Improved Fluorescent In Situ Hybridization Method for Detection of Bacteria from Activated Sludge and River Water by Using DNA Molecular Beacons and Flow Cytometry

Fluorescent in situ hybridization (FISH) remains a key techniquein microbial ecology. Molecular beacons (MBs) are self-reportingprobes that have potential advantages over linear probes forFISH. MB-FISH strategies have been described using both DNA-basedand peptide nucleic acid (PNA)-based approaches. Although recentreports have suggested that PNA MBs are superior, DNA MBs havesome advantages, most notably cost. The data presented heredemonstrate that DNA MBs are suitable for at least some FISHapplications in complex samples, providing superior discriminatorypower compared to that of corresponding linear DNA-FISH probes.The use of DNA MBs for flow cytometric detection of Pseudomonasputida resulted in approximately double the signal-to-noiseratio of standard linear DNA probes when using laboratory-growncultures and yielded improved discrimination of target cellsin spiked environmental samples, without a need for separatewashing steps. DNA MBs were also effective for the detectionand cell sorting of both spiked and indigenous P. putida fromactivated sludge and river water samples. The use of DNA MB-FISHpresents another increase in sensitivity, allowing the detectionof bacteria in environmental samples without the expense ofPNA MBs or multilaser flow cytometry.

INTRODUCTION

Top

Introduction

Fluorescent in situ hybridization (FISH) with rRNA-targetedprobes is a widely used technique (1, 3, 7) that enables phylogeneticidentification of individual cells without the need for priorcultivation. Analysis of samples is often achieved using fluorescencemicroscopy (3, 7) and flow cytometry (2, 16, 17) to enumerateand further study cells of interest. In most environmental samples,bacteria will be slow growing and, hence, will have low ribosomenumbers. Consequently, the signal obtained from target cellsafter FISH will be low, and target cells may be difficult todistinguish from debris and nontarget cells. Accordingly, therehas been much effort to increase the fluorescent signal fromtarget cells (2, 6, 10, 12, 13) to improve the signal-to-noiseratio (S:N).

A recent advance in FISH technologies is the replacement ofstandard linear oligonucleotide probes with molecular beacons.Peptide nucleic acid (PNA) and DNA molecular beacons have beenused successfully for the detection of in situ rRNA (15, 20).Molecular beacons are a type of nucleic acid probe used to detectspecific nucleic acids in homogenous solutions (14). Designedas probes for reporting the presence of specific amplicons inreal-time PCR, molecular beacons substantially increase in fluorescencein the presence of target nucleic acid sequences (reviewed inreference 5). One key advantage in using molecular beacons wouldbe to help minimize noise, thereby also improving the S:N andsubsequent detection of cells using FISH.

This study directly compared the discriminatory powers of FISHusing linear probes and molecular beacons when samples wereanalyzed using single-laser flow cytometry. A standard monolabeledfluorescent linear probe and a DNA beacon that targeted thesame region on the 16S rRNA molecule (specific for the majorityof pseudomonads) were designed. The pseudomonads were targetedin this study due to their ubiquity and importance in many areasof environmental microbiology, especially applications to environmentalproblems. After optimization of hybridization conditions forthe linear probe and beacon, the S:N was directly compared forthe two types of probe in pure culture using single-laser flowcytometry. Both probes were then used to analyze environmentalsamples of water and activated sludge, with and without theartificial addition of target cells.

Comparison of molecular beacons and linear probes with laboratory cultures.

Top

Comparison of molecular beacons...

Pseudomonas putida (PaW340) (19) and Escherichia coli (NCIMB12210)were grown aerobically on a rotary shaker in buffered peptonewater at 28°C and 37°C, respectively. Cells were fixedwith 3 volumes 4% fresh paraformaldehyde in phosphate-bufferedsaline (PBS) (pH 8.0) for 1 h at room temperature (9) beforebeing washed with PBS and resuspended in PBS/absolute ethanol(1:1; vol/vol). Fixed cells were stored at –20°C.

The oligonucleotide probe Ps440 (Ps440LP; CCCTTCCTCCCAACTT),a modification of a previous oligonucleotide probe (4), is complementaryto a 16S rRNA region present in many Pseudomonas species butnot in E. coli. The Ps440LP sequence was used as the basis forthe molecular beacon (Ps440MB). Stems were designed using analgorithm run in Microsoft Excel (11) (ACGGGCCCTTCCTCCCAACTTCCCGT;stems are in bold). All probes used were labeled with 5' 6-carboxyfluorescein;the beacons were also labeled with 3' DABCYL.

