This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnson, E. F.
Right arrow Articles by Mukhopadhyay, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, E. F.
Right arrow Articles by Mukhopadhyay, B.
Agricola
Right arrow Articles by Johnson, E. F.
Right arrow Articles by Mukhopadhyay, B.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, June 2008, p. 3591-3595, Vol. 74, No. 11
0099-2240/08/$08.00+0     doi:10.1128/AEM.00098-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Coenzyme F420-Dependent Sulfite Reductase-Enabled Sulfite Detoxification and Use of Sulfite as a Sole Sulfur Source by Methanococcus maripaludis{triangledown}

Eric F. Johnson1 and Biswarup Mukhopadhyay1,2,3*

Virginia Bioinformatics Institute,1 Departments of Biochemistry,2 Biological Sciences, Virginia Polytechnic Institute and State University, Blacksburg, Virginia3

Received 12 January 2008/ Accepted 19 March 2008


arrow
ABSTRACT
 
Coenzyme F420-dependent sulfite reductase (Fsr) of Methanocaldococcus jannaschii, a sulfite-tolerant methanogen, was expressed with activity in Methanococcus maripaludis, a sulfite-sensitive methanogen. The recombinant organism reduced sulfite to sulfide and grew with sulfite as the sole sulfur source, indicating that Fsr is a sulfite detoxification and assimilation enzyme for methanogens and that M. maripaludis synthesizes siroheme.


arrow
INTRODUCTION
 
Methanogenic archaea are generally sensitive to sulfite (1). This oxyanion inactivates methyl-coenzyme M reductase (3, 13), which is essential for energy generation in a methanogen (25). Yet certain methanogens not only tolerate sulfite but also use it as a sole sulfur source (7, 8, 17). It has recently been shown that for Methanocaldococcus jannaschii, a hyperthermophilic, strictly hydrogenotrophic and methanogenic archaeon of ancient lineage isolated from a deep-sea hydrothermal vent (4, 10), this ability is linked to the sulfite-induced expression of a coenzyme F420-dependent sulfite reductase (Fsr). This enzyme reduces sulfite to sulfide (8), an essential nutrient for the organism (10). Fsr is a structural and functional chimera of two enzymes; the N-terminal half of Fsr represents F420H2 dehydrogenase (FpoF or FqoF), and the C-terminal half is a homolog of DsrA or DsrB subunits of siroheme containing dissimilatory sulfite reductases (Dsr) (8). FpoF is present in certain late-evolving methylotrophic methanogens, and FqoF is found in the sulfate-reducing archaeon Archaeoglobus fulgidus (2, 6). Dsr is found in a group of anaerobic bacteria and certain archaea, such as A. fulgidus, that utilize sulfate as a terminal electron acceptor for anaerobic respiration (24). Fsr homologs are present in Methanothermobacter thermautotrophicus, Methanopyrus kandleri, and Methanococcoides burtonii (9). The cell extract Fsr level and the activity of purified Fsr are rather high and considered to be of a catabolic type (8). A preliminary study indicated that Fsr might associate with the membrane; however, the data could not rule out the possibility of Fsr being part of a large complex appearing in a pellet fraction upon centrifugation at 160,000 x g (9). These observations established sulfite detoxification and assimilation roles for Fsr and raised the question of whether the difference between M. jannaschii and sulfite-sensitive methanogens with respect to sulfite metabolism is defined only or primarily by Fsr. One approach for answering this question would be to test whether an M. jannaschii {Delta}fsr strain is sensitive to sulfite. However, this hyperthermophile is not currently amenable to genetic analysis. Methanococcus maripaludis, a genetically tractable (12, 19-21) and mesophilic methanogen with an optimal growth temperature of 37°C (4, 22), lacks an Fsr homolog (8) and is sensitive to sulfite (see below). It is also a close relative of M. jannaschii (4). Therefore, in this study, M. maripaludis was used to perform a gain-of-function test.


arrow
Growth experiments.
 
