Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Sassera, D. Articles by Bandi, C. Search for Related Content PubMed PubMed Citation Articles by Sassera, D. Articles by Bandi, C. Agricola Articles by Sassera, D. Articles by Bandi, C.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, October 2008, p. 6138-6140, Vol. 74, No. 19
0099-2240/08/$08.00+0     doi:10.1128/AEM.00248-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

"Candidatus Midichloria" Endosymbionts Bloom after the Blood Meal of the Host, the Hard Tick Ixodes ricinus

Davide Sassera,¹ Nathan Lo,^2* Edwin A. P. Bouman,³ Sara Epis,¹ Michele Mortarino,¹ and Claudio Bandi¹

Dipartimento di Patologia Animale, Igiene e Sanità Pubblica Veterinaria, Università degli Studi di Milano, Milan, Italy,¹ The Australian Museum, 6 College St., Sydney, New South Wales 2010, Australia,² Biology Centre, Institute of Parasitology, Academy of Sciences of the Czech Republic, Branisovska 31, 370 05 Ceske Budejovice, Czech Republic³

Received 28 January 2008/ Accepted 4 August 2008

Top ABSTRACT INTRODUCTION REFERENCES

 
"Candidatus Midichloria mitochondrii," an intracellular symbiont of the tick Ixodes ricinus, is the only described organism able to invade the mitochondria of any multicellular organism. We used quantitative PCR to examine cycles of bacterial growth and death throughout the host's development and found that they correspond with the phases of engorgement and molt, respectively.

Top ABSTRACT INTRODUCTION REFERENCES

 
The European hard tick Ixodes ricinus is a vector of numerous pathogenic microorganisms (11). While these pathogens have been extensively studied, less attention has been given to the tick's symbionts, which may have an important effect on host biology. "Candidatus Midichloria mitochondrii" is an intracellular alphaproteobacterial symbiont that inhabits the germ line cells of its female host (3, 5, 13, 16). It has the unique ability to invade and destroy mitochondria within ovarian cells (12). "Ca. Midichloria mitochondrii" has been detected in 100% of the examined I. ricinus females across its geographical distribution and in 44% of males (9). The basis of the symbiosis is not well understood. I. ricinus tick lines raised in the laboratory apparently lose the symbiont but continue to survive and reproduce (9). Thus, the symbiosis does not appear to be obligatory. We used real-time quantitative PCR (qPCR) to examine the population dynamics of the symbiont during the host's life cycle, which involves a blood meal at each of the larval, nymph, and adult stages. qPCR has successfully been used to obtain insights into the basis of a number of other intracellular symbiont-host interactions (1, 10, 15).

Adult ticks were collected in the woods surrounding Ceske Budejovice (Czech Republic). All males and some of the females were preserved in 100% ethanol, while the other females were fed on guinea pigs. Starting with these females, an entire life cycle was completed. DNA was extracted from ethanol-preserved ticks as described previously (3). Sybr green real-time qPCR protocols were designed for the following: (i) the gyrB gene of "Ca. Midichloria mitochondrii" (primers CTTGAGAGCAGAACCACCTA [forward] and CAAGCTCTGCCGAAATATCTT [reverse]; amplifying 125 bp); (ii) the I. ricinus nuclear gene cal (primers ATCTCCAATTTCGGTCCGGT and TGAAAGTTCCCTGCTCGCTT; amplifying 109 bp); and (iii) the I. ricinus mitochondrial gene COII (primers CCGACTTCTTGACGTAGACAAC and CTGATTAAGGCGACCAGGAACG; amplifying 144 bp). PCR cycling for gyrB and cal was as follows: 95°C for 2 min, 40 cycles at 95°C for 15 s and at 60°C for 30 s, and melt curve from 55°C to 95°C with increasing increments of 0.5°C per cycle. The cycling for COII differed only in the annealing temperature, set at 58°C. All reactions were performed in 25 µl of Milli-Q water containing 400 nM of each primer, 12.5 µl of iQ Sybr green supermix, and 1 µl of DNA. PCR products were sequenced to confirm PCR specificity and then ligated into the pGEM-T Easy vector and cloned. Purified plasmids containing the desired fragments were serially diluted to evaluate the efficiency and detection limit of each PCR protocol (10 copies in each case). PCRs were then performed on each tick DNA sample in triplicate. PCR efficiency was assessed by serial dilution of samples from each life stage subset. Using the software SPSS version 14.0, the nonparametric Kruskal-Wallis H test and the Mann-Whitney U test were used to compare genome copy numbers for each life stage; P values of 0.05 were considered to be significant. A total of 156 I. ricinus samples from 12 different life stages were examined. Threshold cycle values were found to be highly reproducible for all three protocols, with mean intra- and interassay coefficients of variation always less than 2% and 5%, respectively.

Estimates of the total number of symbiont, nuclear, and mitochondrial genome copies were obtained via a comparison of the qPCR results of each tick life stage with those of serial dilutions of cloned fragments (containing known copy numbers). Although we did not determine how many genome copies each "Ca. Midichloria mitochondrii" cell contains, other members of the Rickettsiales are known to have a single genome per cell (10) and a single copy of the gyrB gene (2). Thus, the gyrB copy number can be assumed to be approximately equivalent to bacterial numbers or at least directly correlated with them. Since mitochondria can contain a variable number of genome copies (3a), we can consider the COII gene copy number as an approximation of the number of mitochondria present in tick samples.

