Previous Article | Next Article ![]()
Applied and Environmental Microbiology, August 2008, p. 4601-4609, Vol. 74, No. 15
0099-2240/08/$08.00+0 doi:10.1128/AEM.00010-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Michael J. Miller,1,
,
M. Andrea Azcarate-Peril,1
Stephen P. Toon,3 and
Todd R. Klaenhammer1,2*
Departments of Food, Bioprocessing, and Nutrition Sciences,1 Microbiology, North Carolina State University, Raleigh, North Carolina 27695,2 Verenium Corporation, San Diego, California 921213
Received 2 January 2008/ Accepted 2 May 2008
|
|
|---|
AT3, and LcaI and with L. rhamnosus virulent phage Lu-Nu. Of the 54 open reading frames (ORFs) identified, all but 8 shared homology with other phages of this group. Five unknown ORFs were identified that had no homologies in the databases nor predicted functions. Notably, Lrm1 encodes a putative endonuclease and a putative DNA methylase with homology to a methylase in Lactococcus lactis phage Tuc2009. Possibly, the DNA methylase, endonuclease, or other Lrm1 genes provide a function crucial to L. rhamnosus M1 survival, resulting in the stability of the defective prophage in its lysogenic state. The presence of a defective prophage in an industrial strain could provide superinfection immunity to the host but could also contribute DNA in recombination events to produce new phages potentially infective for the host strain in a large-scale fermentation environment. |
|
|---|
Lactobacillus strains have long been known to harbor prophages (43, 48), and the recently sequenced Lactobacillus genomes have provided evidence of a number of previously unidentified prophages. Prophage genome sequences are available for several species of Lactobacillus, including Lactobacillus gasseri (1, 51), L. johnsonii (53, 54), L. plantarum (27, 52), L. casei (20, 34, 48), and L. salivarius (51).The sequencing of multiple strains from the same bacterial species demonstrated that prophages can be significant contributors to genome diversification (11). Analysis of L. johnsonii strains revealed that ca. 50% of the genetic diversity between strains was due to prophages (53). Prophages may also serve as target regions for chromosomal rearrangements, especially when different prophages from the same lysogen share DNA sequence identity (11). Although prophages are a significant contributor to genome diversification, they also can contribute genes that increase the fitness of the lysogen (9, 13, 35, 47). The major virulence factor for Escherichia coli O157:H7, Stx (Shiga-like toxins), is found within a lambdoid prophage (55), and several important virulence factors for gram-positive bacteria are found within prophages, for example, in group A streptococcus strain MGA315 (5). Within the LAB, transcriptional analysis has identified several putative "extra" prophage genes that may be transcribed from the prophage in the lysogenic state (51-53). These extra prophage genes, also known as morons (coding regions plus transcription control sequences inserted between a pair of genes in one phage genome when the genes are adjacent in a related phage genome), are postulated to be lysogenic conversion genes that contribute to the evolutionary fitness of the host strain in the environment (10, 12, 24).
Recently, several bacteriophage genomes have become available from the closely related species L. casei and L. rhamnosus, allowing for a genomic comparison (20, 34, 50, 51). Phylogenetic analysis using a phage proteomic tree has confirmed the shared ancestry of these phages (51; http://phage.sdsu.edu/
rob/PhageTree/v4/neighbor-joining.pam.html). Interestingly, A2,
AT3, and Lca1 from L. casei are prophages, whereas Lc-Nu, from L. rhamnosus, is a virulent phage. Lc-Nu is missing components of the lysogeny module and genetic switch region, resulting in a virulent lifestyle (50). In fact, several virulent Lactobacillus phages have been postulated to have a prophage origin (13, 39, 48).