Methanococcus maripaludis S2 (23) was grown with H2 and CO2 as methanogenic substrates in a modified McN mineral medium (23) of the following composition: K2HPO4, 0.72 mM; KCl, 4.02 mM; NaHCO3, 53.33 mM; NaCl, 336.87 mM; MgCl2·6H2O, 49.19 mM; NH4Cl, 18.7 mM; CaCl2·2H2O, 4 mM; Na2S·9H2O or Na2SO3 (as a medium reductant and sulfur source, added to anaerobic sterile medium from a stock), 2 mM; resazurin, 0.0001%; and 10 ml of a 100-fold-concentrated mineral solution per ml. The composition of mineral solution was the same as that described previously (15), except the concentrations of Na2SeO3, Na2WO4, and FeCl3·6H2O were 10.8, 3.2, and 25.8 µM, respectively. For growth in liquid culture, a 500-ml serum bottle (15) containing 150 ml of modified McN mineral medium and a gas phase of a H2 and CO2 mixture (80:20, vol/vol; 3 x 105 Pa) were used. The general growth protocols were the same as that described previously for M. jannaschii (15), except the incubation temperature was 37°C and, as the H2 and CO2 were consumed, the total pressure in the bottle was maintained close to 3 x 105 Pa by periodic pressurization with a mixture of N2 and CO2 (80:20, vol/vol); the system provided a hydrogen-limited batch culture. Also, the cultures were incubated without shaking for the first 13 h and then shaken at 250 rpm in a gyratory shaker (model 3527X Orbit Environ-Shaker; Lab-Line Instruments, Inc., Melrose Park, IL). For growth on plates, the medium described above was solidified with 1.5% agar and the protocols of Whitman et al. (23) were used. M. maripaludis transformants carrying pMEV2.1.1 or its derivatives were selected on plates or grown in liquid cultures in the presence of neomycin (1 mg/ml). M. jannaschii was grown as described previously (15). M. jannaschii and M. maripaludis cells were harvested anaerobically under an N2-plus-CO2 atmosphere (80:20, vol/vol) by centrifugation at 9,600 x g and 4°C. The optical density of a culture sample at 600 nm was measured by using a Lambda model 25 UV-visible-light spectrometer (Perkin-Elmer Instruments, Shelton, CT). Methane levels were measured via gas chromatography (8). Sulfide concentration in culture liquid was determined by the methylene blue method of Pachmayr (16) as detailed by Trüper and Schlegel (18), but with modifications (8).


arrow
Construction of an expression vector for Methanocaldococcus jannaschii fsr and transformation of Methanococcus maripaludis.
 
The expression system was based on pMEV2.1.1, an Escherichia coli-Methanococcus maripaludis shuttle vector (12) that allows cloning of genes under the control of the Methanococcus voltae histone promoter (Phmv) and confers resistance to neomycin to M. maripaludis and confers resistance to ampicillin to E. coli. The fsr or MJ0870 coding sequence was PCR amplified from M. jannaschii chromosomal DNA with Deep VentR polymerase (New England Biolabs Inc., Ipswich, MA) by use of the primers MJ0870/23F (5'TGCATGTATGAGTGGAAGTTAAATGAAATAGTC3' [underlined element, partial NsiI site]) and MJ0870/24R (5'CGCTCTAGATTAGCAGATTTCTTTTTTCATCAACTC3' [underlined element, XbaI site]) and digested at the 3' end with XbaI. pMEV2.1.1 was digested with NsiI, treated with T4 polymerase and each deoxynucleoside triphosphate, and then gel purified and digested with XbaI. The resulting product was ligated to the XbaI-digested fsr amplicon to obtain pEFJ9 (Fig. 1A). This strategy regenerated the NsiI site at the 5' end of the cloned amplicon and facilitated the cloning of MJ0870, which contains an NsiI site. pEFJ9 was propagated in E. coli TOP10 (Invitrogen Corporation, Carlsbad, CA); ampicillin (50 µg/ml) was used for selection. M. maripaludis was transformed with pEFJ9 purified from E. coli TOP10 according to the method of Tumbula et al. (20), and the transformants were selected on solid medium containing 1 mg/ml neomycin.


