AEM
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AEM.00876-07v1
73/23/7785    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ekborg, N. A.
Right arrow Articles by Distel, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ekborg, N. A.
Right arrow Articles by Distel, D. L.
Agricola
Right arrow Articles by Ekborg, N. A.
Right arrow Articles by Distel, D. L.
Applied and Environmental Microbiology, December 2007, p. 7785-7788, Vol. 73, No. 23
0099-2240/07/$08.00+0     doi:10.1128/AEM.00876-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

CelAB, a Multifunctional Cellulase Encoded by Teredinibacter turnerae T7902T, a Culturable Symbiont Isolated from the Wood-Boring Marine Bivalve Lyrodus pedicellatus{triangledown}

Nathan A. Ekborg,1 Wendy Morrill,2 Adam M. Burgoyne,2 Li Li,2 and Daniel L. Distel1*

Ocean Genome Legacy, Center for Marine Genomic Research and Conservation, 240 County Rd., Ipswich, Massachusetts 01938,1 Department of Biochemistry, Microbiology, and Molecular Biology, University of Maine, 5735 Hitchner Hall, Orono, Maine 044692

Received 18 April 2007/ Accepted 1 October 2007


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 REFERENCES
 
We characterized a multifunctional cellulase (CelAB) encoded by the endosymbiont Teredinibacter turnerae T7902T. CelAB contains two catalytic and two carbohydrate-binding domains, each separated by polyserine linker regions. CelAB binds cellulose and chitin, degrades multiple complex polysaccharides, and displays two catalytic activities, cellobiohydrolase (EC 3.2.1.91) and ß-1,4(3) endoglucanase (EC 3.2.1.4).


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
REFERENCES
 
Increasing demand for renewable energy sources has sparked growing interest in enzymes capable of degrading cellulose, the primary constituent of plant matter, to sugars that can be used for the production of ethanol. In nature, cellulose is degraded by the combined activities of multiple enzymes containing various glycoside hydrolase (GH) domains and carbohydrate binding modules (CBM) (1). While the great majority of glycosidases reported to date contain one GH domain, a small number contain multiple GH domains (2, 4, 5, 7, 9, 14, 16, 18, 20, 21). An example is CelA (8), from Teredinibacter turnerae T8201, an endosymbiont of the wood-boring bivalve Psiloteredo healdi. Although CelA is largely uncharacterized, amino acid sequence homology of its two GH domains suggests both endoglucanase and cellobiohydrolase activities. Here we describe CelAB, a homolog of CelA, produced by T. turnerae T7902T, an endosymbiont of the shipworm Lyrodus pedicellatus. Substrate specificity, binding properties, and cleavage products of purified CelAB were examined to evaluate its potential multiple enzymatic activities and carbohydrate binding affinities.

A recombinant plasmid encoding a protein with hydrolytic activity against pNP-cellobioside and carboxymethylcellulose (CMC), when expressed in Escherichia coli, was identified in a Lambda Zap II genomic library (Stratagene) of T. turnerae T7902T. Using EZ:Tn <Kan-2> transposon mutagenesis (Epicenter), an open reading frame was found encoding a putative cellulase, designated CelAB. CelAB is composed of 1,010 amino acids with a predicted molecular mass of 108 kDa (GenBank accession no. EF562510). It displays an unusual domain composition of GH5, CBM5, CBM10, and GH6 and is 98.2% identical in amino acid sequence to CelA (Fig. 1A). Similar domains have been identified in a variety of functionally diverse proteins from phylogenetically diverse organisms (Table 1). Each domain of CelAB is separated by polyserine linker regions (15) of 38, 55, and 54 residues in length, containing 32, 40, and 43 serine residues, respectively. It is interesting to note that while CelAB differs from CelA by 1.8% in amino acid sequence identity, no changes are observed in the linker regions, suggesting an unexpectedly high degree of functional conservation for regions with no identified sequence-dependent function.


Figure 1
View larger version (13K):
[in this window]
[in a new window]

  		FIG. 1. (A) Structural features of CelAB. Domains are noted. Black box, type II secretion signal; striped boxes, polyserine linker regions. (B) Endoglucanase activity of CelAB. Rapid reduction in viscosity of a 5% CMC gel by K. lactis {Delta}cts-1 celAB (solid line) culture supernatant compared to the K. lactis {Delta}cts-1 background strain (dashed line) suggests endoglucanase activity. (C) Carbohydrate binding characteristics of CelAB. Immunoblot detection of CelAB indicates binding to Avicel, cellulose, and chitin but not xylan or curdlan. Lanes, 1, Avicel; 2, cellulose; 3, chitin; 4, xylan; 5, curdlan. Molecular mass markers (kDa) are indicated to the left.

