Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Chaintreuil, C. Articles by Bailly, X. Search for Related Content PubMed PubMed Citation Articles by Chaintreuil, C. Articles by Bailly, X. Agricola Articles by Chaintreuil, C. Articles by Bailly, X.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, December 2007, p. 8018-8022, Vol. 73, No. 24
0099-2240/07/$08.00+0     doi:10.1128/AEM.01431-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Nickel Resistance Determinants in Bradyrhizobium Strains from Nodules of the Endemic New Caledonia Legume Serianthes calycina ^,

Clémence Chaintreuil,^1* Frédéric Rigault,² Lionel Moulin,¹ Tanguy Jaffré,² Joël Fardoux,¹ Eric Giraud,¹ Bernard Dreyfus,¹ and Xavier Bailly¹

Laboratoire des Symbioses Tropicales et Méditerranéennes (UMR113), IRD/CIRAD/SUPAGRO/INRA/UM2, Montpellier, France,¹ Laboratoire de Botanique et d'Ecologie Végétale, IRD, Nouméa, Nouvelle-Calédonie²

Received 27 June 2007/ Accepted 5 October 2007

Top ABSTRACT INTRODUCTION Nucleotide sequence accession... REFERENCES

 
Bradyrhizobium strains, isolated in New Caledonia from nodules of the endemic legume Serianthes calycina growing in nickel-rich soils, were able to grow in the presence of 15 mM NiCl₂. The genomes of these strains harbored two Ni resistance determinants, the cnr and nre operons. By constructing a cnrA mutant, we demonstrated that the cnr operon determines the high nickel resistance in Bradyrhizobium strains.

Top ABSTRACT INTRODUCTION Nucleotide sequence accession... REFERENCES

 
New Caledonia, an archipelago in the Pacific Ocean, is considered one of the main hotspots of biodiversity on earth (17). This is explained by both its geographical isolation and the presence of nickel-rich ultramafic soils that cover one-third of the main island. These soils contain 250-fold more nickel than is found in average soil. Moreover, they contain high concentrations of other metals and have strong deficiencies in nutritive elements (4, 22). Bacteria isolated from ultramafic soils have been shown to be adapted to these specific constraints (14). In addition, Stoppel and Schlegel (25) determined by DNA-DNA hybridization that nickel-resistant bacteria from New Caledonia soils harbor DNA fragments homologous to several nickel resistance determinants, including nre (nickel resistance), cnr (cobalt-nickel resistance), and ncc (nickel-cobalt-cadmium resistance) genes. Ultramafic ecosystems of New Caledonia are endangered due to nickel mining activities, which constitute the main economical resource of the islands. Therefore, restoration of current or old mining sites (i.e., bare slag heaps) is a priority for preservation of the unique diversity of New Caledonia's ecosystems. This first requires reestablishment of a vegetal cover to stabilize the soils and to control water flow. Native nitrogen-fixing trees belonging to the genus Serianthes appear to be among the best candidates for these purposes because of their capacity to fix nitrogen in symbiosis with rhizobia and to improve the fertility of mine spoils (3, 6). However, until now there has been no information available about the taxonomic and functional diversity of the symbiotic rhizobia associated with the genus Serianthes in New Caledonia. In order to obtain insight into the symbiotic partners associated with Serianthes calycina, we isolated bacteria from nodules obtained from two ultramafic nickel-rich soils (Mont Dore and Tiébaghi) and from one calcareous nickel-free soil (Nouméa Anse Vata) (Table 1). Ten strains were isolated and characterized by determining (i) their taxonomic positions, (ii) their abilities to nodulate plants and fix nitrogen symbiotically, (iii) their capacity to grow on high nickel concentrations, and (iv) the presence of known nickel resistance determinants (nre and cnr operons). Furthermore, by constructing a cnrA mutant of strain STM2464, we confirmed that the cnr operon was responsible for the high nickel resistance of the most tolerant strains.