L. rhamnosus M1 is an industrial fermentation strain for the production of L-lactate. Due to the possibility of spontaneous prophage induction during use or of prophage DNA involvement in the generation of new virulent phages (8, 15, 29, 30, 39, 48), L. rhamnosus M1 was screened for the presence of an inducible prophage. The present study reports the isolation and characterization of inducible L. rhamnosus prophage Lrm1, its complete genome sequence, and similarities to closely related phages of L. casei and L. rhamnosus.
|
|
|---|
(Invitrogen, Carlsbad, CA) was propagated in Luria-Bertani medium (Becton Dickinson) at 37°C using 50 µg of ampicillin/ml for selection as necessary. Cultures were stored at –20°C in the appropriate medium supplemented with 10% (vol/vol) glycerol.
Prophage induction, curing, and DNA preparation.
Prophage induction of L. rhamnosus M1 was attempted through the addition of various concentrations of mitomycin C (MC; Sigma-Aldrich Chemical Co., St. Louis, MO) to cells at various stages of the early growth phase. The cultures were examined after 18 h for lysis. Complete lysis was not observed with MC induction, but optimal induction occurred when 0.1 µg of MC/ml was added to cells at an optical density of 600 nm (OD600) of 0.1 or when 0.3 µg of MC/ml was added to cells at an OD600 of 0.5. Spot titrations of the prophage were performed on MRS plates containing 10 mM calcium chloride using standard double-layer agar methods (49).
For prophage curing, L. rhamnosus M1 cells were plated on MRS agar containing different concentrations of MC (from 0.01 to 0.5 µg/ml) and incubated at 37°C for 48 h. Colonies which appeared on MC plates were transferred to 96-well microtiter plates containing (i) MRS broth only or (ii) MRS broth (50%), MC-induced L. rhamnosus M1 filtered culture supernatant (50%), and bromocresol purple (0.001 g/liter), followed by incubation at 37°C for 16 h. The colonies that did not grow in the medium containing the indicator (no color change) were separately tested with induction experiments using MC.
For phage DNA preparations, partial lysates from MC induction were centrifuged to remove remaining bacterial cells and filtered through a 0.45-µm-pore-size syringe filter (Nalgene, Rochester, NY). The phage lysates were treated with nuclease (both DNase and RNase), and phage DNA was extracted as described previously (15). Genomic DNA from L. rhamnosus M1 was extracted as described previously for Lactococcus lactis (15). Restriction enzymes, T4 ligase, and PCR enzymes were purchased from Roche Applied Science (Indianapolis, IN) and used according to standard methods (45).
Electron microscopy.
The supernatant from induced M1 cells was filter sterilized to remove bacterial cells and debris and subjected to ultracentrifugation for 4 h in a Beckman L8-70 centrifuge at 150,000 x g. Phage pellets were gently resuspended in 50 mM Tris buffer (pH 7.6). After a 10-min centrifugation in a microcentrifuge, 1 drop of supernatant was deposited on a Formvar grid and negatively stained with 2% potassium phosphotungstate (pH 7.2), and the excess liquid was adsorbed with filter paper. The specimens were dried briefly and photographed with a FEI/Philips EM 208S transmission electron microscope at the Laboratory for Advanced Electron and Light Optical Methods, College of Veterinary Medicine, North Carolina State University.
Prophage DNA isolation, amplification, sequencing, and sequence analysis.
For preliminary sequencing, prophage DNA from induced M1 cells was digested with EcoRV, RsaI, and HindIII restriction enzymes and cloned into pBluescript II KS(+) plasmid DNA (Stratagene, La Jolla, CA) digested with EcoRV or HindIII enzymes. E. coli DH5
cells were transformed with ligation mixes using the Z-Competent E. coli transformation buffer set (Zymo Research, Orange, CA) and selected on Luria-Bertani medium with ampicillin. Colony PCR was performed as follows. Transformants were picked to 15 µl of water in 96-well plates and heated to 99°C for 4 min. Then, 2-µl aliquots were used for PCRs using M13 forward and reverse primers (CGCCAGGGTTTTCCCAGTCACGAC and TCACACAGGAAACAGCTATGAC, respectively) and the Expand Long Template PCR system (Roche Applied Science, Indianapolis, IN) according to the manufacturer's instructions. PCR products were purified by using a QIAquick PCR purification kit (Qiagen, Inc., Valencia, CA). Sequencing was performed by Davis Sequencing, Davis, CA, using ABI 3730 DNA sequencers. Subsequent sequencing of the entire M1 prophage genome was performed with PCR products amplified from M1 genomic DNA. Oligonucleotide primers were designed by using the Clone Manager Professional Suite version 8 software (Scientific and Educational Software, Cary, NC). Primers were obtained from Integrated DNA Technologies (Coralville, IA). PCR was performed by using the Expand Long Template PCR System and the Expand High Fidelity PCR System (Roche) according to the manufacturer's protocols. Sequences were processed and assembled by using Staden PreGap4 and Gap4 Genome Assembly Program (7). The sequence was analyzed by using Clone Manager 6.0 (Scientific & Educational Software, Cary, NC) and NCBI open reading frame (ORF) finder software (2). Sequence homology searches were carried out by using NCBI BLAST software. The GenBank accession number of the completed double-stranded sequence is EU246945.
