Previous Article | Next Article ![]()
Applied and Environmental Microbiology, December 2007, p. 7814-7818, Vol. 73, No. 24
0099-2240/07/$08.00+0 doi:10.1128/AEM.01140-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
,
S. Atsumi, and
J. C. Liao*
Department of Chemical and Biomolecular Engineering, University of California, Los Angeles, 5531 Boelter Hall, Los Angeles, California 90095
Received 22 May 2007/ Accepted 6 October 2007
|
|
|---|
|
|
|---|
Several species of Clostridium have been evaluated for isopropanol production, including 52 strains of Clostridium beijerinckii (4). The maximum production of isopropanol from these strains was 30 mM. Limited knowledge about metabolic regulation of the strains and the difficulty of gene manipulation have hindered further improvements in isopropanol production. On the other hand, Escherichia coli is one of most studied and easily manipulated organisms for metabolic engineering (2, 5, 15). The bacterium has already been shown to produce high titers of ethanol (6) and many other biochemicals (1, 2, 5, 12, 22).
Bermejo et al. (1) produced acetone in E. coli by introducing four genes from Clostridium acetobutylicum ATCC 824 (thl, ctfAB, and adc encoding acetyl-coenzyme A [CoA] acetyltransferase, acetoacetyl-CoA transferase, and acetoacetate decarboxylase, respectively) under the control of the thl promoter from C. acetobutylicum (1). This engineered E. coli strain produced almost the same level of acetone as C. acetobutylicum ATCC 824 does. However, isopropanol production in E.coli has not been reported. Here, we engineered a synthetic pathway for the production of isopropanol in E. coli.
The strategy for the biosynthesis of isopropanol in E. coli utilizes the pathway modeled after C. beijerinckii, which produces isopropanol from acetyl-CoA via acetone (Fig. 1). First, an acetyl-CoA acetyltransferase condenses two molecules of acetyl-CoA to one molecule of acetoacetyl-CoA (23). Next, an acetoacetyl-CoA transferase transfers CoA from acetoacetyl-CoA to acetate or to butyrate (24), forming acetoacetate, which is then converted to acetone and CO2 by an acetoacetate decarboxylase (19). Finally, a primary-secondary alcohol dehydrogenase (hereafter referred to as the secondary alcohol dehydrogenase [SADH]) converts acetone to isopropanol in an NADPH-dependent reaction (3). To optimize the pathway, we also evaluated the native E. coli acetyl-CoA acetyltransferase (encoded by atoB) and acetoacetyl-CoA transferase (encoded by atoAD) (8) in performing the initial steps of acetone production. Furthermore, we compared the activities of the SADHs (encoded by adh) from C. beijerinckii NRRL B593 (7) and Thermoanaerobacter brockii HTD4 (10) in performing the final step of isopropanol production in E. coli. These two SADHs have previously been expressed and characterized in E. coli (18).
![]() View larger version (13K): [in a new window] |
FIG. 1. The metabolic pathway for isopropanol production. The box shows the synthetic pathway for isopropanol production from acetyl-CoA engineered in this study. The dashed line indicates omitted steps. ACoAAT, acetyl-CoA acetyltransferase (encoded by E. coli atoB or C. acetobutylicum thl); ACoAT, acetoacetyl-CoA transferase (encoded by C. acetobutylicum ctfAB or E. coli atoAD); ADC, acetoacetate decarboxylase (encoded by C. acetobutylicum adc); SADH, encoded by C. beijerinckii adh or T. brockii adh. ec, E. coli; ca,C. acetobutylicum; cb, C. beijerinckii; tb, T. brockii.
|
|
|
|---|
Z1 (14) by P1 transduction was used as the host strain and designated TA11. Multiple combinations of the acetone pathway genes thl, ctfAB, atoB, atoAD, and adc were cloned into a ColE1-delivered plasmid (pSA40) under the control of the PLlacO1 promoter (14). The resulting plasmids were named pTA29 (atoB ctfAB adc), pTA30 (atoB atoAD adc), pTA39 (thl atoAD adc), and pTA41 (thl ctfAB adc) (Table 1 shows the details). The adh gene from C. beijerinckii or T. brockii was cloned into a p15A-delivered vector (pZA31-luc) under the control of PLlacO1 to generate plasmids pTA36 and pTA18, respectively. Each combination of the acetone pathway genes and the isopropanol-producing genes was introduced into TA11 for evaluation. |
View this table: [in a new window] |
TABLE 1. Strains and plasmids used
|
pTA29 (PLlacO1::atoB ctfAB adc).
