Previous Article | Next Article 
Applied and Environmental Microbiology, August 2008, p. 5254-5258, Vol. 74, No. 16
0099-2240/08/$08.00+0 doi:10.1128/AEM.00580-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Bacillus subtilis Spores Germinate in the Chicken Gastrointestinal Tract
Stephen T. Cartman,*
Roberto M. La Ragione, and
Martin J. Woodward
Department of Food and Environmental Safety, Veterinary Laboratories Agency, Woodham Lane, New Haw, Addlestone, Surrey KT15 3NB, United Kingdom
Received 11 March 2008/
Accepted 21 June 2008

ABSTRACT
A number of poultry probiotics contain bacterial spores. In
this study, orally administered spores of
Bacillus subtilis germinated in the gastrointestinal (GI) tracts of chicks. Furthermore,
20 h after spores were administered, vegetative cells outnumbered
spores throughout the GI tract. This demonstrates that spore-based
probiotics may function in this host through metabolically active
mechanisms.

INTRODUCTION
Antibiotic feed supplements have been used in commercial poultry
farming for over 50 years due to their growth-promoting and
prophylactic properties (
3,
7,
11). However, their use in the
European Union (EU) was banned in 2006 as part of an initiative
aimed at promoting the prudent use of antibiotics (
1,
18,
24).
As a result, there is now a market for alternative growth-promoting
and prophylactic products. In general, feed supplements remain
the method of choice, due to the scale and economics of modern
poultry farming.
Probiotics are one form of alternative feed supplement or "functional food." They can be defined as "live microorganisms which, when administered in adequate amounts, confer a health benefit on the host" (10). Many probiotic products are already available for commercially farmed poultry, and a number of these contain or consist of bacterial spores, principally of the genus Bacillus (4, 5, 16). Bacterial spores are particularly well suited for use as live microbial products as they are metabolically dormant and highly resilient to environmental stresses. These intrinsic properties are highly desirable from a commercial perspective and mean that spore-based products have a long shelf life and retain their viability during distribution and storage. Despite this, knowledge of how bacterial spores may function as probiotics is severely limited at present.
Considering that bacterial spores are metabolically dormant, it is of particular interest to question whether or not they are able to germinate in the chicken gastrointestinal (GI) tract. This is an important point to address, as it is widely accepted that microorganisms must be in a viable state to function as probiotics, the implication being that one or more metabolic processes are essential for probiotic function in the host GI tract. Indeed, if spores do not germinate in the chicken GI tract, it is difficult to envisage how they may function as probiotics through mechanisms which require them to be metabolically active (e.g., secretion of antimicrobial compounds and competition for essential nutrients).
Early work with mammalian hosts suggested that bacterial spores are able to germinate in the GI tracts of dogs, rabbits, and mice (13, 15). Definitive proof of this was obtained when it was shown that vegetative cells of Bacillus subtilis could be detected in the small intestines of mice after they had received an oral dose of spores (6, 25). More recently, spore germination has been observed in the GI tracts of pigs, using flow cytometry analysis (17). While all of these findings are important in the context of mammalian hosts, it cannot be assumed that they will translate directly to an avian host, primarily due to differences in GI anatomy and physiology. Consequently, in the wake of the EU ban on antimicrobial feed supplements and in view of the fact that a number of spore-based probiotic products are already available for commercially farmed poultry, in this study we addressed the pertinent question of whether or not spores of the model spore-forming bacterium B. subtilis are able to germinate in the chicken GI tract. We used a 1-day-old chick model as this is the approximate age of chickens when they are first housed within broiler sheds and placed on diets supplemented with "functional foods," such as antibiotics or probiotics.

Spores are transient members of the chick GI tract.
To address the fate of orally administered spores, 1-day-old
specific pathogen-free White Leghorn chicks were each dosed
by oral gavage with 1
x 10
9 spores of
B. subtilis SC2362 (
6,
8,
9) suspended in 0.1 ml of sterile distilled water. This strain
of
B. subtilis harbors a unique
rrnO-lacZ fusion gene and a
chloramphenicol acetyltransferase (
cat) gene in the chromosome.
Spores were prepared as described previously (
22), including
sequential treatment with lysozyme (20 mg/ml) and heat (68°C
for 90 min) to ensure there were no contaminating vegetative
cells present. Three chicks were selected at random for sampling
at 6, 12, 20, 48, and 168 h after spore doses were administered.
