Expression of Mycoplasma Proteins Carrying an Affinity Tag in M. pneumoniae Allows Rapid Purification and Circumvents Problems Related to the Aberrant Genetic Code

In Mycoplasma pneumoniae and several other mollicutes, the UGAopal codon specifies tryptophan rather than a translation stop.This often makes it difficult to express Mycoplasma proteinsin heterologous hosts. In this work, we demonstrate that mollicuteproteins can be fused to an affinity tag and be expressed directlyin M. pneumoniae. The protein can then be purified by affinitychromatography and be used for biochemical or any other desiredanalysis.

INTRODUCTION

Top

INTRODUCTION

Mycoplasma pneumoniae is a human pathogen that thrives on mucosalsurfaces and causes diseases such as mild pneumonia, tracheobronchitis,pediatric encephalitis, and erythema multiforme (2, 11, 15,18, 24). These bacteria possess one of the smallest genomesof any free-living organism known so far. This reduced genomehas recently attracted much interest, as the analysis of M.pneumoniae and its close relatives may help to identify theminimal set of genes that is required for independent life (4,9). This prompted the development of the new field of syntheticbiology with projects aimed at the generation of artificialmicrobes based on Mycoplasma spp. (3, 14). Another interestingaspect of the small genome is the observation that several enzymesof Mycoplasma spp. are moonlighting: i.e., they have multipleunrelated functions (12). This was discovered for glycolytickinases that are also active as nucleoside diphosphate kinasesin M. pneumoniae and other Mycoplasma spp. (17).

The analysis of proteins from Mycoplasma spp. is hampered bya peculiarity of the genetic code of these bacteria: they usethe UGA opal codon to incorporate tryptophan rather than asa stop codon as in the universal genetic code (10, 19). Thus,if cloned in Escherichia coli or other hosts, the genes fromM. pneumoniae often contain many stop codons that prevent heterologousexpression. Several strategies have been developed to solvethis problem. Expression of mollicute genes in Spiroplasma spp.that read the UGA as a tryptophan codon has been reported; however,these bacteria are difficult to handle (21). E. coli suppressorstrains expressing an opal suppressor tRNA have been developed;however, they fail if multiple opal codons are present (20).M. pneumoniae genes containing few UGA codons have been expressedin Bacillus subtilis with low efficiency (13). Recently, wedeveloped a PCR-based strategy to exchange as many as nine opalcodons in a single step. This approach, the multiple mutationreaction, allowed the expression of the M. pneumoniae glycerolkinase and has been used for several other proteins (7). However,there are cases in which it is desirable to purify a mollicuteprotein from the original host. This is of special importancefor protein-protein interaction studies. To facilitate geneexpression and protein purification in M. pneumoniae, we developeda system for the expression of proteins fused to an N-terminalstreptavidin (Strep) tag in M. pneumoniae. These proteins caneasily be purified by affinity chromatography using Strep-tactincolumns due to the highly specific interaction between the Strep-tagpeptide and the artificial protein Strep-tactin (23).

Outline of the expression system.

Top

Outline of the expression...

To allow efficient expression and subsequent purification ofa protein of interest in M. pneumoniae, the respective genehas to be fused to an affinity tag and a promoter has to beprovided. We chose to use the Strep tag because this peptidebinds with high affinity to Strep-tactin materials and can beeluted in a single step using desthiobiotin. In our hands, thepurification using the Strep tag is much more efficient thanthe popular His tag for purification from both E. coli and B.subtilis (8, 16). To drive the expression of the fusion proteins,we selected a promoter fragment of the M. pneumoniae ackA geneencoding acetate kinase. This promoter was recently shown toconfer active transcription to a reporter gene in M. pneumoniae(6). Since there are no replicative plasmids for M. pneumoniaeavailable, we introduced the artificial gene by transpositioninto the chromosome of M. pneumoniae and assayed several clonesfor expression of the recombinant protein using antibodies recognizingthe Strep tag.

Cloning of M. pneumoniae hprK and expression of the protein.

Top

Cloning of M. pneumoniae...

