This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.
Agricola
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, June 2008, p. 3915-3917, Vol. 74, No. 12
0099-2240/08/$08.00+0     doi:10.1128/AEM.02807-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Transfer of Conjugative Elements from Rumen and Human Firmicutes Bacteria to Roseburia inulinivorans{triangledown}

Karen P. Scott,* Jenny C. Martin, Jakub Mrazek,{dagger} and Harry J. Flint

Rowett Research Institute, Bucksburn, Aberdeen AB21 9SB, United Kingdom

Received 12 December 2007/ Accepted 22 April 2008


arrow
ABSTRACT
 
Studies on Firmicutes bacteria from the gut are hampered by a lack of gene transfer systems. Here the human colonic anaerobe Roseburia inulinivorans A2-194 was shown to be a transfer recipient for two conjugative transposons, Tn1545 from Eubacterium cellulosolvens and TnK10 from Clostridium saccharolyticum K10.


arrow
INTRODUCTION
 
The two most abundant bacterial phyla that inhabit the human colon are the low-G+C-content gram-positive Firmicutes and the gram-negative Bacteroidetes (13, 25). Recent progress in understanding the ecological roles of gram-positive Firmicutes in the human large intestine (4, 11) may soon be supplemented by draft genome sequences. Bacteria related to Roseburia spp. and Eubacterium rectale are an important group of Firmicutes belonging to the Clostridium coccoides cluster (also known as clostridial cluster XIVa) that contribute to polysaccharide breakdown in the colon and are major producers of butyrate (1, 10). This group can comprise up to 10% of the total bacterial diversity in the human colon (1). The species Roseburia inulinivorans is metabolically versatile, utilizing inulin, starch, and fucose for growth (9, 19, 22). While progress in understanding gene expression responses in R. inulinivorans using transcriptomics is being made (22), genetic manipulation methods would clearly enhance the ability to investigate gene function. Some progress has been made with the introduction of transposon and plasmid vectors in the rumen species Butyrivibrio fibrisolvens (5, 14, 20), but very little work with related gram-positive strict anaerobes from the human gut has been reported.

Commensal bacteria are known to harbor antibiotic resistance genes and thus contribute to the reservoir of resistance genes in the gut that can potentially be acquired by pathogenic members of the gut microbial community. Several new tetracycline resistance genes have been identified recently in gram-positive anaerobes isolated from the bovine rumen and human colon (3, 16). The transfer of some of these resistance genes was linked to their carriage on conjugative transposons (CTns), and these elements may offer the potential for genetic manipulation. TnB1230, originally identified in the rumen anaerobe B. fibrisolvens (20), is a 45- to 50-kb transposon with some similarity to the Enterococcus faecalis transposon Tn1549 (17). Repeated attempts to transfer TnB1230 from B. fibrisolvens into R. inulinivorans were unsuccessful despite the high frequencies of transfer between B. fibrisolvens strains observed previously (20). We have, however, been able to transfer another novel CTn, TnK10, previously identified in a human isolate related to Clostridium saccharolyticum (16), into R. inulinivorans A2-194, and transfer with Tn1545, originally identified in Streptococcus pneumoniae, was also successful (8). Details of these transfer experiments are presented below.


arrow
Transfer of the CTn Tn1545.
 
Tn1545, which carries the tet(M) gene, was transferable from the rumen Eubacterium cellulosolvens strain 5484 to a spontaneous rifampin-resistant mutant of R. inulinivorans A2-194 (A2-194R), at frequencies of 10–5 transconjugants per donor cell. Anaerobic filter matings followed the method of Hespell and Whitehead (14), modified as described previously (20). Parent cells were grown anaerobically in M2GSC medium lacking antibiotics overnight to stationary phase prior to mating. Potential transconjugants grew on selective M2GSC agar plates containing rifampin (100 µg ml–1) and tetracycline (10 µg ml–1) for 2 days, and their resistance phenotypes were confirmed by replating selected colonies on double-antibiotic plates. Subsequent stocks of transconjugants were prepared from single colonies. The 16S rRNA gene from each transconjugant was amplified by PCR using eubacterial primers fD1 and rP2 (28), and limited sequencing of the amplicons confirmed that transconjugants were R. inulinivorans isolates.