Figure 1
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 1. Growth and methanogenesis in cultures of M. maripaludis strains with sulfide or sulfite as a sole sulfur source. (A) pEFJ9, an expression vector for fsr based on pMEV2.1.1, an E. coli-M. maripaludis shuttle vector (12). PhmvA, Methanococcus voltae histone promoter; neo, neomycin resistance gene; bla, β-lactamase gene; Eco ori, origin for vector replication in E. coli; ORFless 1 and ORFless 2, elements that contain multiple potential stem-loop structures and direct and inverted repeats, lack open reading frames (ORFs), and are necessary for replication in M. maripaludis (19). (B) Growth, represented by the optical density of the culture at 600 nm. Sulfur sources used were 2 mM sulfide (filled symbols) and 2 mM sulfite (open symbols). M. m., M. maripaludis. The period of incubation without shaking is marked accordingly. Other growth conditions are as described in Materials and Methods. (C) Methanogenesis and sulfide production in an M. maripaludis(pEFJ9) culture with sulfite (final concentration, 2 mM) as the sole sulfur source. The headspace and culture volumes were 370 and 150 ml, respectively. Other details are the same as those described for panel B.


arrow
Protein techniques and enzyme assays.
 
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and protein assays were performed according to Laemmli (11) and Bradford (5), respectively. The identity of a polypeptide in a gel band was determined by in-gel trypsin digestion, matrix-assisted laser desorption ionization-time of flight mass spectrometry, and database searches (14). Whole-cell lysates of M. maripaludis and M. jannaschii were prepared via osmotic shock, which was induced by resuspending cells in 50 mM potassium phosphate buffer, pH 7 (8). A whole-cell lysate was centrifuged at 12,000 x g anaerobically to obtain an anaerobic cell extract supernatant, which was assayed for Fsr activity as described previously (8).


arrow
Growth on sulfite of an M. maripaludis strain carrying a cloned F420-dependent sulfite reductase gene (fsr).
 
M. maripaludis(pEFJ9) grew in a medium with sulfite as the sole sulfur source (Fig. 1B) and concomitantly produced methane (Fig. 1C). M. maripaludis and M. maripaludis(pMEV2.1.1) did not grow (Fig. 1B) or produce methane (data not shown) under this condition. Each of these three strains grew with sulfide as the sole sulfur source (Fig. 1B). Growth of M. maripaludis(pEFJ9) with 2 mM sulfide was faster than that recorded on 2 mM sulfite, although the latter culture eventually reached a higher cell density than that of the former (Fig. 1B).


arrow
Sulfite sensitivity of M. maripaludis in the presence of sulfide.
 
Addition of sulfite to a final concentration of 2 mM to a M. maripaludis(pMEV2.1.1) culture that had been growing with 2 mM sulfide caused the cessation of both growth and methanogenesis (Fig. 2A and B). The same effect was seen for M. maripaludis (data not shown). When a culture of M. maripaludis(pEFJ9) was subjected to a similar treatment, growth and methane production ceased temporarily but quickly resumed (Fig. 2A and B).


Figure 2
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 2. Effect of sulfite addition on growth and methanogenesis in cultures of M. maripaludis strains initiated with sulfide as the sulfur source. (A) Growth, as represented by the optical density of the culture at 600 nm. The cultures were initiated in a medium with sulfide as the sole sulfur source. Two of these cultures (filled symbols) received sodium sulfite (final concentration, 2 mM) at the times shown by arrows. The period of unstirred incubation is marked. Other growth conditions are as described in Materials and Methods. (B) Methanogenesis, as represented by the concentration of methane in the headspace gas (volume, 370 ml). Other details are the same as those described for panel A.


arrow
Sulfide production and expression of Fsr by M. maripaludis(pEFJ9) during growth with sulfite as the sulfur source.
 