To test the anticipated expression system, we selected the M.pneumoniae HPr kinase/phosphorylase (HPrK; encoded by the hprKgene). We previously expressed HPrK with an N-terminal Streptag and demonstrated biochemical activity of the fusion protein(16). Plasmid pGP1012 allowing the expression of HPrK carryingan N-terminal Strep tag under the control of the ackA promoterwas constructed as follows. The DNA fragment corresponding tothe hprK gene with a sequence specifying the Strep tag II atits 5' end was amplified from plasmid pGP611 (16) using theoligonucleotides SS22 (5' AAACTGCAGTGGAGCCACCCGCAGTTCG) andSS23 (5' AAAGCGGCCGCGGTCTGCTACTAACACTAGGATTCATC). In addition,the ackA promoter fragment, which also contains the Shine-Dalgarnosequence and the ATG start codon of the acetate kinase openreading frame, was amplified from M. pneumoniae chromosomalDNA using the primer pair SH58 (6) and SS21 (5' AAACTGCAGCATTTTTATCTAATAGGTAACAA).The promoter and the hprK gene fragments were digested withEcoRI/PstI and PstI/NotI, respectively, and ligated to pMT85(25) linearized with EcoRI and NotI in a three-fragment ligationmixture. The correctness of the resulting plasmid, pGP1012,was verified by restriction and sequence analysis. Plasmid pMT85(and thus, pGP1012) carries an aac-aphD gentamicin resistancedeterminant as well as a derivative of Tn4001 that lacks thetransposase gene (mini-Tn4001) to avoid transposition afterthe initial integration into the M. pneumoniae chromosome. Thetranposase gene is located on the plasmid backbone that is lostupon transposition (25). This allows the random integrationof the cassette carrying the ackA promoter and the artificialstrep-hprK gene in the chromosome of M. pneumoniae. For thispurpose, we introduced pGP1012 (and as a control, pMT85) byelectroporation into M. pneumoniae M129 as described earlier(1). Transformants were selected on plates containing gentamicin.

To check the expression of the tagged HPrK in the transformants,we cultivated five independent clones obtained with pGP1012and one transformant carrying the empty mini-Tn4001 derivedfrom pMT85 and prepared cell extracts. These cell extracts wereseparated by one-dimensional sodium dodecyl sulfate-polyacrylamidegel electrophoresis (SDS-PAGE), and the proteins were transferredto a polyvinylidene difluoride membrane by electroblotting.The presence of Strep-HPrK was verified using polyclonal antibodiesdirected against Strep-glycerol kinase (GlpK) from M. pneumoniae(SeqLab, Göttingen, Germany). We observed that these antibodieswere able to efficiently cross-react with the Strep tag in additionto M. pneumoniae GlpK (data not shown). As shown in Fig. 1,a Strep-tagged protein corresponding in size exactly to theStrep-HPrK purified from E. coli was present in all clones carryingthe minitransposon derived from pGP1012 but not in those carryingthe empty mini-Tn4001 (pMT85). Since the minitransposon canbe inserted at a different position in each clone, we cannotexclude position effects on the expression of the construct.Based on the Western blot shown in Fig. 1, we selected clone1 for the purification of Strep-HPrK. This strain was designatedGPM78.

View larger version (20K):
[in this window]
[in a new window]

FIG. 1. Evaluation of the expression of Strep-tagged HPrK in M. pneumoniae GPM78 by Western blot analysis. Crude extracts of different M. pneumoniae GPM78 clones grown in the presence of glucose (1% [wt/vol]) were separated by SDS-PAGE. Strep-HPrK was detected by using polyclonal rabbit antibodies raised against M. pneumoniae Strep-tagged GlpK due to cross-reaction to the Strep tag. Ten micrograms of cell extract was applied to each lane. A total of 500 ng recombinant Strep-tagged HPrK served as a control (lane 1). Lane 2, M. pneumoniae GPM79 (empty vector); lanes 3 to 7, M. pneumoniae GPM78 clones 1 to 5.

Purification of Strep-HPrK and activity assay.

Top

Purification of Strep-HPrK and...

