AEM.01108-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Lu, Y., Sarson, A. J., Gong, J., Zhou, H., Zhu, W., Kang, Z., Yu, H., Sharif, S., Han, Y.
(2009). Expression Profiles of Genes in Toll-Like Receptor-Mediated Signaling of Broilers Infected with Clostridium perfringens. CVI
16: 1639-1647
[Abstract]
[Full Text]
-
Zhou, H., Gong, J., Brisbin, J., Yu, H., Sarson, A. J., Si, W., Sharif, S., Han, Y.
(2009). Transcriptional profiling analysis of host response to Clostridium perfringens infection in broilers. Poult. Sci.
88: 1023-1032
[Abstract]
[Full Text]