Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Balk, M. Articles by Stams, A. J. M. Search for Related Content PubMed PubMed Citation Articles by Balk, M. Articles by Stams, A. J. M. Agricola Articles by Balk, M. Articles by Stams, A. J. M.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, January 2008, p. 403-409, Vol. 74, No. 2
0099-2240/08/$08.00+0     doi:10.1128/AEM.01743-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

(Per)chlorate Reduction by the Thermophilic Bacterium Moorella perchloratireducens sp. nov., Isolated from Underground Gas Storage

Melike Balk, Ton van Gelder, Sander A. Weelink, and Alfons J. M. Stams^*

Laboratory of Microbiology, Wageningen University, Dreijenplein 10, 6703 HB Wageningen, The Netherlands

Received 27 July 2007/ Accepted 11 October 2007

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
A thermophilic bacterium, strain An10, was isolated from underground gas storage with methanol as a substrate and perchlorate as an electron acceptor. Cells were gram-positive straight rods, 0.4 to 0.6 µm in diameter and 2 to 8 µm in length, growing as single cells or in pairs. Spores were terminal with a bulged sporangium. The temperature range for growth was 40 to 70°C, with an optimum at 55 to 60°C. The pH optimum was around 7. The salinity range for growth was between 0 and 40 g NaCl liter^–1 with an optimum at 10 g liter^–1. Strain An10 was able to grow on CO, methanol, pyruvate, glucose, fructose, cellobiose, mannose, xylose, and pectin. The isolate was able to respire with (per)chlorate, nitrate, thiosulfate, neutralized Fe(III) complexes, and anthraquinone-2,6-disulfonate. The G+C content of the DNA was 57.6 mol%. On the basis of 16S rRNA analysis, strain An10 was most closely related to Moorella thermoacetica and Moorella thermoautotrophica. The bacterium reduced perchlorate and chlorate completely to chloride. Key enzymes, perchlorate reductase and chlorite dismutase, were detected in cell extracts. Strain An10 is the first thermophilic and gram-positive bacterium with the ability to use (per)chlorate as a terminal electron acceptor.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Perchlorate (ClO₄^–) contamination in soil and groundwater has been recognized; it has been detected in drinking water reservoirs (20, 33, 41), in agricultural crops (20), and even in milk (23). Its increasingly widespread occurrence poses a health risk. It is known to affect the function of the thyroid gland in mammals, and its toxicity can cause the inhibition of thyroid hormone output (39). Perchlorate salts are used in the manufacture of propellants, explosives, and pyrotechnic devices by the chemical, aerospace, and defense industries (33, 41).

Perchlorate is chemically very stable and has low reactivity even in highly reducing environments (26). Inorganic perchlorate salts are generally extremely soluble. The high water solubility and poor adsorption of perchlorate to soil and organic carbon make perchlorate highly mobile in the environment (27).

Evidence for bacterial degradation of perchlorate was obtained from early studies (2, 17, 32). Since then, major advances have been made in our understanding of the microbiology, biochemistry, and genetics of the microorganisms that are capable of reductively transforming perchlorate, sequentially via chlorate (ClO₃^–) and chlorite (ClO₂^–), into chloride (Cl^–) and O₂ (24, 34). Many mesophilic perchlorate-reducing mixed and pure cultures have been described, and so far all of the isolates obtained are members of the Proteobacteria, with the majority of the isolates belonging to the Betaproteobacteria subclass (7, 10, 19, 27, 44, 46-48). However, so far perchlorate utilization has not been reported at higher temperatures. This report represents the first description of a thermophilic, gram-positive (per)chlorate-respiring bacterium. The isolation and characterization of strain An10 from underground gas storage in Russia are described.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Source of inoculum.
The sample was obtained from the produced water from underground gas storage in Russia. The dry weight of the sample was about 700 mg liter^–1. It contained the following minerals: Fe²⁺, 140 mg liter^–1; NH₄⁺, 2.8 mg liter^–1; K⁺, 2.6 mg liter^–1; Na⁺, 18 mg liter^–1; Mg²⁺, 4.4 mg liter^–1; Ca²⁺, 27 mg liter^–1; NO₃^–, <1 mg liter^–1; SO₄^2–, 3.6 mg liter^–1; and Cl^–, 57 mg liter^–1. The pH of the sample was 6.8. Although the initial temperature in the sampling place was around 60 to 65°C, after the injection of the cold gas (20 to 23°C) the temperature became around 37°C (A. Ivanova, personal communication). The enrichment culture was cultivated in a bicarbonate-buffered medium containing methanol and perchlorate at 55°C. The culture was repeatedly transferred to fresh medium when methanol and perchlorate were consumed.

Culture medium.
The culture medium used for enrichment, isolation, and maintenance of strain An10 was prepared based on the medium described previously (38). Unless stated otherwise, all cultivations were carried out at 55°C.