Life stages and qPCR results for each gene are shown in Table 1. The copy numbers of both cal and COII rise during the development of the tick from egg to adult, with notable increases following each molt and constant numbers during each stage. In adult females, 5 days after detachment, there is a drop in the copy number of cal. This is likely a result of extensive apoptosis in the salivary glands and other tissues (6, 7). Adult females have significantly higher COII copy numbers than males, presumably due to the energy requirements of oogenesis. The gyrB copy number is relatively high in eggs and drops markedly in newly hatched larvae. High concentration in the eggs is typical for vertically inherited symbionts (4) and may reflect competition among symbionts for transmission to progeny (14). The drop in the copy number of gyrB from the egg stage to the larval stage is presumably due to bacteria being excluded from most tissues of the embryo during development. The gyrB copy number then increases following engorgement of larvae. Following molting to the nymph stage, the gyrB copy number drops again but increases again following engorgement of nymphs. Following the molt to the adult female, the gyrB copy number increases. This is probably due to the fact that the ovaries, the primary niche of the symbiont, are fully developed in adults. The gyrB copy number continues to increase in females during engorgement and egg deposition.

View this table: [in this window] [in a new window]

TABLE 1. Median values and ranges of gyrB, cal, and COII copy numbers and of gyrB/cal and COII/cal ratiosa

We were not able to determine the sex of larvae and nymphs. The available evidence indicates that the symbiont does not cause sex ratio distortion (i.e., via male-killing, parthenogenesis, or feminization) (8). Based on the relatively low variance of the gyrB copy number in larvae, it appears that the symbiont is transferred to both male and female larvae. However, the higher variance in nymphs, combined with the large difference in the gyrB copy numbers between adult females and males, suggests a specialization toward females during the nymph stage. Nine of 15 adult males were found positive for the symbiont, but these had the lowest gyrB copy numbers of all life stages examined.

The gyrB/cal and COII/cal ratios are shown in Fig. 1. The gyrB/cal ratio was highest in day-old eggs and follows a similar pattern to the gyrB copy number (Table 1). One exception is the large jump in females 5 days postdetachment, which is due to the large drop in the cal copy number at this stage (see above). The COII/cal ratio is highest (10⁴) in day-old eggs and then drops to a stable level of 10² to 10³ in other stages. The fact that both the gyrB/cal and COII/cal ratios are highest in day-old eggs is interesting, given the tendency of "Ca. Midichloria mitochondrii" to invade mitochondria. The behavior of the symbiont in eggs has not yet been examined.

View larger version (38K): [in this window] [in a new window]

FIG. 1. The gyrB/cal (A) and COII/cal (B) ratios in the various I. ricinus life stages, determined by qPCR. Abbreviations: Ed1, eggs day 1; Ed15, eggs day 15; Ld1, larvae day 1; Leng, engorged larvae; Nd1, nymphs day 1; Neng, engorged nymphs; Fne, nonengorged females; Fpe, partially engorged females; Fd5ad, engorged females 5 days after detachment; Fd10ad, females 10 days after detachment; Fadep, females after egg deposition; M, males positive for "Candidatus Midichloria mitochondrii." The boxes represent the 25th and 75th percentiles of the values, with the line inside the boxes marking the median. The whiskers indicate the 10th and 90th percentiles. Outlying points are represented by • or .

In conclusion, the increase in the gyrB copy numbers following engorgement of each of the three stages indicates that bacterial growth is linked to the blood meal. Whether this coincides with the production of metabolites by "Ca. Midichloria mitochondrii" for its host remains to be determined. The growth may also reflect competition among symbionts for transmission to the next stage of the tick, although the increase appears to occur in both female and male larvae.

 
We are grateful to Tiziana Beninati for helpful discussion.

N.L. is supported by an Australian Research Council Postdoctoral Fellowship. C.B. is supported by the Ministero della Salute and ISPESL grant RFPS-2006-4-336506.P3.

 
* Corresponding author. Mailing address: The Australian Museum, 6 College St., Sydney, NSW 2010, Australia. Phone: 61 2 9320 6346. Fax: 61 2 9320 6486. E-mail: nathan.lo{at}austmus.gov.au

Published ahead of print on 8 August 2008.