View this table: [in this window] [in a new window]

TABLE 1. Symbiotic properties and nickel resistance genes in rhizobial strains isolated from different New Caledonia soils

Soil analyses and isolation of rhizobia from nodules were carried out as described previously (2, 5). Total genomic DNA was extracted as previously described by Pitcher et al. (21). A nearly full-length 16S rRNA gene was amplified using primers FGPS-6 (GGACAGTTAGATCTTGGCTACG) and FGPS-1509 (AAGGAGGGGATCCAGCCGCA) as described by Normand et al. (19). The sequences of the PCR products were analyzed using the algorithm BLASTN (1) to identify the most related sequences. Multiple alignment was performed with ClustalX, version 1.63b (28). Phylogenetic analysis was performed using a distance approach (Kimura two-parameter method), and bootstrap values were obtained based on 1,000 replicates (9) using MEGA, version 3.0 (16).

All bacteria isolated from S. calycina clustered in a large group, which included the type strain of Bradyrhizobium elkanii (see Fig. S1 in the supplemental material). Within this group, three distinct clades of New Caledonia strains could be distinguished. Two strains (STM2464 and STM2465) belonged to the species B. elkanii as they shared 100% sequence similarity with each other and with two reference B. elkanii strains (LMG9520 and ORS133) and 99% sequence similarity with B. elkanii type strain USDA76. Three other strains (STM2457, STM2458, and STM2460) formed a second clade close to B. elkanii, showing 98% similarity to the B. elkanii type strain. Five strains (STM2456, STM2459, STM2461, STM2467, and STM2468) formed a third clade belonging to the genus Bradyrhizobium. This group, which also includes reference strain Ai1a-2 isolated from Costa Rica (20), is clearly distinct from the known species of Bradyrhizobium, suggesting that it could represent a new species of this genus. This analysis revealed that the main symbionts of S. calycina belong to the genus Bradyrhizobium.

All strains were first tested for in vitro nodulation on Macroptilium atropurpureum (Siratro) as described previously (8). Siratro is a host legume known to form nodules with a very broad range of Bradyrhizobium strains. All 10 strains were able to form nodules on this host plant. They showed different levels of nitrogen fixation, as estimated by plant biomass and leaf color (Table 1). To study their resistance to nickel, the 10 strains were grown on solid or liquid YM (29) medium without Ni (control) or with NiCl₂ at concentrations of 3 and 15 mM. All cultures were incubated at 28°C on a rotary shaker. Bacterial growth rates were evaluated daily for up to 14 days by measuring the optical density at 620 nm. The effect of NiCl₂ on bacterial growth is shown in Table 1 and Fig. 1. The two strains isolated from S. calycina growing in the nickel-free soil (STM2467 and STM2468) did not show any tolerance to 3 mM NiCl₂. In contrast, the eight strains isolated from ultramafic nickel-rich soils were able to grow on solid or liquid YM medium supplemented with 3 mM NiCl₂. However, the nickel tolerance varied significantly between the strains. While the growth rates of strains STM2456, STM2459, and STM2461 were strongly reduced in the presence of 3 mM NiCl₂, the growth of strains STM2464, STM2465, STM2457, STM2458, and STM2460 was hardly affected (Fig. 1). In addition, strains STM2464, STM2465, STM2457, STM2458, and STM2460 were also able to grow in the presence of 15 mM NiCl₂ in either solid or liquid medium; strains STM2464 and STM2465 were the most resistant to this high level of nickel (Table 1). When these five strains were initially grown in the presence of 15 mM NiCl₂ and then inoculated into the same medium, no growth lag phase was observed, showing that nickel resistance is inducible in these bacteria. Furthermore, these five strains were able to grow in the presence of 5 mM CoCl₂ but were inhibited by 0.8 mM CdCl₂, suggesting that the nickel resistance was conferred by a cobalt and nickel resistance determinant (e.g., the cnr operon) rather than a nickel, cadmium, and cobalt resistance determinant (e.g., the ncc operon). These results demonstrate that some Serianthes symbionts are adapted to nickel-rich environments.