Chromosomal DNA isolated from transconjugants was subjected to restriction enzyme digestion, separated by pulsed-field gel electrophoresis (PFGE), Southern blotted, and hybridized to a tet(M) probe as described previously (3, 20). Single insertion of Tn1545 was predicted to give one hybridizing fragment following restriction with HindIII [which cleaves 63 nucleotides into tet(M) but not within the probe sequence] and two hybridizing fragments following cleavage at the ClaI site, located at 913 nucleotides in tet(M), within the probe sequence. Six different complex hybridization profiles were observed with 12 R. inulinivorans transconjugants when the ClaI and HindIII hybridization patterns were compared (Fig. 1, lanes 2, 4, 6, 9, 11, and 12). The lower band (~2.5 kb) present in all transconjugants is due to the presence of an additional ClaI site upstream of tet(M), within Tn1545 (Fig. 1a). Tn1545 was shown previously to insert into different sites in five E. cellulosolvens transconjugants (2) and to target AT-rich regions in the genome (15, 27).


Figure 1
View larger version (78K):
[in this window]
[in a new window]

 
FIG. 1. Southern blot of genomic DNA purified from R. inulinivorans A2-194 transconjugants containing Tn1545, digested with ClaI (a) or HindIII (b). Lanes 1 to 12, selected transconjugants; lane 13, recipient strain. The sizes of key marker bands are indicated on the left. Unique patterns are represented by transconjugants in lanes 2, 4, 6, 9, 11, and 12.

DNA sequences flanking the left end of Tn1545 were obtained for seven transconjugants with six distinct banding patterns. Chromosomal DNA was partially digested with Sau3A, and the 0.5- to 1-kb fraction was ligated into a pBluescript vector (Stratagene) and amplified with M13 specific primers in combination with primers located ~100 bp from each end of Tn1545 based on the sequence published by Caillaud and Courvalin (6) (Tn1545left, 5' AGCTCATTCATAAGTAGT 3'; Tn1545right, 5' CGTGAAGTATCTTCCTACAG 3'). The resulting amplicons were purified and sequenced directly using primer Tn1545left. All seven sequences were identical up to and following the left end of Tn1545 (6), and the same sequence was also obtained for the donor E. cellulosolvens strain. The transferred DNA therefore included DNA in addition to Tn1545 that was presumably derived from E. cellulosolvens. The most plausible explanation is that Tn1545 became part of a larger conjugal transfer element upon integration into the E. cellulosolvens donor strain and that this larger element is able to insert at more than one site upon transfer to R. inulinivorans.


arrow
Transfer of the CTn TnK10.
 
The human gut isolate C. saccharolyticum K10 harbors the transmissible tetracycline resistance gene tet(O/32/O) and also a tet(W) gene (16, 24). Transfer of tet(O/32/O) only was detected in matings with the rumen recipient strain B. fibrisolvens 2221R (16). tet(O/32/O) was therefore postulated to be carried on the CTn TnK10, which had a common insertion site in two transconjugants analyzed (16). Since the two bacteria capable of harboring TnK10 belong to clostridial cluster XIVa, this transposon was considered a promising candidate for further experiments on transfer to R. inulinivorans A2-194.

Transfer of tetracycline resistance occurred between C. saccharolyticum K10 and the recipient R. inulinivorans A2-194R, at frequencies of 10–6 transconjugants per donor cell. Gene transfer was confirmed by PCR amplification of the tet(O/32/O) gene using a primer pair specific for the internal tet(32) region (18) [tet(32)for, 5'-AACCGAAGCATACCGCTC-3'; tet(32)rev, 5'-CTCTTTCATAGCCACGCC-3']. We were unable to estimate the size of TnK10 based on PFGE analysis (data not shown). However, sequencing of homologous elements indicated that TnK10 is likely to be larger than 21 kb (EMBL database accession number AM419751; M. Rincon, personal communication). The band profile on a PFGE gel was immobilized by Southern blotting, and the blot was hybridized to a radioactively labeled tet(O/32/O) probe. The restriction enzyme SalI does not cut internally in tet(O/32/O), and a single insertion of TnK10 should result in a single hybridizing band. A 90-kb band hybridized to the tet(O/32/O) probe in all five of the transconjugants analyzed, with an additional 60-kb band present in two transconjugants (Fig. 2, lanes 3 and 5). This implies that TnK10 has a preferred insertion site in R. inulinivorans but that insertions into a second site can also occur. A much larger single band of about 200 kb hybridized in the donor genome but was absent in the transconjugants.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 2. Southern blot of a representative PFGE gel hybridized to the internal tet(32) sequence. R, recipient R. inulinivorans A2-194; D, donor C. saccharolyticum K10; lanes 1 to 5, representative transconjugants containing TnK10. The sizes of key bands are indicated on the right.


arrow
Conclusions.
 
