Transfer of Conjugative Elements from Rumen and Human Firmicutes Bacteria to Roseburia inulinivorans

Studies on Firmicutes bacteria from the gut are hampered bya lack of gene transfer systems. Here the human colonic anaerobeRoseburia inulinivorans A2-194 was shown to be a transfer recipientfor two conjugative transposons, Tn1545 from Eubacterium cellulosolvensand TnK10 from Clostridium saccharolyticum K10.

INTRODUCTION

Top

INTRODUCTION

The two most abundant bacterial phyla that inhabit the humancolon are the low-G+C-content gram-positive Firmicutes and thegram-negative Bacteroidetes (13, 25). Recent progress in understandingthe ecological roles of gram-positive Firmicutes in the humanlarge intestine (4, 11) may soon be supplemented by draft genomesequences. Bacteria related to Roseburia spp. and Eubacteriumrectale are an important group of Firmicutes belonging to theClostridium coccoides cluster (also known as clostridial clusterXIVa) that contribute to polysaccharide breakdown in the colonand are major producers of butyrate (1, 10). This group cancomprise up to 10% of the total bacterial diversity in the humancolon (1). The species Roseburia inulinivorans is metabolicallyversatile, utilizing inulin, starch, and fucose for growth (9,19, 22). While progress in understanding gene expression responsesin R. inulinivorans using transcriptomics is being made (22),genetic manipulation methods would clearly enhance the abilityto investigate gene function. Some progress has been made withthe introduction of transposon and plasmid vectors in the rumenspecies Butyrivibrio fibrisolvens (5, 14, 20), but very littlework with related gram-positive strict anaerobes from the humangut has been reported.

Commensal bacteria are known to harbor antibiotic resistancegenes and thus contribute to the reservoir of resistance genesin the gut that can potentially be acquired by pathogenic membersof the gut microbial community. Several new tetracycline resistancegenes have been identified recently in gram-positive anaerobesisolated from the bovine rumen and human colon (3, 16). Thetransfer of some of these resistance genes was linked to theircarriage on conjugative transposons (CTns), and these elementsmay offer the potential for genetic manipulation. TnB1230, originallyidentified in the rumen anaerobe B. fibrisolvens (20), is a45- to 50-kb transposon with some similarity to the Enterococcusfaecalis transposon Tn1549 (17). Repeated attempts to transferTnB1230 from B. fibrisolvens into R. inulinivorans were unsuccessfuldespite the high frequencies of transfer between B. fibrisolvensstrains observed previously (20). We have, however, been ableto transfer another novel CTn, TnK10, previously identifiedin a human isolate related to Clostridium saccharolyticum (16),into R. inulinivorans A2-194, and transfer with Tn1545, originallyidentified in Streptococcus pneumoniae, was also successful(8). Details of these transfer experiments are presented below.

Transfer of the CTn Tn1545.

Top

Transfer of the CTn...

Tn1545, which carries the tet(M) gene, was transferable fromthe rumen Eubacterium cellulosolvens strain 5484 to a spontaneousrifampin-resistant mutant of R. inulinivorans A2-194 (A2-194^R),at frequencies of 10^–5 transconjugants per donor cell.Anaerobic filter matings followed the method of Hespell andWhitehead (14), modified as described previously (20). Parentcells were grown anaerobically in M2GSC medium lacking antibioticsovernight to stationary phase prior to mating. Potential transconjugantsgrew on selective M2GSC agar plates containing rifampin (100µg ml^–1) and tetracycline (10 µg ml^–1)for 2 days, and their resistance phenotypes were confirmed byreplating selected colonies on double-antibiotic plates. Subsequentstocks of transconjugants were prepared from single colonies.The 16S rRNA gene from each transconjugant was amplified byPCR using eubacterial primers fD1 and rP2 (28), and limitedsequencing of the amplicons confirmed that transconjugants wereR. inulinivorans isolates.