To purify the tagged HPrK, we cultivated M. pneumoniae GPM78in 400 ml of modified Hayflick medium (5). The cells were disruptedby sonication, and the cell extracts were passed over a Strep-tactinSepharose column (IBA GmbH, Göttingen, Germany). Afterfive washing steps, the protein carrying a Strep tag was elutedby applying desthiobiotin (2.5 mM) to the columns as describedpreviously (16). The purified protein was further analyzed bySDS-PAGE (Fig. 2). Using this procedure, we obtained 25 µgof virtually pure protein from a culture of 400 ml (concentration,100 ng/µl).

View larger version (38K):
[in this window]
[in a new window]

FIG. 2. Overproduction and purification of recombinant M. pneumoniae HPrK. Cells of M. pneumoniae GPM78 were grown in modified Hayflick medium containing 1% (wt/vol) glucose. After 72 h, cells were harvested and disrupted by sonication. The crude extract was passed over a Strep-tactin column (400-µl bed volume; IBA, Göttingen, Germany). The recombinant protein was eluted with desthiobiotin (IBA [final concentration, 2.5 mM]) after extensive washing with a buffer containing 100 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 1 mM EDTA. Aliquots of the individual fractions were separated on 12% SDS-polyacrylamide gels followed by silver staining. A protein mass marker (Fermentas) served as a standard (lane M). Lane 1, washing step 1; lane 2, washing step 2; lane 3, washing step 5; lanes 4 to 8, elution fractions 1 to 5; lane 9, Strep-HPrK purified from E. coli DH5 ${alpha}$ (500 ng).

The purified Strep-HPrK was used for activity assays: i.e.,the phosphorylation of M. pneumoniae HPr protein at the expenseof ATP. For this purpose, we purified HPr carrying an N-terminalHis tag using E. coli DH5 ${alpha}$ /pGP217 (22). The activity assays wereperformed as described previously (22). As shown in Fig. 3,the Strep-HPrK purified from M. pneumoniae was active in thephosphorylation of HPr.

View larger version (26K):
[in this window]
[in a new window]

FIG. 3. In vitro phosphorylation assay to test the activity of purified Strep-HPrK in M. pneumoniae GPM78 elution fractions. M. pneumoniae His₆-HPr (20 µM) was incubated with 12 µl of each elution fraction and 0.5 mM ATP in assay buffer (25 mM Tris-HCl [pH 7.5], 10 mM MgCl₂, 1 mM dithiothreitol) in a final volume of 20 µl at 37°C for 120 min. Subsequently, the HPrK was heat inactivated for 10 min at 95°C. The assay mixtures were analyzed by 10% native PAGE. The first lanes are controls with M. pneumoniae His₆-HPr (first lane) and His₆-HPr(Ser-P) prepared in vitro (second lane). In addition, 5 µg of M. pneumoniae GPM78 crude extract served as a control (third lane). Lanes 1 to 5, elution fractions 1 to 5; lane 6, elution fraction 3 without addition of His₆-HPr.

This study demonstrates that the purification of Strep-taggedproteins directly from M. pneumoniae is an alternative to theirexpression in heterologous hosts such as E. coli, which oftenrequires the laborious replacement of opal codons to preventpremature translation termination. We are confident that otherMycoplasma species such as M. genitalium might also be usedas expression hosts. Moreover, the application of novel, potentiallystronger promoters and translation signals may increase theefficiency of protein expression. The proteins isolated in thisway can be used for biochemical characterization or for thegeneration of antibodies. Moreover, the expression in M. pneumoniaealso allows the isolation of functional protein complexes (8;our unpublished results).

ACKNOWLEDGMENTS

We are grateful to Richard Herrmann for the generous gift ofplasmid pMT85 and to Julia Busse for excellent technical assistance.

This work was supported by the Deutsche Forschungsgemeinschaftand the Fonds der Chemischen Industrie.

FOOTNOTES

* Corresponding author. Mailing address: Department of General Microbiology, Institute of Microbiology and Genetics, Georg-August University Göttingen, Grisebachstr. 8, D-37077 Göttingen, Germany. Phone: 49-551-393781. Fax: 49-551-393808. E-mail: jstuelk{at}gwdg.de

Published ahead of print on 12 October 2007.

REFERENCES

Top