The rumen B. fibrisolvens and E. cellulosolvens and human R. inulinivorans isolates studied here all belong to clostridial cluster XIVa (7), the single most abundant phylogenetic group of bacteria resident in both the human colon (25) and the rumen (26). Through this and previous work (21), we have shown that transfer of antibiotic resistance genes occurs in both directions between rumen and human gut representatives of this important group of gut Firmicutes. Previous evidence has shown that rumen and human gut representatives of the major gram-negative phylum, the Bacteroidetes, can also exchange resistance genes (23). Transfer of TnK10 and Tn1545 between unrelated gut anaerobes was easily detected, but repeated attempts to transfer the rumen CTn TnB1230 to R. inulinivorans A2-194 were unsuccessful. Interestingly, TnB1230 transfers at extremely high frequencies between two phylogenetically distinct strains of B. fibrisolvens (12, 20), and the lack of transfer to R. inulinivorans A2-194 presumably reflects the restricted host range of TnB1230. In fact, the donor, B. fibrisolvens 1.230, is phylogenetically more closely related to Roseburia species than to the recipient, B. fibrisolvens 2221R (4).

Genetic manipulation of bacteria within clostridial cluster XIVa would enhance the ability to investigate the function of specific genes, and it was hoped that one of the CTns studied here would enable transposon mutagenesis in this group. TnK10 showed preferential insertion in R. inulinivorans but remains of interest as a potential delivery system, once more sequence information is available. Although Tn1545 apparently had multiple insertion sites in the R. inulinivorans genome, this was inferred to be due to its transfer as part of a larger element, whose structure and behavior require further investigation. Genomic sequencing of the donor and recipient bacteria may prove the most effective approach to clarifying the transfer mechanisms of Tn1545 and TnK10.

In conclusion, this work demonstrates conjugal gene transfer in laboratory matings with a strictly anaerobic Firmicutes bacterium from the human gastrointestinal tract as the recipient, thus hopefully providing a first step toward genetic manipulation in this important group of bacteria. These experiments emphasize the extent of gene flow between predominant groups of gut bacteria.


arrow
Nucleotide sequence accession number.
 
The accession number for the 16S rRNA sequence of C. saccharolyticum K10 is EU305624.


arrow
ACKNOWLEDGMENTS
 
Jakub Mrazek was supported by a grant from the EU Marie Curie training site (ANAEROBE). The Rowett Research Institute is supported by SG-RERAD (Scottish Government Rural and Environment Research and Analysis Directorate).

We thank Kevin Anderson for kindly supplying E. cellulosolvens strains carrying Tn1545.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Rowett Research Institute, Greenburn Road, Bucksburn, Aberdeen, Scotland AB21 9SB, United Kingdom. Phone: 44 (0) 1224 712751. Fax: 44 (0) 1224 716687. E-mail: k.scott{at}rowett.ac.uk Back

{triangledown} Published ahead of print on 2 May 2008. Back

{dagger} Present address: Institute of Animal Physiology and Genetics, Czech Academy of Sciences, Videnska 1083, 142 20, Prague 4, Czech Republic. Back