View larger version (33K): [in this window] [in a new window]

FIG. 1. Bacterial growth after addition of NiCl2 or CoCl2. Optical density at 620 nm (indicated on the y axis) was measured 2 weeks after inoculation.

We studied the presence and sequence polymorphism of two resistance determinants, nreB, and nccA/cnrA, which have been found in New Caledonia soil bacteria (25). The presence of the nreB gene was analyzed by PCR using primers nreB-425F (CCTTCACGCCGACTTTCCAG) and nreB-1179R (CGGATAGGTAATCAGCCAGCA). Similarly, the presence of nccA/cnrA-like genes was analyzed by PCR amplification using primers cnrA-F (AACAAGCAGGTSCAGATCAAC) and cnrA-R (TGATCAGGCCGAAGTCSAGCG). These primers were designed based on conserved motifs present in nreB and nccA/cnrA sequences available in data banks, respectively. Cupriavidus (Ralstonia) metallidurans strain CH34 was used as a positive control. The different PCR products obtained were sequenced, aligned with nreB and cnrA/nccA/czcA sequences of reference strains, and translated into amino acids, and phylogenetic analyses were independently performed for each of these nickel resistance markers. The resulting phylogenetic trees, constructed by a distance approach ("Poisson p" distance; neighbor joining and bootstrap analysis based on 1,000 pseudoreplicates), are shown in Fig. 2A and B. Amplified nreB gene fragments (725 bp) were obtained from all eight strains growing on 3 mM NiCl₂ (Table 1). The NreB protein sequences of the eight New Caledonia Bradyrhizobium strains formed two main branches; the first branch was subdivided into two clades (99% homology) grouping strains STM2456 to STM2460 (100% identity) and strain STM2464, and the second branch contained strains STM2461 and STM2465 (100% sequence identity) (Fig. 2A). These two branches are closely related to Nitrobacter sp. strain Nb-311A (66% sequence identity) and Magnetospirillum magnetotacticum (62% similarity). They share 61% amino acid identity with the sequences from C. metallidurans and Alcaligenes xylosoxidans, two reference organisms for which the nickel resistance function of the nre operon has been demonstrated (11, 24, 26). Conversely, amplified nccA/cnrA gene fragments (1,066 bp) were obtained only from the five strains growing on 15 mM NiCl₂, which also contained the nreB gene (Table 1). The CnrA protein sequences from the five strains resistant to 15 mM NiCl₂ were analyzed together with reference sequences encoded by both the NccA/CnrA genes and CzcA genes (i.e., a homolog involved in the resistance to cobalt, zinc, and cadmium). As shown in Fig. 2B, reference sequences of NccA/CnrA and CzcA determinants form two well-separated branches. The New Caledonia CnrA sequences form a single branch much closer to the NccA/CnrA clade than the CzcA clade. This New Caledonia branch shares 68, 63, and 62% amino acid identity with the closely related sequences from Nitrobacter sp. strain Nb-311A, Nitrobacter hamburgensis X14, and the photosynthetic organism Bradyrhizobium sp. strain BTAi1, respectively. It also shares 51% amino acid identity with NccA from A. xylosoxidans, 49% amino acid identity with CnrA from C. metallidurans, and 47% amino acid identity with CzcA from C. metallidurans; all of the latter resistance determinants were functionally demonstrated in these organisms (7, 18, 27).

View larger version (31K): [in this window] [in a new window]