Chromosomal DNA isolated from transconjugants was subjectedto restriction enzyme digestion, separated by pulsed-field gelelectrophoresis (PFGE), Southern blotted, and hybridized toa tet(M) probe as described previously (3, 20). Single insertionof Tn1545 was predicted to give one hybridizing fragment followingrestriction with HindIII [which cleaves 63 nucleotides intotet(M) but not within the probe sequence] and two hybridizingfragments following cleavage at the ClaI site, located at 913nucleotides in tet(M), within the probe sequence. Six differentcomplex hybridization profiles were observed with 12 R. inulinivoranstransconjugants when the ClaI and HindIII hybridization patternswere compared (Fig. 1, lanes 2, 4, 6, 9, 11, and 12). The lowerband ( $~$ 2.5 kb) present in all transconjugants is due to the presenceof an additional ClaI site upstream of tet(M), within Tn1545(Fig. 1a). Tn1545 was shown previously to insert into differentsites in five E. cellulosolvens transconjugants (2) and to targetAT-rich regions in the genome (15, 27).

View larger version (78K):
[in this window]
[in a new window]

FIG. 1. Southern blot of genomic DNA purified from R. inulinivorans A2-194 transconjugants containing Tn1545, digested with ClaI (a) or HindIII (b). Lanes 1 to 12, selected transconjugants; lane 13, recipient strain. The sizes of key marker bands are indicated on the left. Unique patterns are represented by transconjugants in lanes 2, 4, 6, 9, 11, and 12.

DNA sequences flanking the left end of Tn1545 were obtainedfor seven transconjugants with six distinct banding patterns.Chromosomal DNA was partially digested with Sau3A, and the 0.5-to 1-kb fraction was ligated into a pBluescript vector (Stratagene)and amplified with M13 specific primers in combination withprimers located $~$ 100 bp from each end of Tn1545 based on thesequence published by Caillaud and Courvalin (6) (Tn1545left,5' AGCTCATTCATAAGTAGT 3'; Tn1545right, 5' CGTGAAGTATCTTCCTACAG3'). The resulting amplicons were purified and sequenced directlyusing primer Tn1545left. All seven sequences were identicalup to and following the left end of Tn1545 (6), and the samesequence was also obtained for the donor E. cellulosolvens strain.The transferred DNA therefore included DNA in addition to Tn1545that was presumably derived from E. cellulosolvens. The mostplausible explanation is that Tn1545 became part of a largerconjugal transfer element upon integration into the E. cellulosolvensdonor strain and that this larger element is able to insertat more than one site upon transfer to R. inulinivorans.

Transfer of the CTn TnK10.

Top

The human gut isolate C. saccharolyticum K10 harbors the transmissibletetracycline resistance gene tet(O/32/O) and also a tet(W) gene(16, 24). Transfer of tet(O/32/O) only was detected in matingswith the rumen recipient strain B. fibrisolvens 2221^R (16).tet(O/32/O) was therefore postulated to be carried on the CTnTnK10, which had a common insertion site in two transconjugantsanalyzed (16). Since the two bacteria capable of harboring TnK10belong to clostridial cluster XIVa, this transposon was considereda promising candidate for further experiments on transfer toR. inulinivorans A2-194.

Transfer of tetracycline resistance occurred between C. saccharolyticumK10 and the recipient R. inulinivorans A2-194^R, at frequenciesof 10^–6 transconjugants per donor cell. Gene transferwas confirmed by PCR amplification of the tet(O/32/O) gene usinga primer pair specific for the internal tet(32) region (18)[tet(32)for, 5'-AACCGAAGCATACCGCTC-3'; tet(32)rev, 5'-CTCTTTCATAGCCACGCC-3'].We were unable to estimate the size of TnK10 based on PFGE analysis(data not shown). However, sequencing of homologous elementsindicated that TnK10 is likely to be larger than 21 kb (EMBLdatabase accession number AM419751; M. Rincon, personal communication).The band profile on a PFGE gel was immobilized by Southern blotting,and the blot was hybridized to a radioactively labeled tet(O/32/O)probe. The restriction enzyme SalI does not cut internally intet(O/32/O), and a single insertion of TnK10 should result ina single hybridizing band. A 90-kb band hybridized to the tet(O/32/O)probe in all five of the transconjugants analyzed, with an additional60-kb band present in two transconjugants (Fig. 2, lanes 3 and5). This implies that TnK10 has a preferred insertion site inR. inulinivorans but that insertions into a second site canalso occur. A much larger single band of about 200 kb hybridizedin the donor genome but was absent in the transconjugants.