Sections of duodenum, jejunum, ileum, cecum, and colon were
excised from each chick postmortem, and the number of
B. subtilis SC2362 spores per gram of tissue (including luminal contents)
was determined by heat treatment (to kill vegetative cells and
background contaminants), serial dilution, and plating. A mean
value was calculated for the number of spores in the duodenum,
the jejunum, and the ileum of each chick and reported as the
number of spores per gram of small intestine. Numbers of
B. subtilis SC2362 spores were found to decrease with time, throughout
the GI tract, indicating that spores are transient members of
the chick GI microflora (Fig.
1). This may have been due to
spore germination in the GI tract and/or shedding of spores
in feces. Between 5
x 10
2 and 5
x 10
3 spores remained in the
GI tract of each chick at the end of the experimental period.

Spore germination in the chick GI tract.
To investigate the possibility of spore germination in the GI
tracts of chicks, a reverse transcriptase PCR (RT-PCR)-based
method was developed for detecting vegetative cells of
B. subtilis SC2362. We decided to use a molecular approach, as preliminary
work revealed that the process of serial dilution and plating
onto medium supplemented with chloramphenicol was an unreliable
method for accurately determining total viable counts of
B. subtilis SC2362 (i.e., spores and vegetative cells) in samples
of gut tissue. Other researchers have reported similar problems
(
14,
15), the issues being (i) inefficient and nonsynchronous
spore germination in the absence of a heat treatment/activation
step, which leads to an underestimation of total viable units,
and (ii) growth of background contaminants which obscure colonies
of
B. subtilis on agar plates. Ultimately, our decision to use
RT-PCR was based on successful work by researchers elsewhere
(
6,
25).
In the first instance, a semiquantitative RT-PCR assay was developed for detecting vegetative cells of B. subtilis SC2362. Total RNA was prepared from 30-mg sections of gut tissue (including luminal contents), using an RNeasy mini-kit (Qiagen), and RNA concentrations were determined by spectroscopy prior to RT-PCR. The primers SC2362-F (GGGAGGGTCATTGGAAACTG) and SC2362-R (CCTATATAAAAGCATTAGTGTATCAACAAGC) were designed using Primer Express software (Applied Biosystems) to target the unique rrnO-lacZ sequence of B. subtilis SC2362. The assay was then validated using sections of control tissue spiked with known numbers of vegetative cells. A visible RT-PCR product of the expected size (117 bp) was amplified when total RNA from gut tissue spiked with
1 x 104 vegetative cells of B. subtilis SC2362 was used as the template (Fig. 2). The absolute detection limit of the assay was found to be 100 cells or 3.33 x 105 cells per gram of tissue. (Total RNA was extracted from sections of tissue that weighed 30 mg and were eluted in 50 µl. A 0.5-µl volume of eluate was then used as the template in RT-PCR). No RT-PCR product was amplified from RNA extracted from the parental B. subtilis strain PY79 (26) or from spores of B. subtilis SC2362, indicating that the assay was specific for the rrnO-lacZ mRNA of B. subtilis SC2362 vegetative cells (data not shown). Additional RT-PCRs with an initial RT denaturing step (95°C for 30 min) or with primers Bact-F (CTGGTCGTACCACTGGTATTG) and Bact-R (CAGGTGGGGCAATGATCTTG), used to amplify a 550-bp product from chicken β-actin mRNA (2), confirmed that RT-PCR products were not amplified from contaminating DNA and that the RNA preparation procedure was consistent between samples (data not shown).
To determine whether or not orally administered spores of
B. subtilis SC2362 germinated in the GI tracts of chicks, RT-PCR
was carried out using RNA template from sections of gut tissue
which had been sampled from chicks at 6, 12, 20, 48, and 168
h after they had been dosed with spores. The
rrnO-lacZ RT-PCR
product was amplified from RNA template prepared from the ceca
and colons of two of the three chicks sampled at 12 h and all
three of the chicks sampled 20 h after spore doses were administered
(Fig.
3). Repeat reactions with an initial RT denaturing step
or with the primers Bact-F and Bact-R confirmed that these were
true positives (i.e., not amplified from contaminating DNA)
and that the RNA preparation procedure was consistent between
all samples (data not shown). As samples from the 12- and 20-h
time points were the only ones to test positive for
B. subtilis SC2362 vegetative cells (indicating the presence of at least
3.33
x 10
5 cells per gram of tissue), we proceeded to analyze
these samples by TaqMan real-time quantitative RT-PCR (qRT-PCR)
to estimate the numbers of vegetative cells present.