arrow
REFERENCES
 
    1
  1. Aminov, R. I., A. W. Walker, S. H. Duncan, H. J. M. Harmsen, G. W. Welling, and H. J. Flint. 2006. Molecular diversity, cultivation, and improved detection by fluorescent in situ hybridization of a dominant group of human gut bacteria related to Roseburia spp. or Eubacterium rectale. Appl. Environ. Microbiol. 72:6371-6376.[Abstract/Free Full Text]
  2. 2
  3. Anderson, K. L., J. A. Megehee, and V. H. Varel. 1998. Conjugal transfer of transposon Tn1545 into the cellulolytic bacterium Eubacterium cellulosolvens. Lett. Appl. Microbiol. 26:35-37.[CrossRef][Medline]
  4. 3
  5. Barbosa, T. M., K. P. Scott, and H. J. Flint. 1999. Evidence for recent intergeneric transfer of a new tetracycline resistance gene, tet(W), isolated from Butyrivibrio fibrisolvens, and the occurrence of tet(O) in ruminal bacteria. Environ. Microbiol. 1:53-64.[CrossRef][Medline]
  6. 4
  7. Barcenilla, A., S. E. Pryde, J. C. Martin, S. H. Duncan, C. S. Stewart, C. Henderson, and H. J. Flint. 2000. Phylogenetic relationships of butyrate-producing bacteria from the human gut. Appl. Environ. Microbiol. 66:1654-1661.[Abstract/Free Full Text]
  8. 5
  9. Beard, C. E., M. A. Hefford, R. J. Forster, S. Sontakke, R. M. Teather, and K. Gregg. 1995. A stable and efficient transformation system for Butyrivibrio fibrisolvens OB156. Curr. Microbiol. 30:105-109.[CrossRef][Medline]
  10. 6
  11. Caillaud, F., and P. Courvalin. 1987. Nucleotide sequence of the ends of the conjugative shuttle transposon Tn1545. Mol. Gen. Genet. 209:110-115.[CrossRef][Medline]
  12. 7
  13. Collins, M. D., P. A. Lawson, A. Willems, J. J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J. A. E. Farrow. 1994. The phylogeny of the genus Clostridium: proposal of five new genera and eleven new species combinations. Int. J. Syst. Bacteriol. 44:812-826.[Abstract/Free Full Text]
  14. 8
  15. Courvalin, P., and C. Carlier. 1986. Transposable multiple antibiotic resistance in Streptococcus pneumoniae. Mol. Gen. Genet. 205:291-297.[CrossRef][Medline]
  16. 9
  17. Duncan, S. H., K. P. Scott, A. G. Ramsay, H. J. Harmsen, G. W. Welling, C. S. Stewart, and H. J. Flint. 2003. Effects of alternative dietary substrates on competition between human colonic bacteria in an anaerobic fermentor system. Appl. Environ. Microbiol. 69:1136-1142.[Abstract/Free Full Text]
  18. 10
  19. Duncan, S. H., R. I. Aminov, K. P. Scott, P. Louis, T. B. Stanton, and H. J. Flint. 2006. Proposal of Roseburia faecis (sp. nov.), Roseburia hominis (sp. nov.), and Roseburia inulinivorans, based on isolates from human faeces. Int. J. Syst. Evol. Microbiol. 56:2437-2441.[Abstract/Free Full Text]
  20. 11
  21. Duncan, S. H., P. Louis, and H. J. Flint. 2007. Cultivable bacterial diversity from the human colon. Lett. Appl. Microbiol. 44:343-350.[CrossRef][Medline]
  22. 12
  23. Forster, R. J., R. M. Teather, J. Gong, and S.-J. Deng. 1996. 16S rDNA analysis of Butyrivibrio fibrisolvens: phylogenetic position and relation to butyrate producing anaerobic bacteria from the rumen of white-tailed deer. Lett. Appl. Microbiol. 23:218-222.[Medline]
  24. 13
  25. Franks, A. H., H. J. Harmsen, G. C. Raangs, G. J. Jansen, F. Schut, and G. W. Welling. 1998. Variations of bacterial populations in human feces measured by fluorescent in situ hybridization with group-specific 16S rRNA-targeted oligonucleotide probes. Appl. Environ. Microbiol. 64:3336-3345.[Abstract/Free Full Text]
  26. 14
  27. Hespell, R. B., and T. R. Whitehead. 1991. Conjugal transfer of Tn916, Tn916{Delta}E, and pAMβ1 from Enterococcus faecalis to Butyrivibrio fibrisolvens strains. Appl. Environ. Microbiol. 57:2703-2709.[Abstract/Free Full Text]
  28. 15