To replace PLtetO1 of pZE21-MCS1 (14) with PLlacO1, pZE12-luc was digested with AatII and Acc65I. The shorter fragment was purified and cloned into plasmid pZE21-MCS1 cut with the same enzymes, creating pSA40. To clone atoB, ctfAB, and adc, Acc65I-SalI (atoB), SalI-XmaI (ctfAB), and XmaI-BamHI (adc) recognition sites in pSA40 were used. AatII and AvrII recognition sites were used to replace the kanamycin resistance gene with the ampicillin resistance gene. To clone atoB, genomic DNA of E. coli K-12 MG1655 was used as a template with a pair of primers, TA15F (5' CGCGGTACCATGAAAAATTGTGTCATCGTCAGTG 3') and TA16R (5' CCGCGTCGACTTAATTCAACCGTTCAATCACCATC 3'), and the PCR products were digested with Acc65I and SalI. To clone ctfAB, genomic DNA of C. acetobutylicum ATCC 824 (ATCC) was used as a template with a pair of primers, TA19F (5' CCGCGTCGACGAAGGAGATATACATATGAACTCTAAAATAATTAGATTTG 3') and TA4R (5' CGCCCCGGGCTAAACAGCCATGGGTCTAAGTTCA 3'), and the PCR products were digested with SalI and XmaI. To clone adc, genomic DNA of C. acetobutylicum ATCC 824 was used as a template with a pair of primers, TA20F (5' CGCCCCGGGGAAGGAGATATACATATGTTAAAGGATGAAGTAATTAAAC 3') and TA6R (5' CGCGGATCCTTACTTAAGATAATCATATATAACT 3'), and the PCR products were digested with XmaI and BamHI.
pTA30 (PLlacO1::atoB atoAD adc).
To clone atoAD, genomic DNA of E. coli K-12 MG1655 was used as a template with a pair of primers, TA21F (5' CCGCGTCGACGAAGGAGATATACATATGAAAACAAAATTGATGACATTAC 3') and TA18R (5' CGCCCCGGGTCATAAATCACCCCGTTGCGTATTC 3'). The PCR products were digested with SalI and XmaI and cloned into plasmid pTA29 cut with the same enzymes.
pTA39 (PLlacO1::thl atoAD adc).
To clone thl, genomic DNA of C. acetobutylicum ATCC 824 was used as a template with a pair of primers, TA13F (5' CGCGGTACCATGAAAGAAGTTGTAATAGCTAGTG 3') and TA14R (5' CCGCGTCGACCTAGCACTTTTCTAGCAATATTGC 3'). The PCR products were digested with Acc65I and SalI and cloned into plasmid pTA30 cut with the same enzymes.
pTA41 (PLlacO1::thl ctfAB adc).
To clone thl, genomic DNA of C. acetobutylicum ATCC 824 was used as a template with a pair of primers, TA13F and TA14R. The PCR products were digested with Acc65I and SalI and cloned into plasmid pTA29 cut with the same enzymes.
pTA18 (PLlacO1::adh [T. brockii]).
To clone adh (T. brockii), synthesized DNA of T. brockii HTD4 (Epoch Biolabs) was used as a template with a pair of primers, TA7F (5' CGCGGTACCATGAAAGGTTTTGCAATGCTGTCCA 3') and TA8R (5' CGCTCTAGACTATGCTAAAATCACCACTGGTTTAATT 3'). The PCR products were digested with Acc65I and XbaI and cloned into plasmid pZE12-luc cut with the same enzymes, creating pTA8. To replace the replication origin and the ampicillin resistance gene with p15A and the kanamycin resistance gene, pZA31-luc(14) was digested with AatII and AvrII. The shorter fragment was purified and cloned into pTA8 cut with the same enzymes to create pTA18. The codon usage of the synthesized DNA was optimized for expression in E. coli, and stem-loop structures were avoided by checking with a secondary-structure prediction program. This sequence is shown in the supplemental material.
pTA36 (PLlacO1::adh [C. beijerinckii]).
To clone adh (C. beijerinckii), the plasmid with synthesized DNA of C. beijerinckii NRRL B593 (Epoch Biolabs) was digested with Acc65I and SalI and cloned into plasmid pZE12-luc cut with the same enzymes, creating pTA34. To replace the replication origin and the ampicillin resistance gene with p15A and the kanamycin resistance gene, pZA31-luc was digested with AatII and AvrII. The shorter fragment was purified and cloned into the plasmid cut with the same enzymes to create pTA36. The codon usage of the synthesized DNA was optimized in the same way as the adh gene from T. brockii. This sequence is shown in the supplemental material.