Top ABSTRACT INTRODUCTION REFERENCES

 

1
1. Anbutsu, H., and T. Fukatsu. 2003. Population dynamics of male-killing and non-male-killing spiroplasmas in Drosophila melanogaster. Appl. Environ. Microbiol. 69:1428-1434.[Abstract/Free Full Text]
2
2. Andersson, S. G., A. Zomorodipour, J. O. Andersson, T. Sicheritz-Ponten, U. C. Alsmark, R. M. Podowski, A. K. Naslund, A. S. Eriksson, H. H. Winkler, and C. G. Kurland. 1998. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396:133-140.[CrossRef][Medline]
3
3. Beninati, T., N. Lo, L. Sacchi, C. Genchi, H. Noda, and C. Bandi. 2004. A novel alpha-proteobacterium resides in the mitochondria of ovarian cells of the tick Ixodes ricinus. Appl. Environ. Microbiol. 70:2596-2602.[Abstract/Free Full Text]
3
4. Bogenhagen, D., and D. A. Clayton. 1974. The number of mitochondrial deoxyribonucleic acid genomes in mouse L and human HeLa cells. Quantitative isolation of mitochondrial deoxyribonucleic acid. J. Biol. Chem. 249:7991-7995.[Abstract/Free Full Text]
4
5. Buchner, P. 1965. Endosymbiosis of animals with plant microorganisms. Interscience, New York, NY.
5
6. Epis, S., D. Sassera, T. Beninati, N. Lo, L. Beati, J. Piesman, L. Rinaldi, K. D. McCoy, A. Torina, L. Sacchi, E. Clementi, M. Genchi, S. Magnino, and C. Bandi. 2008. Midichloria mitochondrii is widespread in hard ticks (Ixodidae) and resides in the mitochondria of phylogenetically diverse species. Parasitology 135:485-494.[Medline]
6
7. Freitas, D., R. Rosa, D. Moura, A. Seitz, E. Colodel, D. Driemeier, J. Da Silva Vaz I, Jr., and A. Masuda. 2007. Cell death during preoviposition period in Boophilus microplus tick. Vet. Parasitol. 144:321-327.[CrossRef][Medline]
7
8. L'Amoreaux, W., L. Junaid, and S. Trevidi. 2003. Morphological evidence that salivary gland degeneration in the American dog tick, Dermacentor variabilis (Say), involves programmed cell death. Tissue Cell 35:95-99.[CrossRef][Medline]
8
9. Lo, N., T. Beninati, L. Sacchi, and C. Bandi. 2006. An alpha-proteobacterium invades the mitochondria of the tick Ixodes ricinus. In K. Bourtzis and T. A. Miller (ed.), Insect symbiosis, vol. 2. Taylor & Francis, Boca Raton, FL.
9
10. Lo, N., T. Beninati, D. Sassera, E. A. P. Bouman, S. Santagati, L. Gern, V. Sambri, T. Masuzawa, J. Gray, T. G. T. Jaenson, A. Bouattour, I. Bitam, M. J. Kenny, E. S. Guner, I. G. Kharitonenkov, and C. Bandi. 2006. Widespread distribution and high prevalence of an alpha-proteobacterial symbiont in the tick Ixodes ricinus. Environ. Microbiol. 8:1280-1287.[CrossRef][Medline]
10
11. McGarry, H. F., G. L. Egerton, and M. J. Taylor. 2004. Population dynamics of Wolbachia bacterial endosymbionts in Brugia malayi. Mol. Biochem. Parasitol. 135:57-67.[CrossRef][Medline]
11
12. Parola, P., and D. Raoult. 2001. Tick-borne bacterial diseases emerging in Europe. Clin. Microbiol. Infect. 7:80-83.[CrossRef][Medline]
12
13. Sacchi, L., E. Bigliardi, S. Corona, T. Beninati, N. Lo, and A. Franceschi. 2004. A symbiont of the tick Ixodes ricinus invades and consumes mitochondria in a mode similar to that of the parasitic bacterium Bdellovibrio bacteriovorus. Tissue Cell 36:43-53.[CrossRef][Medline]
13
14. Sassera, D., T. Beninati, C. Bandi, E. A. Bouman, L. Sacchi, M. Fabbi, and N. Lo. 2006. ‘Candidatus Midichloria mitochondrii,’ an endosymbiont of the tick Ixodes ricinus with a unique intramitochondrial lifestyle. Int. J. Syst. Evol. Microbiol. 56:2535-2540.[Abstract/Free Full Text]
14
15. Werren, J. H., and S. L. O'Neill. 1997. The evolution of heritable symbionts, p. 1-41. In S. L. O'Neill, A. A. Hoffmann, and J. H. Werren (ed.), Influential passengers. Oxford University Press, New York, NY.
15
16. Wolschin, F., B. Holldobler, R. Gross, and E. Zientz. 2004. Replication of the endosymbiotic bacterium Blochmannia floridanus is correlated with the developmental and reproductive stages of its ant host. Appl. Environ. Microbiol. 70:4096-4102.[Abstract/Free Full Text]
16
17. Zhu, Z., A. Aeschlimann, and L. Gern. 1992. Rickettsia-like microorganisms in the ovarian primordia of molting Ixodes ricinus (acari: Ixodidae) larvae and nymphs. Ann. Parasitol. Hum. Comp. 67:99-110.

---

Applied and Environmental Microbiology, October 2008, p. 6138-6140, Vol. 74, No. 19
0099-2240/08/$08.00+0     doi:10.1128/AEM.00248-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Sassera, D. Articles by Bandi, C. Search for Related Content PubMed PubMed Citation Articles by Sassera, D. Articles by Bandi, C. Agricola Articles by Sassera, D. Articles by Bandi, C.