To obtain the L. rhamnosus M1 attB sequence, genomic M1 DNA was separately digested with HindIII and EcoRV, and ligated with similarly digested pBluescript II KS(+) plasmid DNA. PCR products were obtained from the ligation mixes using each of two primers flanking the predicted phage attP region upstream of the integrase gene (forward, CCATTACGCATCTGAGAATGA; reverse, AAAGTCTACGCTCATCTTCTTG) combined with pBluescript II forward or reverse primers. The PCR products were sequenced with the same primers to obtain the attL and attR sequences. To confirm the M1 attB site, the following primers were used to PCR amplify and sequence M1 genomic DNA (attB left, CGTTTCGATGAATACGTTAAG; attB right, GCTAATCCTCCATGACGATTAC). The ability to amplify this region depends on the presence of prophage cured cells within the lysogenic population.
|
|
|---|
![]() View larger version (60K): [in a new window] |
FIG. 1. (A) MC (0.1 µg/ml) prophage induction curves for L. rhamnosus M1. Symbols indicate the OD600 of cells when MC was added: , no MC added; , 0.1; , 0.2; and , 0.3. (B) Electron micrograph of phage Lrm1. Bar, 100 nm.
|
Prophage curing experiments were carried out to obtain a sensitive host for phage Lrm1 and for possible use as a replacement for M1 in an industrial fermentation. Some cells in a lysogenic population may not contain the prophage and thus may survive MC exposure. L. rhamnosus M1 was diluted and plated on MC-supplemented MRS agar plates. Individual colonies were picked and screened for sensitivity to the induced phage in broth culture supplemented with a pH indicator. However, all colonies that did not grow in the medium containing the phage supernatant and the pH indicator subsequently showed lysis after induction with MC (0.1 µg/ml). Therefore, a cured derivative of L. rhamnosus M1 was not obtained. It is possible that lysis could occur after curing prophage Lrm1 if a second prophage were present in the lysogenic strain. However, restriction digests of Lrm1 DNA matched the predicted sites from genome sequencing (see below), providing evidence that no other phage was being induced.
Sixteen L. casei, L. paracasei, and L. rhamnosus strains from the NCK culture collection were screened for sensitivity to phage Lrm1 by using the spot titer method. No plaques were detected on the following strains: L. casei ATCC 393, NCBI 4114, ML6, SA, Lc-11, and ATCC 25302; L. paracasei Lbc81, Lbc82, Lc-10, Lbc183, #2, and #2a; and L. rhamnosus GG, LbC80, LR-32, and ATCC 11982. Thus, a propagating host for Lrm1 was not identified, either from a cured derivative of M1 or from another related Lactobacillus strain. It was not surprising that the search for a host strain was unsuccessful due to the apparent defective nature of Lrm1.
Genome organization of prophage Lrm1.