FIG. 2. Neighbor-joining phylogenies of metal resistance determinants based on amino acid alignments of (A) NreB (nickel resistance) and (B) NccA/CnrA (nickel-cobalt-cadmium/cobalt-nickel resistance) and the close homolog CzcA (cobalt-zinc-cadmium resistance). New strains in this study are indicated by bold type. Scale bars = number of substitution per site. The values at the nodes are bootstrap percentages based on an analysis of 1,000 replicates using distance criteria (only values of >50% are shown). The metal targeted by the resistance marker is indicated when a functional demonstration has been published for the strain used in the phylogeny, as follows: Ni, nickel (11); Cd/Zn, cadmium/zinc (13); Co/Zn/Cd (7), Co/Ni: cobalt/nickel (12) and Ni/Co/Cd: nickel/cobalt/cadmium (24). The accession numbers for NreB homologs are as follows (clockwise from Magnetospirillum magnetotacticum): ZP_00051068, ZP_01018645, NP_436142, AAR82963, AAK38164, EAM36311, ZP 00654165, AAZ19430, YP_145657, AAA72441, ZP_01038231, BAD57616, ZP_00413240, AAN05252, ZP_01038464, ZP_01037380, ZP_00964062, ZP_00955873, ZP_00621039, AAV94683, and ZP_010455481. The accession numbers for CzcA homologs (clockwise from Methylobacillus flagellatus) are as follows: ZP00564496, YP315085, NP841672, YP343437, AAM38995, YP245184, ZP00415898, ZP00242273, YP527427, ZP00803354, NP947401, ZP01199977, YP145656, CAB82453, Q44586, YP161705, YP497419, ZP00577412, ZP01039337, AAK24689, ZP00577310, ZP01048443, ZP00860443, ZP00625303, YP276927, ZP00899495, YP349350, NP251210, CAB56471, ZP00978841, YP373186, NP522054, and ZP00599347. Abbreviations: Sil., Silicibacter; Leg., Legionella; C. met., Cupriavidus metallidurans; Rh., Rhodopseudomonas; X., Xanthomonas; Xa., Xanthobacter; P., Pseudomonas; Sp., Sphingopyxis; No., Novosphingobium; Al., Alcaligenes; B., Burkholderia; Sac., Saccharophagus; Ni., Nitrobacter.

As we observed a clear correlation between high nickel resistance and the presence of the cnrA gene, but not the presence of the nreB gene, we performed a functional analysis of the former marker. To create the STM2464cnrA mutant, the PCR fragment corresponding to the cnrA region from strain STM2464, obtained as previously described, was cloned into the pGEM-T vector (Promega Corporation, Madison, WI). The lacZ-Km^r cassette of pKOK5 (15) was then inserted into the unique BamHI site present in this region. The construct liberated by ApaI/SpeI double digestion was then introduced into the pJQ200mp18 suicide vector (23) and finally delivered by conjugation into STM2464 as described previously (10). Double recombinants were selected on sucrose and confirmed by PCR. The effects of 3 and 15 mM NiCl₂ on the growth of strain STM2464 and the STM2464cnrA mutant are shown in Fig. 1. Both the wild type and the mutant strain were able to grow on YM medium supplemented with 3 mM NiCl₂. In contrast, no growth of mutant strain STM2464cnrA was detected with 15 mM NiCl₂ (Fig. 1). In addition, mutant strain STM2464cnrA also was not able to grow on 5 mM CoCl₂ (Fig. 1). These results clearly demonstrate that resistance to high levels of nickel and cobalt in Bradyrhizobium sp. strain STM2464 involves the cnr operon.

In order to determine if the cnr operon could confer to Bradyrhizobium sp. strain STM2464 a selective advantage for establishment of the symbiotic association with its host plant, S. calycina, the wild-type and mutant strains were inoculated onto young S. calycina plants growing in pots containing 0 or 15 mM NiCl₂ per kg of soil. Both strains formed effective nodules within 4 weeks. No difference in nodulation between the wild type and the mutant strain was observed in the nickel-free pots. In contrast, in the presence of 15 mM NiCl₂, the number and size of nodules were doubled when the wild-type strain was used, showing that nodulation by mutant strain STM2464cnrA was affected by the presence of Ni. Taken together, our data suggest that the cnr operon found in some Bradyrhizobium strains gives these strains a competitive advantage for survival in metal-rich environments and therefore also for symbiotic efficiency that benefits the endemic leguminous tree. It remains to be determined whether the cnr operon was acquired by lateral gene transfer or whether it is an ancestral characteristic that is specifically conserved in the bacteria living in nickel-rich ultramafic soils.