For qRT-PCR, the primers SC2362-F and SC2362-R were used in
conjunction with the fluorescently labeled TaqMan probe, SC2362-P
([FAM]-TTCCACTCTCCTCTTCTGCACTCAAGTT-[TAMRA]). The probe was
designed, using Primer Express software (Applied Biosystems),
to lie across the splice junction of the unique
rrnO-lacZ sequence,
thus ensuring the assay was specific for vegetative cells of
B. subtilis SC2362. The qRT-PCR assay was validated using the
same RNA preparations as those used to validate the semiquantitative
RT-PCR assay (i.e., those from control tissue spiked with known
numbers of vegetative cells). Results were plotted to obtain
a calibration curve for the qRT-PCR assay (Fig.
4). The efficiency
of the qRT-PCR was low (55%) as an unfortunate consequence of
having to specifically target the splice junction of the
rrnO-lacZ sequence. However, considering that the qRT-PCR assay was used
for absolute quantification of
B. subtilis SC2362 vegetative
cells (as opposed to relative quantification by comparison to
an endogenous housekeeping gene) and that there was a good linear
relationship between the log
10(number of vegetative cells) and
qRT-PCR signal strength (
R2 = 0.9970), the assay was fit for
the purpose of this study. The absolute detection limit of the
qRT-PCR assay was just 2 cells or 667 cells per gram of tissue.
(Total RNA was extracted from sections of tissue weighing 30
mg and eluted in 50 µl. A 5-µl volume of eluate
was then used as template in qRT-PCR.) Control reactions with
no RNA template or RNA template prepared from vegetative cells
of the parental
B. subtilis strain PY79, spores of
B. subtilis SC2362, or from unspiked (negative control) chick tissue did
not yield any qRT-PCR signal, confirming that the assay was
both robust and specific for the
rrnO-lacZ mRNA of
B. subtilis SC2362 vegetative cells.
Analysis of experimental samples from the 12- and 20-h time
points by qRT-PCR enabled us to estimate the numbers of
B. subtilis SC2362 vegetative cells present (Table
1). Furthermore, the
enhanced sensitivity of the qRT-PCR assay enabled us to estimate
the numbers of vegetative cells in samples which did not test
positive by semiquantitative RT-PCR, most notably, samples of
small intestine. Considering that spore doses were administered
in sterile distilled water, which lacks any of the chemical
or nutrient signals associated with spore germination (
12,
23),
this suggests that spore germination was induced either prior
to or upon entry into the chick small intestine. Interestingly,
the number of vegetative cells was found to surpass the number
of spores between 12 and 20 h postdosing in all regions of the
GI tract (Table
1). Based on the results of the present study,
it is not possible to comment on whether this was due to spore
germination alone or whether cell replication within the host
GI tract was also a contributing factor.

Retention of B. subtilis in the chick GI tract.
Finally, estimates were made as to what percentage of the original
spore dose (1
x 10
9) was retained in the GI tract of each chick
at 12 and 20 h postdosing. To do this, the GI tissues of 12
1-day-old chicks were excised and weighed immediately postmortem.
The mean weight of small intestines was 1.21 ± 0.12 g,
that of ceca was 0.25 ± 0.10 g, and that of colons was
0.1 ± 0.01 g. Using these approximations in conjunction
with plating (spores) and qRT-PCR (vegetative cells) data, estimates
were made as to the numbers of spores and vegetative cells retained
throughout the entire GI tract of each chick at 12 and 20 h
postdosing. Between 0.13% and 1.23% of the original spore dose
was estimated to have been retained in the GI tract of each
chick (Table
2). This finding is comparable with that from work
conducted in mice (
6,
25) and supports the notion that
B. subtilis is a transient member of the chick GI microflora, which does
not colonize the GI tract. The remainder of the original spore
dose may have been shed in feces or germinated in the GI environment
and subsequently died due to unfavorable conditions.
In conclusion, we have proven for the first time that spores
of
B. subtilis are able to germinate in the chicken GI tract.
This principle finding agrees with studies conducted with a
mouse model (
6,
25). However, in those studies, vegetative cells
were detected only in the small intestines of mice dosed with
spores. In contrast, vegetative cells were detected throughout
the GI tracts of chicks in the present study. This observation
demonstrates that the findings of experiments conducted with
a mammalian model may not translate directly to an avian host.
Moreover, these findings may reflect genuine physiological and/or
physicochemical differences between the GI tracts of chicks
and mice. Notwithstanding these differences, it is noteworthy
that chicks in the present study were 1 day old at the time
of dosing, whereas mice used in the aforementioned studies were
6 weeks old at the time of dosing. Therefore, the state of GI
microflora maturity and/or physiological status of the host
may have played some part in the apparent disparity between
chicks and mice. Nonetheless, the findings of the present study
are considered highly relevant, as functional foods (e.g., probiotics)
are typically administered to commercially farmed chickens from
one day of age.