During growth with sulfite as the sole sulfur source, M. maripaludis(pEFJ9) produced sulfide (Fig. 1C) and expressed an ~70-kDa polypeptide (Fig. 3, lane D) that was absent in M. maripaludis(pMEV2.1.1) grown with sulfide (Fig. 3, lane E). The amount of sulfide produced was about 75% of that of the sulfite added, and the ~70-kDa polypeptide was identified as M. jannaschii Fsr or MJ0870 (8). The data in Fig. 3, lanes A and B, reconfirmed a previously reported observation that sulfite induces the expression of Fsr in M. jannaschii (8). The specific Fsr activity in cell extracts of M. maripaludis(pEFJ9) grown with 2 mM sulfite as the sole sulfur source was 9.6 µmol of electrons transferred min–1 mg–1 protein, and the activity for similarly grown M. jannaschii was 10.4 µmol of electrons transferred min–1 mg–1; the assay temperature was 80°C. The cellular levels of Fsr protein in M. jannaschii and M. maripaludis(pEFJ9) grown with sulfite were similar (Fig. 3, lanes B and D).


Figure 3
View larger version (79K):
[in this window]
[in a new window]

  		FIG. 3. Expression of recombinant Fsr in Methanococcus maripaludis (Mm) and native Fsr in Methanocaldococcus jannaschii (Mj). The study involved sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of cell lysates of the following: M. jannaschii grown on sulfide and sulfite (lanes A and B, respectively), molecular mass standards (lane C), M. maripaludis(pEFJ9) grown on sulfite (lane D), and M. maripaludis(pMEV2.1.1) grown on sulfide (lane E). The concentrations of both sulfide and sulfite were 2 mM. The arrow points to the location of the Fsr polypeptide. The molecular masses (in kDa) for the standards (as in lane C) are shown to the right of the gel.


arrow
Conclusion.
 
From a replicable plasmid vector, M. jannaschii Fsr was expressed in M. maripaludis at high protein and activity levels, allowing the recombinant strain to carry out F420H2-dependent reduction of sulfite to sulfide and consequently to grow with sulfite as the sole sulfur source; sulfide is an essential nutrient for M. maripaludis (22). These results established Fsr as the likely sole determinant for sulfite tolerance and use by methanogens. However, the possibility that the establishment of this phenotype required additional proteins that are present both in M. jannaschii and in M. maripaludis cannot be ruled out.

Efforts to express Fsr from a T7 promoter in E. coli grown in LB medium at 37, 25, and 10°C yielded the recombinant protein in inclusion bodies (data not shown). The same result was obtained when a glucose minimal medium with sulfate as the sole sulfur source was used (data not shown); this growth medium requires E. coli to produce siroheme for assembling an active sulfite reductase (26). The M. maripaludis system provided not only soluble and catalytically active protein but also a near-natural expression condition for Fsr because of this organism's close relation to M. jannaschii (4). Even though the optimum temperature for the activity of purified Fsr from M. jannaschii, the native host, is >95°C (8), the recombinant Fsr allowed M. maripaludis to detoxify sulfite at 37°C. This was not surprising, because purified M. jannaschii Fsr exhibits substantial activity (about 2.4 µmol electrons transferred min–1 mg–1) at 37°C (E. F. Johnson and B. Mukhopadhyay, unpublished data). Due to this advantage, it will now be possible to rapidly identify the catalytically essential residues of Fsr via an in vivo screening of site-directed or random-mutagenesis-derived variants of this enzyme, by which process their abilities to enable M. maripaludis to grow with sulfite as the sulfur source will be tested. In addition, one could use this host for generating wild-type Fsr and its variants in amounts needed for X-ray crystallography, nuclear magnetic resonance, and kinetic and biophysical studies. The in vivo screening approach will also aid in determining whether the Fsr homologs from other methanogens and uncultivated methane-oxidizing archaea (9) exhibit sulfite reductase activity. Since Fsr contains siroheme (8), the expression of catalytically active Fsr in M. maripaludis indicated that this host produces the cofactor. Consequently, the in vivo screening approach will allow facile identification of genes involved specifically in the synthesis of siroheme, because in a M. maripaludis strain with a defect in such a gene, Fsr will not be able to reduce sulfite. This approach will be useful as long as a target gene is not involved in the synthesis of coenzyme F430 and vitamin B12, which are essential for methanogenesis. It should be noted that, currently, the utility of siroheme in M. maripaludis is not clearly known; it is possible that open reading frame MMP0078 of M. maripaludis, which has recently been identified as a putative small-size sulfite reductase (9), carries siroheme.


arrow
ACKNOWLEDGMENTS
 
We thank William B. Whitman for generously providing M. maripaludis strain S2 and the vector pMEV2.1.1; Endang Purwantini for discussions, comments, and a gift of coenzyme F420; and Carol Volker for editing.