View larger version (30K):
[in this window]
[in a new window]

FIG. 2. Southern blot of a representative PFGE gel hybridized to the internal tet(32) sequence. R, recipient R. inulinivorans A2-194; D, donor C. saccharolyticum K10; lanes 1 to 5, representative transconjugants containing TnK10. The sizes of key bands are indicated on the right.

Conclusions.

Top

Conclusions.

The rumen B. fibrisolvens and E. cellulosolvens and human R.inulinivorans isolates studied here all belong to clostridialcluster XIVa (7), the single most abundant phylogenetic groupof bacteria resident in both the human colon (25) and the rumen(26). Through this and previous work (21), we have shown thattransfer of antibiotic resistance genes occurs in both directionsbetween rumen and human gut representatives of this importantgroup of gut Firmicutes. Previous evidence has shown that rumenand human gut representatives of the major gram-negative phylum,the Bacteroidetes, can also exchange resistance genes (23).Transfer of TnK10 and Tn1545 between unrelated gut anaerobeswas easily detected, but repeated attempts to transfer the rumenCTn TnB1230 to R. inulinivorans A2-194 were unsuccessful. Interestingly,TnB1230 transfers at extremely high frequencies between twophylogenetically distinct strains of B. fibrisolvens (12, 20),and the lack of transfer to R. inulinivorans A2-194 presumablyreflects the restricted host range of TnB1230. In fact, thedonor, B. fibrisolvens 1.230, is phylogenetically more closelyrelated to Roseburia species than to the recipient, B. fibrisolvens2221^R (4).

Genetic manipulation of bacteria within clostridial clusterXIVa would enhance the ability to investigate the function ofspecific genes, and it was hoped that one of the CTns studiedhere would enable transposon mutagenesis in this group. TnK10showed preferential insertion in R. inulinivorans but remainsof interest as a potential delivery system, once more sequenceinformation is available. Although Tn1545 apparently had multipleinsertion sites in the R. inulinivorans genome, this was inferredto be due to its transfer as part of a larger element, whosestructure and behavior require further investigation. Genomicsequencing of the donor and recipient bacteria may prove themost effective approach to clarifying the transfer mechanismsof Tn1545 and TnK10.

In conclusion, this work demonstrates conjugal gene transferin laboratory matings with a strictly anaerobic Firmicutes bacteriumfrom the human gastrointestinal tract as the recipient, thushopefully providing a first step toward genetic manipulationin this important group of bacteria. These experiments emphasizethe extent of gene flow between predominant groups of gut bacteria.

Nucleotide sequence accession number.

Top

Nucleotide sequence accession...

The accession number for the 16S rRNA sequence of C. saccharolyticumK10 is EU305624.

ACKNOWLEDGMENTS

Jakub Mrazek was supported by a grant from the EU Marie Curietraining site (ANAEROBE). The Rowett Research Institute is supportedby SG-RERAD (Scottish Government Rural and Environment Researchand Analysis Directorate).

We thank Kevin Anderson for kindly supplying E. cellulosolvensstrains carrying Tn1545.

FOOTNOTES

* Corresponding author. Mailing address: Rowett Research Institute, Greenburn Road, Bucksburn, Aberdeen, Scotland AB21 9SB, United Kingdom. Phone: 44 (0) 1224 712751. Fax: 44 (0) 1224 716687. E-mail: k.scott{at}rowett.ac.uk

Published ahead of print on 2 May 2008.

Present address: Institute of Animal Physiology and Genetics,Czech Academy of Sciences, Videnska 1083, 142 20, Prague 4,Czech Republic.

REFERENCES

Top