Analysis of the contigs from initial shotgun sequencing of phage Lrm1 revealed a number of regions on some of the contigs with high similarity to L. casei phage A2 (20). The homologous contigs were ordered via mapping to the A2 genome, and PCR primers were designed from the homologous regions in order to generate amplicons which would cover the complete Lrm1 genome. The resulting nine PCR amplicons, ranging from 1.7 to 10 kb in length, were sequenced by using primer walking. The completed de novo double-stranded sequence of Lrm1 revealed a genome of 39,989 bp with a G+C content of 45.5% (Fig. 2A and B). The length and G+C content of phage Lrm1 correspond to the values for the related phages A2,
AT3, Lca1, and Lc-Nu (Table 1). Blastn analysis of the Lrm1 genome revealed regions of high similarity with genomic phage sequences for L. casei A2,
AT3, and Lca1, and L. rhamnosus phage Lc-Nu, as well as the Lc-Nu-like prophage of L. rhamnosus strain 1/3 (see Table S1 in the supplemental material and Fig. 2C). Homology was also found with the smaller cos regions of L. casei phages PL-1 and J1.
![]() View larger version (18K): [in a new window] |
FIG. 2. Schematic map of phage Lrm1. (A) Putatively identified genes are labeled. Modules are indicated as follows: packaging, light blue; structural, yellow; cell lysis, purple; integration, green; genetic switch, red; and replication, white. Selected genes are indicated as follows: methylase, dark orange; endonuclease, light orange; and all others, black. (B) G+C percentage of Lrm1 genome (molbiol-tools.ca). (C) Blastn analysis of the phage Lrm1 genomic sequence was performed. The regions of homology for the following phages are shown: line 1, L. casei bacteriophage A2, complete genome, 43,411 bp; line 2, L. casei bacteriophage AT3, complete sequence, 39,166 bp; line 3, L. rhamnosus bacteriophage Lc-Nu, complete genome, 36,466 bp; line 4, L. casei phage Lca1, complete sequence, 52,470 bp; line 5, L. rhamnosus strain 1/3 Lc-Nu-like prophage, 12,404 bp; line 6, L. casei bacteriophage PL-1, length, 653 bp; line 7, L. casei bacteriophage J1 cohesive end site (cos), length, 362 bp. The Blast alignment scores are as follows: blue, 40 to 50; green, 50 to 60; pink, 80 to 200; and red, >200.
|
|
View this table: [in a new window] |
TABLE 1. General features of Lrm1 and related bacteriophagesa
|
AT3 and L. rhamnosus phages Lc-Nu are aligned, showing ORF homologies with phage Lrm1 in Fig. 3.
![]() View larger version (63K): [in a new window] |
FIG. 3. Alignment of the genomic maps for L. casei phages A2 and AT3 and L. rhamnosus phages Lc-Nu and phage Lrm1. Amino acid identities are indicated by the following colors: pale gray, 20 to 40%, medium gray; 40 to 60%; bright gray, 60 to 80%; and dark gray, 80 to 100%.
|
AT3 (34), and L. casei phage Lca1 (51) (Fig. 2C and 3 and see Table S1 in the supplemental material). Phage A2 has been extensively characterized regarding its taxonomy, morphology, genetic switch, replication, and gene expression (3, 4, 17-21, 25, 31-33, 37, 40, 44). The packaging module of phage Lrm1 is predicted to consist of ORFs 54, 1, and 2. Lrm1 ORF54 encodes a putative small subunit of the phage terminase, which can also be classified as an HNH nuclease (smart00507, e-value 0.0001). The HNH family of proteins is associated with DNA binding and cutting functions and includes some phage packaging proteins (38). Lrm1 ORF54 is a hybrid of A2 ORFs 60 and 61. In A2, ORFs 60 and 61, as well as ORF59, may be linked by translational coupling (20). The product of phage A2 ORF61 has been shown experimentally to be the small subunit of the terminase enzyme (20). Garcia et al. (20) speculate that the proteins encoded by phage A2 ORFs 61 and 1 have redundant activities. If so, this may also be the case in Lrm1 for corresponding proteins from ORFs 54 and 1. Lrm1 ORF2 corresponds to ORF 2 from phage A2, identified as the A2 large terminase subunit. In many phages, the large and small terminase subunits cleave concatemeric phage DNA at cos sites and package the DNA into phage heads (28). The small subunit recognizes and binds to the phage DNA site, while the large subunit usually provides the endonuclease and ATPase activities for packaging.