This work was supported by a NASA Astrobiology: Exobiology and Evolutionary Biology grant (NNG05GP24G) to B.M.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Virginia Bioinformatics Institute, Virginia Polytechnic Institute and State University, Washington Street 0477, Blacksburg, VA 24061. Phone: (540) 231-8015. Fax: (540) 231-2606. E-mail: biswarup{at}vt.edu Back

{triangledown} Published ahead of print on 31 March 2008. Back


arrow
REFERENCES
 
    1
  1. Balderston, W. L., and W. J. Payne. 1976. Inhibition of methanogenesis in salt marsh sediments and whole-cell suspensions of methanogenic bacteria by nitrogen oxides. Appl. Environ. Microbiol. 32:264-269.[Abstract/Free Full Text]
    2. 2
  2. Baumer, S., T. Ide, C. Jacobi, A. Johann, G. Gottschalk, and U. Deppenmeier. 2000. The F420H2 dehydrogenase from Methanosarcina mazei is a redox-driven proton pump closely related to NADH dehydrogenases. J. Biol. Chem. 275:17968-17973.[Abstract/Free Full Text]
    3. 3
  3. Becker, D. F., and S. W. Ragsdale. 1998. Activation of methyl-SCoM reductase to high specific activity after treatment of whole cells with sodium sulfide. Biochemistry 37:2639-2647.[CrossRef][Medline]
    4. 4
  4. Boone, D. R., W. B. Whitman, and P. Rouviére. 1993. Microbiology, diversity and taxonomy of methanogens, p. 35-80. In J. G. Ferry (ed.), Methanogenesis: ecology, physiology, biochemistry and genetics. Chapman and Hall, New York, NY.
    5. 5
  5. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline]
    6. 6
  6. Bruggemann, H., F. Falinski, and U. Deppenmeier. 2000. Structure of the F420H2:quinone oxidoreductase of Archaeoglobus fulgidus identification and overproduction of the F420H2-oxidizing subunit. Eur. J. Biochem. 267:5810-5814.[Medline]
    7. 7
  7. Daniels, L., N. Belay, and B. S. Rajagopal. 1986. Assimilatory reduction of sulfate and sulfite by methanogenic bacteria. Appl. Environ. Microbiol. 51:703-709.[Abstract/Free Full Text]
    8. 8
  8. Johnson, E. F., and B. Mukhopadhyay. 2005. A new type of sulfite reductase, a novel coenzyme F420-dependent enzyme, from the methanarchaeon Methanocaldococcus jannaschii. J. Biol. Chem. 280:38776-38786.[Abstract/Free Full Text]
    9. 9
  9. Johnson, E. F., and B. Mukhopadhyay. 2007. A novel coenzyme F420-dependent sulfite reductase and a small size sulfite reductase in methanogenic archaea. In C. Dahl and C. G. Friedrich (ed.), Proceedings of the International Symposium on Microbial Sulfur Metabolism. Springer, New York, NY.
    10. 10
  10. Jones, W. J., J. A. Leigh, F. Mayer, C. R. Woese, and R. S. Wolfe. 1983. Methanococcus jannaschii sp. nov., an extreme thermophilic methanogen from a submarine hydrothermal vent. Arch. Microbiol. 136:254-261.[CrossRef]
    11. 11
  11. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
    12. 12
  12. Lin, W., and W. B. Whitman. 2004. The importance of porE and porF in the anabolic pyruvate oxidoreductase of Methanococcus maripaludis. Arch. Microbiol. 181:68-73.[CrossRef][Medline]
    13. 13
  13. Mahlert, F., C. Bauer, B. Jaun, R. K. Thauer, and E. C. Duin. 2002. The nickel enzyme methyl-coenzyme M reductase from methanogenic archaea: in vitro induction of the nickel-based MCR-ox EPR signals from MCR-red2. J. Biol. Inorg. Chem. 7:500-513.[CrossRef][Medline]