Medium and cultivation.
As the preculture medium, SD-7 containing 2% glucose was prepared (NH4Cl, 7.0 g/liter; KH2PO4, 1.5 g/liter; Na2HPO4, 1.5 g/liter; K2SO4, 0.35 g/liter; MgSO4·7H2O, 0.17 g/liter; trace elements, 0.8 ml/liter; yeast extract, 5 g/liter) as described previously (13). SD-8 medium (NH4Cl, 7.0 g/liter; KH2PO4, 7.5 g/liter; Na2HPO4, 7.5 g/liter; K2SO4, 0.85 g/liter; MgSO4·7H2O, 0.17 g/liter; trace elements, 0.8 ml/liter; yeast extract; 10 g/liter) (13) containing 2% glucose was used for fermentations. The trace element solution contained the following (in grams per liter of 5 M HCl): FeSO4·7H2O, 40.0; MnSO4·H2O, 10.0; Al2(SO4)3, 28.3; CoCl2·6H2O, 4.0; ZnSO4·7H2O, 2.0; Na2MoO4·2H2O, 2.0; CuCl2·2H2O, 1.0; and H3BO4, 0.5. Antibiotics were added as appropriate (ampicillin, 100 µg/ml, and chloramphenicol, 40 µg/ml).
Preculture with 5 ml of SD-7 medium in a test tube was performed at 37°C overnight (17 h) on a rotary shaker (250 rpm); 250 µl of overnight culture was inoculated into 25 ml of SD-8 medium in a 250-ml flask with baffles. When the optical density at 600 nm was
1.0 (3 h), 0.1 mM IPTG (isopropyl-β-D-thiogalactopyranoside) was added for induction. Cells were grown at 37°C for 30.5 h on a rotary shaker (250 rpm) and harvested at 0, 3, 6.5, 9.5, 12, 24, 28.5, and 30.5 h.
Glucose and fermentation product analysis.
Glucose was measured using a glucose analysis reagent (Sigma Aldrich). Various alcohols were quantified by gas chromatography with a flame ionization detector. The reported analysis conditions (21) were modified for this study. The system consisted of a model 5890A gas chromatograph (Hewlett-Packard, Avondale, PA) and a model 7673A automatic injector, sampler, and controller (Hewlett-Packard). The separation of alcohol compounds was carried out with a DB-WAX capillary column (30 m; 0.32-mm inside diameter; 0.50-µm film thickness; Agilent Technologies). The gas chromatograph oven temperature was initially held at 40°C for 5 min and raised with a gradient of 15°C/min to 120°C, followed by a gradient of 50°C/min to 230°C, where it was held for 4 min. Helium was used as the carrier gas, with 9.3-lb/in2 inlet pressure. The injector and detector were maintained at 225°C; 0.5 µl supernatant of the culture broth was injected in split-injection mode (1:15 split ratio). 1-Propanol was used as the internal standard.
For other secreted metabolites, filtered supernatant (20 µl) was applied to an Agilent 1100 high-performance liquid chromatograph equipped with an autosampler (Agilent Technologies) and a Bio-Rad Aminex HPX87 column (5 mM H2SO4; 0.6 ml/min; column temperature, 65°C; Bio-Rad Laboratories, Hercules, CA) (16). Organic acids (fumarate, lactate, citrate, pyruvate, formate, malate, acetate, and succinate) were detected using a photodiode array detector at 210 nm.
Secondary alcohol dehydrogenase enzyme assay.
Cells harvested 4 h after induction were used for enzyme assays after centrifugation. Crude extract in 50 mM Tris-chloride (pH 8) was prepared under anaerobic conditions with 0.1-mm glass beads and a Mini Bead Beater 8 (Biospec Products, Oklahoma). The assay was carried out according to the method described previously (7). SADH activities were measured by following the reduction of acetone (6.7 mM) with NADPH at 25°C under Ar. The assay mixture contained 50 mM Tris-Cl buffer (pH 7.5), 1 mM dithiothreitol, and 0.2 mM NADPH. One unit of activity is the oxidation of 1 µmol of NADPH per min.
|
|
|---|
![]() View larger version (27K): [in a new window] |
FIG. 2. Comparison of maximum isopropanol production levels by each combination of the pathway genes. ACoAAT, acetyl-CoA acetyltransferase; ACoAT, acetoacetyl-CoA transferase; ADC, acetoacetate decarboxylase; ec, E. coli; ca, C. acetobutylicum; cb, C. beijerinckii; tb, T. brockii. The error bars indicate standard deviations of at least two independent experiments.
|
![]() View larger version (18K): [in a new window] |
FIG. 3. Time course of isopropanol production by TA11(pTA39/pTA36).
|
Acetone production.