Runoff sequencing of the cos ends of phage Lrm1 from purified phage DNA was not successful, likely due to the defective nature of the phage. However, the cos ends are predicted to be similar to those of L. casei phages A2, J1, and PL-1, based on phage Lrm1 homology over the cos site regions of these phages (Fig. 4). The cos sites of all three L. casei phages were experimentally determined and are identical except in length.
![]() View larger version (26K): [in a new window] |
FIG. 4. CLUSTAL W alignment of sequence from the cos regions of L. rhamnosus phage Lrm1 and L. casei phages A2, PL-1, and J1. Experimentally determined cos sites for the L. casei phages are underlined.
|
The protein encoded by Lrm1 ORF6 is highly similar over its entire length, with the A2 major head protein. In A2, an apparent 328-bp gap between ORF5, the major head protein, and ORF6, a DNA packaging protein, encodes a second, frame-shifted capsid protein 85 residues longer than the shorter version (21). Both the shorter and the frameshifted longer capsid proteins are necessary for A2 viability (21). Interestingly, Lrm1 ORF6 ends with a CCCAAAA slippery sequence, which would allow the protein to be extended by an additional 17 residues through frameshifting. However, a divergence in Lrm1-A2 homology in the region replaces the extended head protein, as well as the first 16 amino acids of the following gene, ORF7, with a much shorter shifted head protein and slightly longer ORF7. ORF7 encodes a putative DNA packaging protein that is similar to A2 ORF6.
The neck region of phage Lrm1 (ORFs 7 to 10) closely resembles the same region in L. casei phage A2 (ORFs 6 to 9). Phage Lrm1 ORF7 encodes a predicted DNA packaging protein and overlaps ORF8 (predicted head-tail joining protein) by 120 bp, as is the case for phage A2 ORFs 6 and 7. As in A2 ORFs 7 to 9, Lrm1 ORFs 8 to 10, predicted head-tail joining proteins, have overlapping start and stop codons. Phage A2 ORFs 7 to 9 are predicted to have translational coupling (20), which may also be the case with phage Lrm1.
The tail morphogenic cluster of phage Lrm1, composed of ORFs 11 through 15, is most similar to the same region in phage A2. ORF11 encodes the predicted major tail protein of the phage. ORF12, which has no predicted function, is twice as long as the corresponding ORF11 of phage A2. ORF13 is a predicted tape measure protein, nearly identical to that of A2, and ORF14 is related to hypothetical proteins of phages A2, Lca1, and Lc-Nu. ORF15 shares homology over its N terminus, but not the C terminus, with host specificity proteins of phages A2, Lca1, and Lc-Nu, suggesting that phage Lrm1 may have a different host range. Several antireceptors experimentally identified in Streptococcus phages share collagen-like repeats (Gly-X-Y) and 17-amino-acid motifs found in phage Lrm1 ORF15 (14). The putative antireceptors from Lc-Nu,
AT3, and A2 all contain both of these sequences (50).
Phage Lrm1, like phage A2, may have a frameshift in its predicted major tail protein gene. The slippery CCCAAAA sequence from the frameshifted A2 capsid gene (21) is found in the sequence of both the A2 and the Lrm1 tail genes (44), and DNA level homology extends through the major tail genes and the downstream region that would potentially encode longer, frameshifted tail proteins. In contrast, a conserved frameshift of many double-stranded DNA phages occurs in tail assembly genes that are not part of the completed tail but may function as assembly chaperones (57). The assembly gene frameshifting occurs in overlapping ORFs found between genes encoding the major tail protein and the tape measure protein. Phage A2 apparently does not have a frameshift in its assembly gene (44), nor does Lrm1 in ORF12. Examination of the genomes of phages Lc-Nu and AT3 in this region reveals that neither is likely to encode a frameshift in the major tail proteins but that both have potential frameshifted ORFs of their highly similar putative tail component genes between the major tail protein and the tape measure protein. However, neither has an identifiable slippery sequence that would be required for frameshifting to occur.