    14. 14
  14. Mukhopadhyay, B., E. F. Johnson, and R. S. Wolfe. 2000. A novel Formula control on the expression of flagella in the hyperthermophilic strictly hydrogenotrophic methanarchaeaon Methanococcus jannaschii. Proc. Natl. Acad. Sci. USA 97:11522-11527.[Abstract/Free Full Text]
    15. 15
  15. Mukhopadhyay, B., E. F. Johnson, and R. S. Wolfe. 1999. Reactor-scale cultivation of the hyperthermophilic methanarchaeon Methanococcus jannaschii to high cell densities. Appl. Environ. Microbiol. 65:5059-5065.[Abstract/Free Full Text]
    16. 16
  16. Pachmayr, F. 1960. Vorkommen und Bestimmung von Schwefelverbindungen in Mineral-Wasser. Ph.D. thesis. University of Munich, Munich, Germany.
    17. 17
  17. Rothe, O., and M. Thomm. 2000. A simplified method for the cultivation of extreme anaerobic Archaea based on the use of sodium sulfite as reducing agent. Extremophiles 4:247-252.[CrossRef][Medline]
    18. 18
  18. Trueper, H. G., and H. G. Schlegel. 1964. Sulphur metabolism in Thiorhodaceae. I. Quantitative measurements on growing cells of Chromatium okenii. Antonie van Leeuwenhoek 30:225-238.[CrossRef][Medline]
    19. 19
  19. Tumbula, D. L., T. L. Bowen, and W. B. Whitman. 1997. Characterization of pURB500 from the archaeon Methanococcus maripaludis and construction of a shuttle vector. J. Bacteriol. 179:2976-2986.[Abstract/Free Full Text]
    20. 20
  20. Tumbula, D. L., R. A. Makula, and W. B. Whitman. 1994. Transformation of Methanococcus maripaludis and identification of a PstI-like restriction system. FEMS Microbiol. Lett. 121:309-314.[CrossRef]
    21. 21
  21. Tumbula, D. L., and W. B. Whitman. 1999. Genetics of Methanococcus: possibilities for functional genomics in Archaea. Mol. Microbiol. 33:1-7.[CrossRef][Medline]
    22. 22
  22. Whitman, W. B., J. Shieh, S. Sohn, D. S. Cars, and U. Premachandran. 1986. Isolation and characterization of 22 mesophilic methanococci. Syst. Appl. Microbiol. 7:235-240.
    23. 23
  23. Whitman, W. B., S. Sohn, and R. Y. Xing. 1987. Role of amino acids and vitamins in nutrition of mesophilic Methanococcus spp. Appl. Environ. Microbiol. 53:2373-2378.[Abstract/Free Full Text]
    24. 24
  24. Widdel, F. 1988. Microbiology and ecology of sulfate- and sulfur-reducing bacteria, p. 469-585. In A. Zehnder (ed.), Biology of anaerobic microorganisms. John Wiley & Sons, New York, NY.
    25. 25
  25. Wolfe, R. S. 1992. Biochemistry of methanogenesis. Biochem. Soc. Symp. 58:41-49.[Medline]
    26. 26
  26. Wu, J. Y., L. M. Siegel, and N. M. Kredich. 1991. High-level expression of Escherichia coli NADPH-sulfite reductase: requirement for a cloned cysG plasmid to overcome limiting siroheme cofactor. J. Bacteriol. 173:325-333.[Abstract/Free Full Text]

Applied and Environmental Microbiology, June 2008, p. 3591-3595, Vol. 74, No. 11
0099-2240/08/$08.00+0     doi:10.1128/AEM.00098-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnson, E. F.
Right arrow Articles by Mukhopadhyay, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, E. F.
Right arrow Articles by Mukhopadhyay, B.
Agricola
Right arrow Articles by Johnson, E. F.
Right arrow Articles by Mukhopadhyay, B.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»