Top ABSTRACT INTRODUCTION Nucleotide sequence accession... REFERENCES

 
The nreB gene sequences of strains STM2456, STM2457, STM2458, STM2459, STM2460, STM2461, STM2464, and STM2465 have been deposited in the EMBL database under accession numbers AM236914, AM236915, AM179845, AM179846, AM179847, AM179848, AM179851, and AM236916, respectively. The cnrA gene sequences of strains STM2457, STM2458, STM2460, STM2464, and STM2465 have been deposited in the EMBL database under accession numbers AM260684, AM260685, AM260686, AM260687, and AM260688, respectively.

 
We thank Michel Lebrun and Nico Nouwen for reviewing the manuscript, Laure Hannibal for technical assistance, and Isabelle Navarro for helpful discussions.

This work was supported by IRD.

 
* Corresponding author. Mailing address: LSTM, Campus International de Baillarguet, TA A-82/J, 34398 Montpellier Cedex 5, France. Phone: (334) 67 59 38 51. Fax: (334) 67 59 38 02. E-mail: clemence.chaintreuil{at}mpl.ird.fr

Published ahead of print on 19 October 2007.

Supplemental material for this article may be found at http://aem.asm.org/.

Top ABSTRACT INTRODUCTION Nucleotide sequence accession... REFERENCES

 