The high similarity of prophages Lrm1 and A2 over the packaging and structural modules raises the question of why Lrm1 appears to be defective while A2 is not. Electron micrographs of Lrm1 show not only some fully assembled phages but also many empty heads and separate tails (Fig. 1B). Furthermore, a host for Lrm1 was not found among several L. casei and L. rhamnosus strains. The minor sequence differences occur at Lrm1 ORF54 (putative small terminase subunit), in the region of the putative major head protein and DNA packaging protein, and the longer length of Lrm1 ORFs 7, 10, and 12 compared to similar ORFs in A2. The phages' host specificities may also differ.
Cell lysis module.
The lysis module of phage Lrm1 includes a putative holin encoded by ORF18 and lysin encoded by ORF19. The predicted holin shows one strong transmembrane domain between amino acids 6 and 23. The ORF18 protein is homologous with one of the two predicted holins of phage Lc-Nu (ORF20). Phage Lrm1 ORF19 encodes a putative lysin that is very similar to the lysin from Lc-Nu and the lysozyme M1 (1,4-β-N-acetylmuramidase) encoded by L. casei ATCC 334. The C terminus of phage Lrm1 ORF19 contains two LysM domains that are predicted to be involved in bacterial cell wall degradation, while the N terminus contains a Glyco_25 (smart00641) domain (conserved across glycosyl hydrolases). SignalP (http://www.cbs.dtu.dk/services/SignalP/) analysis revealed the presence of a signal peptide with a predicted cleavage site (cleavage site probability of 0.938) between positions 28 and 29 of the deduced Lrm1 lysin amino acid sequence. Such a signal peptide was reported for Oenococcus oeni phage fOg44 and was shown to be active (46).
Integration module and attachment sequence.
The region between the Lrm1 phage lysin (ORF19) and the integrase (ORF24) contains two genes encoding hypothetical proteins (ORFs 20 and 21, similar to proteins of unknown function in the L. plantarum phage
g1e), and two genes encoding unknown proteins (ORFs 22 and 23, no database matches). These four ORFs are not linked to known phage-specific functions. The G+C content of the region is 44%, which is comparable to the 45.5% for the Lrm1 genome as a whole. The predicted integrase of phage Lrm1 (ORF24; 375 amino acids) is similar to the integrase from Lactobacillus casei phage
AT3 and encodes the conserved multidomain INT_P4 (cd00801, bacteriophage P4 integrase) often found in temperate bacteriophages and other mobile genetic elements. The integrase from bacteriophage P4 mediates integrative and excisive site-specific recombination between the attachment sites located on the phage genome and the bacterial chromosome. In addition, the C-terminal catalytic domain INT_phiLC3_C (cd01189) of Lactococcus lactis
LC3 phage typical of phage-related integrases, site-specific recombinases, and DNA breaking-rejoining enzymes, is present in the phage Lrm1 integrase.
The phage attachment site is often found adjacent to the integrase gene, while the host attachment sites are frequently situated near tRNA genes (56). In the case of Lrm1, the putative attP attachment region is just upstream of the putative integrase gene. The corresponding region in the genome of L. rhamnosus M1 was sequenced with primer walking (Fig. 5 and Table 1). The attB sequence occurs at the 3' end of a putative 5S rRNA region. Blastn similarities of the Lrm1 attachment region were found with several 5S ribosomal regions of L. casei ATCC 334 and other Lactobacillus strains. The closely related phages A2,
AT3, and Lca1 have different attB locations than Lrm1 (Table 1).
![]() View larger version (10K): [in a new window] |
FIG. 5. (A) Phage insertion site attB in the Lactobacillus rhamnosus M1 genome. (B) Alignment of the attachment sequences from M1 (attB), the Lrm1 prophage (attL, attR), and Lrm1 (attP).
|
Lysogeny module.