Flow cytometric analysis of cells was performed using a FACStarPlus flow cytometer (Becton Dickinson, Cowley, United Kingdom)using a single 488-nm laser at 25 mW. The forward scatter wasset to the logarithmic gain and used to trigger events. 6-Carboxyfluoresceinfluorescence at 520 nm was analyzed through a fluorescence detector1 (photo multiplier tube, 750 V) with logarithmic gain.

The hybridization of both Ps440LP and Ps440MB was optimizedusing P. putida as a positive control and E. coli as a negativecontrol. The S:N was calculated by dividing the mean fluorescentintensity (MFI) of P. putida cells by that of E. coli cells.Approximately 2 x 10⁵ cells were added to 50 µl hybridizationbuffer containing between 0.02 µM and 0.66 µM probefor up to 5 h at temperatures between room temperature and 65°C.The optimal hybridization buffer contained 0.9 M NaCl, 20 mMTris-HCl (pH 7.2), 0.1% sodium dodecyl sulfate (SDS) (16). Otherhybridization buffers tested contained NaCl and MgCl₂, and MgCl₂at various concentrations with Tris-HCl and SDS. The optimalhybridization conditions were determined to be 0.1 µMprobe for 1 h at 55°C for both probes. Ps440MB and Ps440LPgave S:N of 14.2 (MFI: P. putida, 133.4, and E. coli, 9.4) and7.9 (MFI: P. putida, 147.3, and E. coli, 18.7), respectively.The increase in the S:N was mainly a result of the decreasein background fluorescence (Fig. 1). The increase in the S:Nmay be due to closed molecular beacons being "dark" unless hybridizedto a target, whereas linear probes are of constant fluorescencewhether hybridized or in solution.

View larger version (23K):
[in this window]
[in a new window]

FIG. 1. Flow cytometry histograms showing fluorescence of cells after hybridization with Ps440MB and Ps440LP in optimal conditions. (A) E. coli cells hybridized with Ps440MB. (B) E. coli cells hybridized with Ps440LP. (C) P. putida cells hybridized with Ps440MB. (D) P. putida cells hybridized with Ps440LP.

The effect of posthybridization washing was also investigated,by the centrifugation of hybridized cells followed by resuspensionin PBS (16). SDS was included in the hybridization buffer bothto increase probe accessibility into the cells and to reduceclumping upon washing. Centrifugation was performed at 2,700x g or 11,900 x g for 30 seconds to 5 min. While the S:N increasedfor both probes, the percentage of single cells decreased byup to 30%, presumably because of clumping, and up to 50% ofcells were lost. Due to this, cell washing should be avoidedwhen enumeration is important (16) and also since it may causedamage to and clumping of larger cells (13). Concentration,fixation, and washing of cells on filters also cause cell loss(13). Thus, the use of molecular beacons for FISH representsa development that reduces the need for washing and consequentlyreduces cell clumping and loss.

FISH detection of target bacteria in river water and activated sludge.

Top

Fish detection of target...

Activated sludge samples were taken from Countess Wear sewagetreatment works, Exeter, United Kingdom. Countess Wear is amedium-scale municipal plant, serving $~$ 150,000 population equivalents,taking domestic and industrial wastes. Samples were preparedaccording to previous protocols (8) and then fixed and stored(as described above) at a concentration of 10⁸ cells per ml.Before fixation, culturable counts were made in duplicate onC-F-C agar (Oxoid, Basingstoke, United Kingdom) to estimatethe numbers of fluorescent pseudomonads. To test the system,approximately 500 fixed P. putida cells per microliter of fixedsample were added to a subset of samples. Known concentrationsof fluorescent beads were added to samples to measure the volumeof sample analyzed and permit the calculation of the numberof target cells per volume of original sample.

Samples were hybridized with Ps440LP, Eub338' (2) (to act asa nonspecific binding control for linear probes), Ps440MB, andan entirely separate beacon, xylE MB (CGCTCGCGACCTATGACCTGTTCACCGAGCG)(J. Lenaerts et al., unpublished data) (to act as a nonspecificbinding control for beacons). Molecular beacons proved to bemore powerful than linear probes at discriminating target cellsfrom debris and nontarget cells (Fig. 2). This increase in discriminatorypower is because molecular beacons increase the S:N by reducingbackground fluorescence. Hence, FISH with molecular beaconsallows increased discrimination of target events due to fewernonspecific events appearing within the same region of the flowcytometry dot plot (Fig. 2).

View larger version (27K):
[in this window]
[in a new window]

FIG. 2. Flow cytometry dot plots of activated sludge samples, with and without fixed exponential-phase P. putida cells added, hybridized with Ps440MB (A and C), Ps440LP (B and D), xylE MB (E), and Eub338' (F). Samples amended with P. putida cells are shown in panels C and D. The inset rectangles highlight the region where labeled target events should appear. All plots display 5,000 events.