1
1. Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lippman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
2
2. Becquer, T., E. Bourdon, and J. Pétard. 1995. Disponibilité du nickel le long d'une toposéquence de sols développés sur roches ultramafiques de Nouvelle-Calédonie. C. R. Acad. Sci. Paris 321:585-592.
3
3. Bradshaw, A. D. 1997. Restoration of mined lands—using natural processes. Ecol. Eng. 8:255-269.[CrossRef]
4
4. Brooks, R. R. 1987. Serpentine and its vegetation. A multidisciplinary approach. Grooms Helm, London, United Kingdom.
5
5. Chaintreuil, C., E. Giraud, Y. Prin, J. Lorquin, A. Bâ, M. Gillis, P. de Lajudie, and B. Dreyfus. 2000. Photosynthetic bradyrhizobia are natural endophytes of the African wild rice Oryza breviligulata. Appl. Environ. Microbiol. 66:5437-5447.[Abstract/Free Full Text]
6
6. Cooke, J. A., and M. S. Johnson. 2002. Ecological restoration of land with particular reference to the mining of metals and industrial minerals: a review of theory and practice. Environ. Rev. 10:41-71.[CrossRef]
7
7. Diels, L., Q. Dong, D. van der Lelie, W. Baeyens, and M. Mergeay. 1995. The czc operon of Alicagenes eutrophus CH34: from resistance mechanism to the removal of heavy metals. J. Ind. Microbiol. 14:142-153.[CrossRef][Medline]
8
8. Ezura, H., N. Nukui, K.-I. Yuhashi, and K. Minamisawa. 2000. In vitro plant regeneration in Macroptilium atropurpureum, a legume with a broad symbiont range for nodulation. Plant Sci. 159:21-27.[Medline]
9
9. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:424-429.
10
10. Giraud, E., L. Hannibal, J. Fardoux, M. Jaubert, P. Jourand, B. Dreyfus, J. N. Sturgis, and A. Verméglio. 2004. Two distinct crt gene clusters for two different functional classes of carotenoid in Bradyrhizobium. J. Biol. Chem. 279:15076-15083.[Abstract/Free Full Text]
11
11. Grass, G., B. Fan, B. Rosen, K. Lemke, H. Schlegel, and C. Rensing. 2001. NreB from Achromobacter xylosoxidans 31A is a nickel-induced transporter conferring nickel resistance. J. Bacteriol. 183:2803-2807.[Abstract/Free Full Text]
12
12. Grass, G., C. Grosse, and D. H. Nies. 2000. Regulation of the cnr cobalt and nickel resistance determinant from Ralstonia sp. strain CH34. J. Bacteriol. 182:1390-1398.[Abstract/Free Full Text]
13
13. Hassan, M. T., D. van der Lelie, D. Springael, U. Romling, N. Ahmed, and M. Mergeay. 1999. Identification of a gene cluster, czr, involved in cadmium and zinc resistance in Pseudomonas aeruginosa. Gene 238:417-425.[CrossRef][Medline]
14
14. Hery, M., L. Philippot, E. Mériaux, F. Poly, X. Roux, and E. Navarro. 2005. Nickel mine spoils revegetation attempts: effect of pioneer plants on two functional bacterial communities involved in N-cycle. Environ. Microbiol. 7:486-498.[CrossRef][Medline]
15
15. Kokotek, W., and W. Lotz. 1989. Construction of a lacZ-kanamycin-resistance cassette, useful for site-directed mutagenesis and as a promoter probe. Gene 84:467-471.[CrossRef][Medline]
16
16. Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5:150-163.[Abstract/Free Full Text]
17
17. Myers, N., R. A. Mittermeier, C. G. Mittermeier, G. A. B. da Fonseca, and J. Kent. 2000. Biodiversity hotspots for conservation priorities. Nature 403:853-858.[CrossRef][Medline]
18
18. Nies, D. H. 1995. The cobalt, zinc, and cadmium efflux system CzcABC from Alcaligenes eutrophus functions as a cation-proton antiporter in Escherichia coli. J. Bacteriol. 177:2707-2712.[Abstract/Free Full Text]
19
19. Normand, P., B. Cournoyer, S. Nazaret, and P. Simonet. 1992. Analysis of a ribosomal rRNA operon in the actinomycete Frankia. Gene 111:119-124.[CrossRef][Medline]
20
20. Parker, M. A. 2004. rRNA and dnaK relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legume trees in Costa Rica. Syst. Appl. Microbiol. 27:334-342.[CrossRef][Medline]
21
21. Pitcher, D. G., N. A. Saunders, and R. J. Owen. 1989. Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett. Appl. Microbiol. 8:151-156.
22
22. Proctor, J., and L. Nagy. 1992. Ultramafic rocks and their vegetation: an overview, p. 469-494. In A. J. M. Baker, J. Proctor, and R. D. Reeves (ed.), The vegetation of ultramafic (serpentine) soils. Intercept Ltd., Andover, United Kingdom.
23
23. Quandt, J., and M. F. Hynes. 1993. Versatile suicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene 127:15-21.[CrossRef][Medline]
24
24. Schmidt, T., and H. G. Schlegel. 1994. Combined nickel-cobalt-cadmium resistance encoded by the ncc locus of Alicagenes eutrophus 31A. J. Bacteriol. 176:7045-7054.[Abstract/Free Full Text]
25
25. Stoppel, R. D., and H. G. Schlegel. 1995. Nickel-resistant bacteria from anthropogenically nickel-polluted and naturally nickel-percolated ecosystems. Appl. Environ. Microbiol. 61:2276-2285.[Abstract]
26
26. Stoppel, R. D., M. Meyer, and H. G. Schlegel. 1995. The nickel resistance determinant cloned from the enterobacterium Klebsiella oxytoca: conjugational transfer, expression, regulation and DNA homologies to various nickel-resistant bacteria. Biometals 8:70-79.[Medline]
27
27. Taghavi, S., H. Delanghe, C. Lodewyckx, M. Mergeay, and D. van der Lelie. 2001. Nickel-resistance-based minitransposons: new tools for genetic manipulation of environmental bacteria. Appl. Environ. Microbiol. 67:1015-1019.[Abstract/Free Full Text]
28
28. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL_X Windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.[Abstract/Free Full Text]
29
29. Vincent, J. M. 1970. A manual for the practical study of root-nodule bacteria. Blackwell Scientific Publication Ltd., Oxford, United Kingdom.

---

Applied and Environmental Microbiology, December 2007, p. 8018-8022, Vol. 73, No. 24
0099-2240/07/$08.00+0     doi:10.1128/AEM.01431-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Chaintreuil, C. Articles by Bailly, X. Search for Related Content PubMed PubMed Citation Articles by Chaintreuil, C. Articles by Bailly, X. Agricola Articles by Chaintreuil, C. Articles by Bailly, X.