Phage Lrm1 ORFs 26, 27, and 28 encode the predicted CI-like repressor, Cro-like protein, and antirepressor, respectively. ORFs 26 and 27 are nearly identical to the lytic cycle repressor CI and Cro protein of phage A2. The operator region of Lrm1 is also nearly identical to that of A2 and therefore likely uses the same operators in its genetic switch (19, 31, 33). Phage Lrm1 ORF28 encodes a 242-amino-acid protein that contains a complete ANT (pfam03374) phage antirepressor domain and a truncated phage conserved domain of unknown function (COG3646). The phage Lrm1 antirepressor shows 40% identity over the whole sequence with the antirepressor of the C. difficile phage
CD119 (22). In addition, the C terminus of the Lrm1 antirepressor shows high similarity to antirepressors from C. novyi NT (6) and Lc-Nu (50). It is remarkable that both Lrm1 ORF25, encoding a protein of unknown function, and ORF 28, encoding the antirepressor, share similarity to C. difficile genes, whereas ORFs 26 and 27 do not. Notably, although the production of C. difficile toxins has not been shown to be encoded by temperate phages, the pathogenicity island (PaLoc) containing the genes necessary for toxin production resembles a mobile element (23).
DNA replication module.
The nine ORFs of the predicted replication module of phage Lrm1 (ORFs 29 to 37) are highly similar to phage
AT3 and generally show less similarity to phages A2, Lc-Nu, and Lca1 (see Table S1 in the supplemental material and Fig. 3). The functions of the predicted proteins of ORFs 29 through 32 are unknown, and they do not have any identifiable conserved protein domains or signal sequences (http://www.cbs.dtu.dk/). Although phage Lrm1 ORF33 also has no confirmed function, it encodes a 161-amino-acid protein that contains a complete Sipho_Gp157 (pfam05565) domain that is thought to confer phage resistance for organisms possessing a gene with this domain. Phage Lrm1 ORFs 34 and 35 are predicted to encode an NTP-binding protein and a single-stranded binding protein. As in phage
AT3 ORF29, the N-terminal region of the phage Lrm1 ORF35 protein has numerous
-helices and β-sheets, while the C-terminal region has an acidic domain consisting of 10 amino acids (IDVSDDDLPF). Although the function of the acidic domain is not known, it is necessary for SSB function in E. coli (16). Phage Lrm1 ORF36 is a putative DNA replication protein with no identifiable conserved domains but has regions of high similarity with known DNA replication proteins. Lastly, ORF37 is annotated as dnaC, a DNA replication protein, based on the presence of the DnaC conserved domain (COG1484; 8e-13) and similarity to replication proteins of phage Lca1 and phage
AT3.
Region of unknown function.
Between the replication and packaging module of phage Lrm1 are 16 ORFs (ORFs 38 to 53) that do not belong to any of the described modules. Compared to the six predicted modules, this region has more diffuse similarities with the closely related phages A2,
AT3, Lc-Nu, and Lca1 (see Table S1 in the supplemental material and Fig. 2B). A portion of the corresponding region in phage A2 has been shown to be dispensable for phage A2 function under laboratory conditions (33), which is consistent with this region having higher genetic exchange rates. The region contains only two ORFs that have a predicted function: ORF43 (DNA methylase) and ORF51 (endonuclease). Phage Lrm1 ORF43 has no homolog in the closely related phages A2,
AT3, Lc-Nu, and Lca1, and yet it is very similar to putative DNA-methylases in various Lactococcus, Streptococcus, and Haemophilus phages. Although nonhomologous to phage Lrm1 ORF43, phage A2 ORF47 is a putative DNA methylase contained within the dispensable region of phage A2 (33), suggesting the possibility that phage Lrm1 ORF43 may be dispensable for phage Lrm1 function. Phage Lrm1 ORF51 is somewhat related to predicted endonucleases from phages A2,
AT3, and Lc-Nu. The presence of an endonuclease NUMOD4 motif (pfam07463; 2e-10) supports the endonuclease prediction for phage Lrm1 ORF51.
Conclusions.