 

View this table:
[in this window]
[in a new window]

  		TABLE 1. Properties of functional domains in CelAB

 
Sequence homology of CelAB to domains of known function suggests it may be capable of both endoglucanase and cellobiohydrolase activities and may bind cellulose and, perhaps, other polysaccharides. Most known representatives of the GH5 family display endoglucanase activity (though this family also includes proteins with at least 11 other activities), while only cellobiohydrolase and ß-1,4 glucanase activities have been demonstrated in family GH6 domains to date (12). Both CBM5 and CBM10 families are further classified as type A surface binding modules, all of which are thought to bind highly crystalline substrates (3), including cellulose and chitin.

CelAB was cloned and expressed in a Kluyveromyces lactis {Delta}cts1 strain (6) (a gift from P. Colussi and C. Taron, New England Biolabs [NEB]) because of its attractive scale-up potential for protein production. Cloning was performed according to the manufacturer's guidelines using the following PCR primers: forward, TATATATAGATCTACCTCTGCAGCTTTCGCGG; and reverse, containing a hemagglutinin (HA) epitope, ATATATAGCGGCCGCTTATGCATAATCTGGAACATCATATGGATACGTCAGGTCGGAGGCGG. Culture supernatants of this strain rapidly depolymerized 5% CMC, suggestive of endoglucanase activity (Fig. 1B).

To test the carbohydrate binding characteristics of CelAB, various substrates were incubated with culture supernatant of K. lactis {Delta}cts-1 celAB cells, washed with 3 M urea, and assayed by immunoblots with anti-HA (Cell Signaling Technologies) for the presence of CelAB. CelAB bound to cellulose and chitin, while it did not bind to xylan or curdlan (Fig. 1C). The observed binding was resistant to 8 M urea, 5 M NaCl, and exposure to pH 3 or 10 (data not shown) but was reversible in 20 mM NaOH (pH 12). The capability of CelAB to bind two structurally distinct polysaccharides may reflect differential specificities of its two distinct CBM domains, although this remains to be confirmed experimentally.

CelAB was purified from K. lactis {Delta}cts1 celAB cells by applying culture supernatants to a chitin column (NEB) following the manufacturer's guidelines, except the proteins were eluted with 20 mM NaOH and then neutralized with 1/10 volume of 1 M Tris (pH 8.0). Active fractions were applied to a High Trap DEAE column and then fractionated on a Superdex 75 preparative column (5 cm by 90.2 cm) to isolate the full-length product. CelAB was purified as a variably glycosylated protein that produced a broad high-molecular-weight smear observed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Incubation of the glycosylated protein with peptide:N glycosidase F (PNGase F [NEB]), which cleaves N-linked-glycan chains from proteins, produced a single sharp protein band of approximately the expected molecular mass for CelAB (Fig. 2A). The identical purification procedure performed on the K. lactis {Delta}cts1 background expression strain did not yield any detectable protein in immunoblots, Coomassie-stained gels, or activity assays. CelAB produced in E. coli appeared to be enzymatically identical to that produced by the K. lactis {Delta}cts-1 celAB strain, suggesting that neither host glycosylation of CelAB nor contaminating proteins derived from the K. lactis {Delta}cts-1 strain affected activity (data not shown).


Figure 2
View larger version (35K):
[in this window]
[in a new window]

  		FIG. 2. Enzymatic characterization of CelAB. (A) Glycosylation of CelAB by the K. lactis {Delta}cts-1 strain. Treatment of CelAB purified from the K. lactis {Delta}cts-1 celAB strain with PNGase F resulted in a single protein band at the expected molecular mass. Lane 1, PNGase F-treated CelAB; lane 2, untreated CelAB. Molecular mass markers (kDa) are given to the left. (B) Temperature and pH optima for CelAB based on the hydrolysis of pNP-cellobioside. (C) Endoglucanase and cellobiohydrolase activity of CelAB demonstrated with coumarin-linked substrates. Lanes: 1 D-glucose-coumarin; 2, cellobiose-coumarin; 3, cellotriose-coumarin; 4, cellotetraose-coumarin; 5, cellopentaose-coumarin; 6, CelAB plus cellotetraose-coumarin; 7, CelAB plus cellopentaose-coumarin. (D) Cleavage site of coumarin-linked cellotetraose and cellopentaose produced by CelAB. CelAB produced cellobiose-coumarin from cellotetraose-coumarin (below left) indicative of cellobiohydrolase (CBH) activity and released cellotriose-coumarin and cellobiose-coumarin from cellopentaose-coumarin (below right), indicative of cellobiohydrolase and ß-1,4 endoglucanase (ENG) activities. Open stars, coumarin; solid circles, glucose.