The numbers of target cells were calculated by subtracting thecounts of the nonspecific binding controls (Eub338' and xylEMB) from the total counts (Ps440LP and Ps440MB). Where targetcells were added, Ps440MB detected significantly more cellswithout any posthybridization wash step than Ps440LP (P = 0.047;mean cell count of 418 compared to mean cell count of 326, respectively,per microliter of fixed sample). The number of target cellsdetected decreased after washing. The numbers of cells detectedby Ps440MB decreased significantly (P = 0.010). The decreasein cell numbers detected by Ps440LP was not significant (P =0.077). There was no significant difference between the numbersof target cells detected with Ps440MB and Ps440LP after washing(P = 0.550). Before washing, the molecular beacon enabled thedetection of significantly more target cells than the linearprobe, due to its superior S:N. It is proposed that after washing,both probes detected lower but similar numbers of target cells,presumably due to both approaches providing useful S:N values,but with fewer cells detected in total due to losses from thewashing steps. Because molecular beacons increase the S:N byreducing background fluorescence, the area on flow cytometrydot plots occupied by cells with low cellular rRNA contentsis made more clear, as noise is reduced (Fig. 2). As naturalenvironments are rarely as rich in nutrients as laboratory cultureconditions, the cellular rRNA content of most cells in environmentalsamples is low, and the ability to detect these cells is important.

Water was collected from a nontidal region of the river Exe(Ordnance Survey grid reference SX914923) in July 2004. Theriver flow was normal for the time of year. To maximize targetcell numbers, the contents of 25 liters of river water wereconcentrated using tangential flow filtration and centrifugationto a 10-ml volume. Culturable counts were made before fixation(as above).

For both river water and activated sludge samples, molecularbeacons detected more target cells than linear probes in everysample analyzed (Table 1). However, the increases in cell numbersdetected with Ps440MB were not significant, probably due tothe large variability within the samples and due to target cellsbeing very rare (<0.01%).

View this table:
[in this window]
[in a new window]

TABLE 1. Detection of indigenous pseudomonads in environmental samples by FISH and culturable counts

One thousand target events (and nontarget events) were sortedby flow cytometry from activated sludge samples hybridized withboth Ps440LP and Ps440MB. Target events were confirmed as pseudomonadsby PCR and restriction digests (18). The PCR products from sampleshybridized with Ps440MB gave pseudomonad-specific products withhigher relative intensities (RI; calculated by Jasc Paint ShopPro) than those hybridized with Ps440LP (Ps440MB RI of 32.5compared to Ps440LP RI of 9.8). For negative controls, nonspecificevents were also sorted and were used as a PCR template (Ps440MBnonspecific RI of 6.2 and Ps440LP nonspecific RI of 7.2). Theseresults again confirm the higher discriminatory power of molecularbeacons over standard linear probes.

Alternative protocols are available that allow better detectionof target cells using flow cytometry. One such protocol usesdual-laser flow cytometry, where only events stained with aDNA dye are analyzed for the presence of the specific FISH probe(17). Dual-laser flow cytometry requires both a substantiallymore expensive instrument and the use of more complex stainingprocedures. FISH using a probe labeled with an enzyme to amplifythe signal intensity has also been used (13). Again, this techniqueintroduces more steps to the staining protocol and, due to thesize of the enzyme complex, is limited to easily permeabilizedbacteria. The technique presented in this work uses a simpleprotocol which has a greater potential for automation. Thus,a much-higher sample throughput can be achieved.

PNA beacons have also been used to achieve better discriminatorypower (using signal-laser flow cytometry), but low signal-to-noiseratios and long hybridization times reportedly hindered DNAbeacons (20). DNA beacons cost substantially less than PNA beacons,and thus are more accessible to a higher number of microbialecology labs. This study demonstrates that DNA beacons can beused for FISH in laboratory and environmental samples to obtainbetter discriminatory power than that of standard monolabeledfluorescent linear probes. The use of DNA beacons together withsingle-laser flow cytometry presents a method that does nothave the associated expense of PNA beacons or dual-laser flowcytometry. The protocol is also simpler than those using washingsteps and/or enzymatically amplified signals.

ACKNOWLEDGMENTS

J.L. was supported by the Biotechnological and Biological SciencesResearch Council (Swindon, United Kingdom).

FOOTNOTES

* Corresponding author. Mailing address: Dako UK Ltd., Denmark House, Angel Drove, Ely, Cambridgeshire CB7 4ET, United Kingdom. Phone: 44-1353669911. Fax: 44-1353668989. E-mail: jeremy.lenaerts{at}dako.com.

Published ahead of print on 2 February 2007.

REFERENCES

Top