L. rhamnosus M1 is an industrial fermentation strain which contains the inducible prophage Lrm1. Phage Lrm1 appears to be defective based on the incomplete lysis of MC-induced cultures (Fig. 1A) and the relative absence of intact phage particles in the lysate (Fig. 1B). A sensitive Lactobacillus host for Lrm1 could not be identified, nor could the prophage be cured from its lysogenic host, M1. These results could have implications for the use of L. rhamnosus M1 in industrial fermentations. The presence of a prophage could provide superinfection immunity against infecting phages, an advantage for an industrial strain. In contrast, the prophage could contribute DNA in recombination events, leading to the creation of new, virulent phages, which could then infect the host. The mosaic nature of phage Lrm1 homologies with closely related L. casei and L. rhamnosus phages demonstrates the well-known ability of LAB phages to undergo lateral gene transfers, as well as conversions from temperate to lytic lifestyles (13). Interestingly, the mosaic and rapidly evolving nature of bacteriophages was demonstrated by the fact that there was no single ORF that was highly related over the entire length of the ORF, among all five of these related phages. The unique ORFs of phage Lrm1 are of interest for their possible contribution to the environmental fitness of the phage's lysogenic host, L. rhamnosus M1. The region between the putative lysin gene and phage attachment site, just downstream from the integrase gene of Lrm1, includes ORFs 22 and 23. A comparable region in pathogenic Streptococcus pyogenes prophages contains lysogenic conversion genes and frequently contains ORFs with no known phage-related function in prophages of nonpathogenic LAB (13). However, biochemical or genetic evidence for lysogenic conversion in fermentative LAB prophages is still lacking (13). Phage Lrm1 ORFs 22 and 23 have no known homologies or function, but both potentially encode proteins with transmembrane helices and possible N-terminal signal sequences. In phage A2, this region encodes ORF19, a low G+C content gene that is lethal when cloned in E. coli (20) but is not found in phage Lrm1. In addition, Lrm1 ORFs 45 and 46 are morons: the flanking ORFs, ORFs 44 and 47, are homologous to
AT3 ORFs 38 and 39. Again, these ORFs have no known homologies or function. Finally, Lrm1 ORF 43 is a predicted DNA methylase, and ORF 51 is a predicted endonuclease. Temperate phage Lc-Nu encodes three putative methylases, phage A2 encodes one, and L. lactis phage Tuc2009 encodes one that shares homology with the Lrm1 putative methylase. Phage Lc-Nu encodes three nucleases, and phage A2 encodes two; however, nucleases related to the A2 nuclease are not believed to function in restriction-modification systems (42).
The prophages of LAB are no longer simply regarded as "selfish DNA" or as inert entities in a cell's genome. In particular, Lactobacillus prophages are of interest, since relatively few Lactobacillus lytic phages have been identified. Future investigations will undoubtedly lead to a better understanding of the role of temperate phages in relation to their lysogenic hosts and the evolution of virulent phages in fermentation environments.
We thank Jarett Styron for technical assistance with the prophage curing experiments, Michael J. Dykstra of The Laboratory for Advanced Electron and Light Optical Methods, College of Veterinary Medicine at North Carolina State University, for electron microscopy, and the staff of Davis Sequencing, LLC, Davis, CA.
Published ahead of print on 6 June 2008. ![]()
Supplemental material for this article may be found at http://aem.asm.org/. ![]()
E.D. and M.J.M. contributed equally to this study. ![]()
Present address: Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign, Urbana, IL 61801. ![]()
|
|
|---|
adh. Gene 236:333-346.[CrossRef][Medline]
393 A2, a bacteriophage that infects Lactobacillus casei. Microbiology 140:2585-2590.
g1e: the whole genome sequence and the putative promoter/repressor system. Gene 187:45-53.[CrossRef][Medline]
AT3 isolated from Lactobacillus casei ATCC 393. Virology 339:42-55.[CrossRef][Medline]
adh and plasmid transduction in Lactobacillus acidophilus ADH. Appl. Environ. Microbiol. 55:2206-2213.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»