B. subtilis spore germination occurred rapidly in the GI tracts of chicks, with vegetative cells outnumbering spores 20 h after spore doses were administered. This may have been due to spore germination alone, although cell replication within the GI environment may also have been a contributing factor. Even though B. subtilis is classically considered to be an obligate aerobe, it may well survive and replicate within the anoxic GI environment, as it can use nitrate or nitrite (in place of oxygen) as a terminal electron acceptor during anaerobic respiration (20, 21).
The RT-PCR assays developed in the present study were designed to identify B. subtilis SC2362 vegetative cells based on the presence of rrnO-lacZ mRNA. Considering that spore germination per se does not require de novo protein synthesis (19), the vegetative cells detected in this study must have either entered or completed the process of spore outgrowth, which is characterized by the onset of metabolic processes (23). This proves that although spore-based probiotics are metabolically dormant upon administration, they may germinate in the GI tract of chicks and function through mechanisms which require them to be metabolically active (e.g., secretion of antimicrobial compounds and/or competition for essential nutrients).

ACKNOWLEDGMENTS
We thank Simon M. Cutting for the kind gift of
B. subtilis SC2362
and Le Hong Duc for technical assistance. We are also extremely
grateful to the Animal Services Unit (ASU) at VLA, particularly
Pete Gilmore and Sue Turner.

FOOTNOTES
* Corresponding author. Present address: Institute of Infection, Immunity and Inflammation, Centre for Biomolecular Sciences, University of Nottingham, University Park, Nottingham NG7 2RD, United Kingdom. Phone: 44 115 846 7959. Fax: 44 115 846 8002. E-mail:
stephen.cartman{at}nottingham.ac.uk 
Published ahead of print on 27 June 2008. 

REFERENCES
1 - Anadon, A., M. R. Martinez-Larranaga, and M. Aranzazu Martinez. 2006. Probiotics for animal nutrition in the European Union. Regulation and safety assessment. Regul. Toxicol. Pharmacol. 45:91-95.[CrossRef][Medline]
2 - Balu, S., and P. Kaiser. 2003. Avian interleukin-12beta (p40): cloning and characterization of the cDNA and gene. J. Interferon Cytokine Res. 23:699-707.[CrossRef][Medline]
3 - Bunyan, J., L. Jeffries, J. R. Sayers, A. L. Gulliver, and K. Coleman. 1977. Antimicrobial substances and chick growth promotion: the growth promoting activities of antimicrobial substances, including fifty-two used either in therapy or as dietary feed additives. Br. Poult. Sci. 18:283-294.[CrossRef]
4 - Cartman, S. T., and R. M. La Ragione. 2004. Spore probiotics as animal feed supplements, p. 155-161. In E. Ricca, A. O. Henriques, and S. M. Cutting (ed.), Bacterial spore formers: probiotics and emerging applications. Horizon Bioscience, Norfolk, United Kingdom.
5 - Cartman, S. T., R. M. La Ragione, and M. J. Woodward. 2007. Bacterial spore formers as probiotics for poultry. Food Sci. Tech. Bull. 4:21-30.[CrossRef]
6 - Casula, G., and S. M. Cutting. 2002. Bacillus probiotics: spore germination in the gastrointestinal tract. Appl. Environ. Microbiol. 68:2344-2352.[Abstract/Free Full Text]
7 - Coates, M. E., R. Fuller, G. F. Harrison, M. Lev, and S. F. Suffolk. 1963. A comparison of the growth of chicks in the Gustafsson germ-free apparatus and in a conventional environment, with and without dietary supplements of penicillin. Br. J. Nutr. 17:141-150.[CrossRef][Medline]
8 - Duc le, H., H. A. Hong, T. M. Barbosa, A. O. Henriques, and S. M. Cutting. 2004. Characterization of Bacillus probiotics available for human use. Appl. Environ. Microbiol. 70:2161-2171.[Abstract/Free Full Text]
9 - Duc le, H., H. A. Hong, N. Q. Uyen, and S. M. Cutting. 2004. Intracellular fate and immunogenicity of B. subtilis spores. Vaccine 22:1873-1885.[CrossRef][Medline]
10 - FAO/WHO. 2002. Guidelines for the evaluation of probiotics in food. Report of a joint Food and Agriculture Organization (FAO)/World Health Organization (WHO) working group on drafting guidelines for the evaluation of probiotics in food. World Health Organization. http://www.who.int/foodsafety/fs_management/en/probiotic_guidelines.pdf.