When the adh-containing plasmid was omitted from the strain, the host produced acetone by TA11 containing only pTA39 under the same conditions as those for the isopropanol production experiment. The strain continued to produce acetone until the glucose was exhausted (12 h). At 24 h, glucose was added to 111 mM, and the strain continued to produce acetone at almost the same production rate (data not shown). The cell growth and ethanol concentration displayed a tendency similar to that observed during the isopropanol production experiment. When glucose was exhausted (30.5 h), the final concentration of acetone was measured at 148.3 mM. As with the isopropanol production, no organic acids except fumaric acid (maximum concentration, 292 µM) accumulated significantly after the induction of IPTG.
|
|
|---|
30 mM with a maximum productivity of
3 mM/h (
0.18 g/liter/h) (4). The isopropanol yield at 9.5 h after inoculation was 43.5% (mol isopropanol/mol glucose). The yield was calculated from the isopropanol produced (44.8 mM) and the glucose consumed (103.0 mM) between 3 and 9.5 h: molar yield = 44.8/103.0 = 0.435. This yield is very encouraging, since the maximum theoretical yield from glucose using our production pathway is 1 mol isopropanol/mol glucose. The theoretical yield of isopropanol production was calculated based on the pathway shown in Fig. 1. One mole of glucose is converted to 2 mol acetyl-CoA and 2 mol of CO2. The two acetyl-CoAs are then condensed to form 1 mole of isopropanol, losing one additional mole of CO2. Our results showed that E. coli containing atoAD produced isopropanol at a higher concentration than the strain containing C. beijerinckii ctfAB. As Wiesenborn et al. (24) pointed out, the Km for acetate for CtfAB (1,200 mM) is much higher than that for AtoAD (53.1 mM) (1, 20). This difference in acetate affinity likely explains why AtoAD is a better enzyme for isopropanol production. Isopropanol production showed that the conversion rate of SADH from C. beijerinckii from acetone to isopropanol is much higher than that of SADH from T. brockii. Indeed, the alcohol dehydrogenase assay using crude extract showed that SADH from C. beijerinckii has a higher activity for isopropanol formation from acetone than that from T. brockii, consistent with the results of Peretz et al. (18). Although a difference in expression levels cannot be ruled out, the SADH from C. beijerinckii is a better choice for isopropanol production under our conditions. We did not investigate the exact effect of codon optimization in adh genes. However, it is generally known that the GC content of the gene affects the expression efficiency. The GC contents of SADH in C. beijerinckii and in T. brockii are 38 and 44%, respectively. These values are different from the average GC content of E. coli K-12 MG1655.
Bermejo et al. (1) demonstrated batch and glucose-fed batch cultures using a shake flask for acetone production in E. coli, utilizing a recombinant acetone pathway from C. acetobutylicum (thl ctfAB adc). This strain produced about 40 mM acetone at 24 h after inoculation in batch culture and 93 mM acetone in a glucose-fed batch culture. We also used the same medium, the same glucose concentration, and a modified version of E. coli strain B. Nevertheless, our batch production using the same gene construction (pTA41) achieved 60.3 mM of acetone at 12 h (data not shown). In shake flasks, strain TA11 containing pTA39 achieved a maximum concentration of 148.3 mM at about 30 h and a maximum productivity of 12.1 mM/h (0.70 g/liter/h) at 3 to 9.5 h. The acetone titer also exceeded that produced by wild-type C. acetobutylicum (90 mM) (1). Without further optimization of the strain and the fermentation conditions, the acetone yield at 12 h after inoculation was already 73.5% (mol/mol) of the theoretical maximum. This high yield indicates a great potential for using metabolically engineered E. coli in the industrial production of isopropanol.
Published ahead of print on 12 October 2007. ![]()
Supplemental material for this article may be found at http://aem.asm.org/. ![]()
Permanent address: Laboratory for Bioinformatics, Graduate School of Systems Biosciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»