 
Temperature and pH optima of 42°C and pH 6.0 were determined for purified CelAB based on the cleavage of pNP-cellobioside (Fig. 2B) (18). Substrate specificity of CelAB was determined by detecting the production of reducing sugar ends (10) after incubation with various substrates in 50-µl reaction mixtures containing 1% (wt/vol) substrate, 0.15 µg of CelAB, and 50 mM sodium citrate (pH 6.0). Reaction mixtures were incubated for 2 h at 42°C. The production of reducing sugars was detected with barley ß-glucan, CMC, laminarin, and lichenan (Table 2). These activities along with lack of activity against Avicel suggested that the activity of CelAB is directed primarily towards amorphous substrates.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Activity of CelAB

 
Endoglucanase and cellobiohydrolase activities for CelAB were assayed with coumarin-labeled cello-oligosaccharides synthesized and assayed as previously described (19). CelAB cleaved cellotetraose to produce cellobiose as the sole product, by definition a cellobiohydrolase activity. Hydrolysis of cellopentaose produced cellotriose and cellobiose, consistent with both cellobiohydrolase and ß-1,4 endoglucanase activities (Fig. 2C). Cellobiose concentrations up to 30 mM did not inhibit cellobiohydrolase activity (data not shown).

It remains to be determined whether the two catalytic activities observed in CelAB reflect the distinct properties of its two GH domains. If so, the potential exists for synergistic interaction between these domains, possibly explaining its 25-fold increase in specific activity compared to Cel5A from Saccharophagus degradans, a similar enzyme with two predicted endoglucanase domains (18). Further domain analysis of CelAB may provide insights into the potential for coordinated activity within multifunctional cellulases and may be useful in the discovery and optimization of industrial cellulases.


   ACKNOWLEDGMENTS
 
We gratefully acknowledge the financial support of the National Science Foundation (OCE0612444) and New England Biolabs.


   FOOTNOTES
 
* Corresponding author. Mailing address: Ocean Genome Legacy, 240 County Rd., Ipswich, MA 01938. Phone: (978) 380-7425. Fax: (978) 356-5263. E-mail: distel{at}oglf.org Back