11 - Forbes, M., and J. T. Park. 1959. Growth of germ-free and conventional chicks: effect of diet, dietary penicillin and bacterial environment. J. Nutr. 67:69-84.[Abstract/Free Full Text]
12 - Foster, S. J., and K. Johnstone. 1990. Pulling the trigger: the mechanism of bacterial spore germination. Mol. Microbiol. 4:137-141.[CrossRef][Medline]
13 - Hisanga, S. 1980. Studies on the germination of genus Bacillus spores in rabbit and canine intestines. J. Nagoya City Med. Assoc. 30:456-469.
14 - Hoa, N. T., L. Baccigalupi, A. Huxham, A. Smertenko, P. H. Van, S. Ammendola, E. Ricca, and A. S. Cutting. 2000. Characterization of Bacillus species used for oral bacteriotherapy and bacterioprophylaxis of gastrointestinal disorders. Appl. Environ. Microbiol. 66:5241-5247.[Abstract/Free Full Text]
15 - Hoa, T. T., L. H. Duc, R. Isticato, L. Baccigalupi, E. Ricca, P. H. Van, and S. M. Cutting. 2001. Fate and dissemination of Bacillus subtilis spores in a murine model. Appl. Environ. Microbiol. 67:3819-3823.[Abstract/Free Full Text]
16 - Hong, H. A., H. Duc le, and S. M. Cutting. 2005. The use of bacterial spore formers as probiotics. FEMS Microbiol. Rev. 29:813-835.[CrossRef][Medline]
17 - Leser, T. D., A. Knarreborg, and J. Worm. 2007. Germination and outgrowth of Bacillus subtilis and Bacillus licheniformis spores in the gastrointestinal tract of pigs. J. Appl. Microbiol. 104:1025-1033.
18 - McCartney, E. 2004. EU regulations on bacillary probiotics for animal feeds, p. 221-227. In E. Ricca, A. O. Henriques, and S. M. Cutting (ed.), Bacterial spore formers: probiotics and emerging applications. Horizon Bioscience, Norfolk, United Kingdom.
19 - Moir, A., B. M. Corfe, and J. Behravan. 2002. Spore germination. Cell. Mol. Life Sci. 59:403-409.[CrossRef][Medline]
20 - Nakano, M. M., Y. P. Dailly, P. Zuber, and D. P. Clark. 1997. Characterization of anaerobic fermentative growth of Bacillus subtilis: identification of fermentation end products and genes required for growth. J. Bacteriol. 179:6749-6755.[Abstract/Free Full Text]
21 - Nakano, M. M., and P. Zuber. 1998. Anaerobic growth of a "strict aerobe" (Bacillus subtilis). Annu. Rev. Microbiol. 52:165-190.[CrossRef][Medline]
22 - Nicholson, W. L., and P. Setlow. 1990. Sporulation, germination and outgrowth, p. 391-450. In S. M. Cutting and C. R. Harwood (ed.), Molecular biological methods for Bacillus. John Wiley & Sons Ltd., Chichester, United Kingdom.
23 - Setlow, P. 2003. Spore germination. Curr. Opin. Microbiol. 6:550-556.[CrossRef][Medline]
24 - SSC for the European Commission, Health and Consumer Protection Directorate-General. 1999. Opinion of the Scientific Steering Committee on antimicrobial resistance. http://ec.europa.eu/food/fs/sc/ssc/out50_en.pdf.
25 - Tam, N. K., N. Q. Uyen, H. A. Hong, H. Duc le, T. T. Hoa, C. R. Serra, A. O. Henriques, and S. M. Cutting. 2006. The intestinal life cycle of Bacillus subtilis and close relatives. J. Bacteriol. 188:2692-2700.[Abstract/Free Full Text]
26 - Youngman, P., J. B. Perkins, and R. Losick. 1984. Construction of a cloning site near one end of Tn917 into which foreign DNA may be inserted without affecting transposition in Bacillus subtilis or expression of the transposon-borne erm gene. Plasmid 12:1-9.[CrossRef][Medline]
Applied and Environmental Microbiology, August 2008, p. 5254-5258, Vol. 74, No. 16
0099-2240/08/$08.00+0 doi:10.1128/AEM.00580-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Sanchez, B., Arias, S., Chaignepain, S., Denayrolles, M., Schmitter, J. M., Bressollier, P., Urdaci, M. C.
(2009). Identification of surface proteins involved in the adhesion of a probiotic Bacillus cereus strain to mucin and fibronectin. Microbiology
155: 1708-1716
[Abstract]
[Full Text]
-
Flint, J. F., Garner, M. R.
(2009). Feeding beneficial bacteria: A natural solution for increasing efficiency and decreasing pathogens in animal agriculture. J. Appl. Poult. Res.
18: 367-378
[Abstract]
[Full Text]