  29. Jaworski, D. D., and D. B. Clewell. 1994. Evidence that coupling sequences play a frequency determining role in conjugative transposition of Tn916 in Enterococcus faecalis. J. Bacteriol. 176:3328-3335.[Abstract/Free Full Text]
  30. 16
  31. Melville, C. M., K. P. Scott, D. K. Mercer, and H. J. Flint. 2001. Novel tetracycline resistance gene, tet(32), in the Clostridium-related human colonic anaerobe K10 and its transmission in vitro to the rumen anaerobe Butyrivibrio fibrisolvens. Antimicrob. Agents Chemother. 45:3246-3249.[Abstract/Free Full Text]
  32. 17
  33. Melville, C. M., R. Brunel, H. J. Flint, and K. P. Scott. 2004. The Butyrivibrio fibrisolvens tet(W) gene is carried on the novel conjugative transposon TnB1230, which contains duplicated nitroreductase coding sequences. J. Bacteriol. 186:3656-3659.[Abstract/Free Full Text]
  34. 18
  35. Patterson, A. J., R. Colangeli, P. Spigaglia, and K. P. Scott. 2007. Distribution of specific tetracycline and erythromycin resistance genes in environmental samples assessed by macroarray detection. Environ. Microbiol. 9:703-715.[CrossRef][Medline]
  36. 19
  37. Ramsay, A. G., K. P. Scott, J. C. Martin, M. T. Rincon, and H. J. Flint. 2006. Cell associated {alpha}-amylases of butyrate-producing Firmicute bacteria from the human colon. Microbiology 152:3281-3290.[Abstract/Free Full Text]
  38. 20
  39. Scott, K. P., T. M. Barbosa, K. J. Forbes, and H. J. Flint. 1997. High frequency transfer of a naturally occurring chromosomal tetracycline resistance element in the ruminal anaerobe Butyrivibrio fibrisolvens. Appl. Environ. Microbiol. 63:3405-3411.[Abstract]
  40. 21
  41. Scott, K. P. 2002. The role of conjugative transposons in spreading antibiotic resistance between bacteria that inhabit the gastrointestinal tract. Cell. Mol. Life Sci. 59:2071-2082.[CrossRef][Medline]
  42. 22
  43. Scott, K. P., J. C. Martin, G. Campbell, C.-D. Mayer, and H. J. Flint. 2006. Whole-genome transcription profiling reveals genes up-regulated by growth on fucose in the human gut bacterium Roseburia inulinivorans. J. Bacteriol. 188:4340-4349.[Abstract/Free Full Text]
  44. 23
  45. Shoemaker, N. B., H. Vlamakis, K. Hayes, and A. A. Salyers. 2001. Evidence for extensive resistance gene transfer among Bacteroides spp. and among Bacteroides and other genera in the human colon. Appl. Environ. Microbiol. 67:561-568.[Abstract/Free Full Text]
  46. 24
  47. Stanton, T. B., S. B. Humphrey, K. P. Scott, and H. J. Flint. 2005. Hybrid tet genes and tet gene nomenclature: request for opinions. Antimicrob. Agents Chemother. 49:1265-1266.[Free Full Text]
  48. 25
  49. Suau, A., R. Bonnet, M. Sutren, J.-J. Godon, G. R. Gibson, M. D. Collins, and J. Doré. 1999. Direct analysis of genes encoding 16S rRNA from complex communities reveals many molecular species within the human gut. Appl. Environ. Microbiol. 65:4799-4807.[Abstract/Free Full Text]
  50. 26
  51. Tajima, K., R. I. Aminov, T. Nagamine, K. Ogata, M. Nakamura, H. Matsui, and Y. Benno. 1999. Rumen bacterial diversity as determined by sequence analysis of 16S rDNA libraries. FEMS Microbiol. Ecol. 29:159-169.[CrossRef]
  52. 27
  53. Trieu-Cuot, P., C. Poyart-Salmeron, C. Carlier, and P. Courvalin. 1993. Sequence requirements for target activity in site-specific recombination mediated by the Int protein of transposon Tn1545. Mol. Microbiol. 8:179-185.[Medline]
  54. 28
  55. Weisburg, W. G., S. M. Barns, D. A. Pelletier, and D. J. Lane. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697-703.[Abstract/Free Full Text]


Applied and Environmental Microbiology, June 2008, p. 3915-3917, Vol. 74, No. 12
0099-2240/08/$08.00+0     doi:10.1128/AEM.02807-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.
Agricola
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.