{triangledown} Published ahead of print on 12 October 2007. Back


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 REFERENCES
 

  1. Beguin, P., and J. P. Aubert. 1994. The biological degradation of cellulose. FEMS Microbiol. Rev. 13:25-58.[CrossRef][Medline]
  2. Bergquist, P. L., M. D. Gibbs, D. D. Morris, V. S. J. Te'o, D. J. Saul, and H. W. Morgan. 1999. Molecular diversity of thermophilic cellulolytic and hemicellulolytic bacteria. FEMS Microbiol. Ecol. 28:99-110.[CrossRef]
  3. Boraston, A. B., D. N. Bolam, H. J. Gilbert, and G. J. Davies. 2004. Carbohydrate-binding modules: fine-tuning polysaccharide recognition. Biochem. J. 382:769-781.[CrossRef][Medline]
  4. Cho, K. M., S. Y. Hong, S. M. Lee, Y. H. Kim, G. G. Kahng, H. Kim, and H. D. Yun. 2006. A cel44C-man26A gene of endophytic Paenibacillus polymyxa GS01 has multi-glycosyl hydrolases in two catalytic domains. Appl. Microbiol. Biotechnol. 73:618-630.[CrossRef][Medline]
  5. Collin, M., and V. A. Fischetti. 2004. A novel secreted endoglycosidase from Enterococcus faecalis with activity on human immunoglobulin G and ribonuclease B. J. Biol. Chem. 279:22558-22570.[Abstract/Free Full Text]
  6. Colussi, P. A., C. A. Specht, and C. H. Taron. 2005. Characterization of a nucleus-encoded chitinase from the yeast Kluyveromyces lactis. Appl. Environ. Microbiol. 71:2862-2869.[Abstract/Free Full Text]
  7. Eberhardt, R. Y., H. J. Gilbert, and G. P. Hazlewood. 2000. Primary sequence and enzymic properties of two modular endoglucanases, Cel5A and Cel45A, from the anaerobic fungus Piromyces equi. Microbiology 146:1999-2008.[Abstract/Free Full Text]
  8. Freer, S. N., R. V. Green, and R. J. Bothast. 2001. Gene structure of a bifunctional cellulase gene (celA) isolated from Teredinobacter turnerae, p. 39-54. In M. E. Himmel, J. O. Baker, and J. N. Saddler (ed.), Glycosyl hydrolases for biomass conversion. American Chemical Society, Washington, DC.
  9. Gibbs, M. D., R. A. Reeves, G. K. Farrington, P. Anderson, D. P. Williams, and P. L. Bergquist. 2000. Multidomain and multifunctional glycosyl hydrolases from the extreme thermophile Caldicellulosiruptor isolate Tok7B.1. Curr. Microbiol. 40:333-340.[CrossRef][Medline]
  10. Green, F., C. Clausen, and T. Highley. 1989. Adaptation of the Nelson-Somogyi reducing-sugar assay to a microassay using microtiter plates. Anal. Biochem. 182:197-199.[CrossRef][Medline]
  11. Hall, J., G. W. Black, L. M. Ferreira, S. J. Millward-Sadler, B. R. Ali, G. P. Hazlewood, and H. J. Gilbert. 1995. The non-catalytic cellulose-binding domain of a novel cellulase from Pseudomonas fluorescens subsp. cellulosa is important for the efficient hydrolysis of Avicel. Biochem. J. 309:749-756.[Medline]
  12. Henrissat, B., and A. Bairoch. 1996. Updating the sequence-based classification of glycosyl hydrolases. Biochem. J. 316:695-696.[Medline]
  13. Hogg, D., G. Pell, P. Dupree, F. Goubet, S. M. Martin-Orue, S. Armand, and H. J. Gilbert. 2003. The modular architecture of Cellvibrio japonicus mannanases in glycoside hydrolase families 5 and 26 points to differences in their role in mannan degradation. Biochem. J. 371:1027-1043.[CrossRef][Medline]
  14. Howard, M. B., N. A. Ekborg, L. E. Taylor II, R. M. Weiner, and S. W. Hutcheson. 2004. Chitinase B of "Microbulbifer degradans" 2-40 contains two catalytic domains with different chitinolytic activities. J. Bacteriol. 186:1297-1303.[Abstract/Free Full Text]
  15. Howard, M. B., N. A. Ekborg, L. E. Taylor, S. W. Hutcheson, and R. M. Weiner. 2004. Identification and analysis of polyserine linker domains in prokaryotic proteins with emphasis on the marine bacterium Microbulbifer degradans. Protein Sci. 13:1422-1425.[Abstract/Free Full Text]
  16. Huang, Y. H., C. T. Huang, and R. S. Hseu. 2005. Effects of dockerin domains on Neocallimastix frontalis xylanases. FEMS Microbiol. Lett. 243:455-460.[CrossRef][Medline]
  17. Meinke, A., N. R. Gilkes, E. Kwan, D. G. Kilburn, R. A. Warren, and R. C. Miller, Jr. 1994. Cellobiohydrolase A (CbhA) from the cellulolytic bacterium Cellulomonas fimi is a beta-1,4-exocellobiohydrolase analogous to Trichoderma reesei CBH II. Mol. Microbiol. 12:413-422.[CrossRef][Medline]
  18. Taylor, L. E., II, B. Henrissat, P. M. Coutinho, N. A. Ekborg, S. W. Hutcheson, and R. M. Weiner. 2006. Complete cellulase system in the marine bacterium Saccharophagus degradans strain 2-40T. J. Bacteriol. 188:3849-3861.[Abstract/Free Full Text]
  19. Wong-Madden, S. T., and D. Landry. 1995. Purification and characterization of novel glycosidases from the bacterial genus Xanthomonas. Glycobiology 5:19-28.[Abstract/Free Full Text]
  20. Yoda, K., A. Toyoda, Y. Mukoyama, Y. Nakamura, and H. Minato. 2005. Cloning, sequencing, and expression of a Eubacterium cellulosolvens 5 gene encoding an endoglucanase (Cel5A) with novel carbohydrate-binding modules, and properties of Cel5A. Appl. Environ. Microbiol. 71:5787-5793.[Abstract/Free Full Text]
  21. You, M., X. Xuan, N. Tsuji, T. Kamio, D. Taylor, N. Suzuki, and K. Fujisaki. 2003. Identification and molecular characterization of a chitinase from the hard tick Haemaphysalis longicornis. J. Biol. Chem. 278:8556-8563.[Abstract/Free Full Text]
  22. Zeng, R., P. Xiong, and J. Wen. 2006. Characterization and gene cloning of a cold-active cellulase from a deep-sea psychrotrophic bacterium Pseudoalteromonas sp. DY3. Extremophiles 10:79-82.[CrossRef]

Applied and Environmental Microbiology, December 2007, p. 7785-7788, Vol. 73, No. 23
0099-2240/07/$08.00+0     doi:10.1128/AEM.00876-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AEM.00876-07v1
73/23/7785    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ekborg, N. A.
Right arrow Articles by Distel, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ekborg, N. A.
Right arrow Articles by Distel, D. L.
Agricola
Right arrow Articles by Ekborg, N. A.
Right arrow Articles by Distel, D. L.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Microbiol. Mol. Biol. Rev. Eukaryot. Cell All ASM Journals