The cultures were routinely grown in 117-ml serum vials with butyl rubber stoppers and aluminum crimp seals. The vials contained 50 ml basal medium and a gas phase of 1.7 bar N₂-CO₂ (80%/20% [vol/vol]). Concentrated stock solutions of substrates were prepared anoxically, sterilized by filtration, and added to the medium to final concentrations of 5 to 20 mM. For pectin, a weighted quantity of pectin was autoclaved separately in serum vials and after autoclaving the sterile bicarbonate-buffered medium was added to reach a final pectin concentration of 0.5% (wt/vol). The pH of the medium was 7. By varying the CO₂ concentration in the headspace and adding a few drops of 0.1 N HCl or NaOH per vial, the pH of the medium could be adjusted within the range of 5.5 to 8.5. To test the optimum NaCl range for growth, NaCl was omitted from the medium and added at certain concentrations from 0 to 50 g liter^–1. In all growth experiments in liquid medium, the inoculum size was 1% (vol/vol).

To test the tolerance of strain An10 towards oxygen, the isolate was cultivated in the bicarbonate-buffered medium without reducing agent. Fructose (10 mM) was added as substrate. As soon as the medium was inoculated, sterile O₂ was injected by syringe to a final concentration up to 10% (vol/vol). The detection limit was 1 µM O₂.

Enrichment and isolation of strain An10.
Serial dilutions of the sample from underground gas storage were prepared in liquid medium containing 20 mM of methanol and 10 mM of perchlorate. The highest dilution showing growth at 55°C was used for further study. The culture was diluted in agar media (1.8% [wt/vol] agar noble) in the serum vials. Colonies from the highest dilution were picked and diluted again in liquid medium. This procedure was repeated twice. Purity of the isolate, designated An10, was confirmed by incubations at 30 and 65°C under anoxic and oxic conditions in medium containing 10 g liter^–1 yeast extract (BBL-Becton Dickinson) or in Wilkins-Chalgren broth (Oxoid).

Cell morphology and purity were examined with a phase-contrast microscope. Gram staining was carried out according to the standard procedure (15).

Substrate utilization tests.
The ability of strain An10 to metabolize substrates was tested in the bicarbonate-buffered medium. Substrates were added from sterile, anoxic concentrated stock solutions to final concentrations of 20 mM, unless otherwise indicated. To test the use of potential electron acceptors, sodium perchlorate (10 mM), sodium chlorate (10 mM), sodium sulfate (20 mM), sodium thiosulfate (20 mM), sodium sulfite (5 mM), FeCl₃ (10 mM), Fe(III)-nitrilotriacetic acid (10 mM), Fe(III)-citrate (10 mM), anthraquinone-2,6-disulfonic acid (AQDS; 20 mM), and sodium nitrate (10 mM) were added to the medium at the indicated concentrations.

16S RNA sequence analysis and G+C content of DNA.
For the phylogenetic characterization of strain An10, chromosomal DNA was isolated from a liquid culture as described previously (42). The 16S rRNA gene was selectively amplified by PCR, using oligonucleotide primers complementary to conserved regions of the eubacterial 16S rRNA genes. The following primer pair was used: 5' ACCTAATACGACTACTATAGGGAGAGTTTGATCCTGGCTCAG 3' (positions 8 to 27, Escherichia coli numbering) and 5' ATTGTAAAACGACGGCCAGTGGTTACCTTGTTACGACTT 3' (positions 1492 to 1510, E. coli numbering). The PCR amplification products were sequenced with an amplified Biosystems model 373A DNA sequencer by using the Taq DyeDeoxy terminator cycle sequencing method and custom primers based on conserved regions. The sequences were checked for reading errors with the alignment programs of the ARB package (28), and homology searches of the ARB, EMBL, and GenBank DNA databases for these partial sequences were done with FASTA.

The G+C content of the DNA was determined by using standard high-performance liquid chromatography (HPLC) analysis (31) at the DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany). Genomic DNA was isolated according to the procedure that was described previously (8, 29).

Analytical methods.
Most substrates were measured by HPLC as previously described (38). Gases and alcohols were measured by gas chromatography (3, 18). Perchlorate, chlorate, chloride, thiosulfate, nitrate, and sulfate were analyzed by an HPLC system equipped with an Ionpac AS9-SC column and an ED 40 electrochemical detector (Dionex, Sunnyvale, CA) (35). Perchlorate (retention time was 24 min) showed a very broad peak in the chromatogram. Therefore, it was used semiquantitatively. Perchlorate consumption was quantified based on the increase in chloride formation. Chloride and chlorate (retention times of 2.2 min and 4.5 min, respectively) measurements by HPLC were very accurate. Sulfide was analyzed by the method of Trüper and Schlegel (40). The protein content of the cell extracts was determined according to the method of Bradford (6), with bovine serum albumin as a standard.

Growth was measured as the optical density at 600 nm (OD₆₀₀). Uninoculated medium served as a reference. The results are representative of replicate experiments.

Preparation of cell extracts.
Cell extracts used for enzyme assays were obtained from cells grown in the medium supplemented with 10 mM of fructose and 10 mM of perchlorate. The preparation of cell extracts were performed under anoxic conditions in an anaerobic glove box. Cells were collected by centrifugation at 10,000 rpm for 10 min at 4°C. The cell pellet was suspended (1:2 [wt/vol]) in 15 mM potassium/sodium phosphate buffer, pH 7.2. The cells were disrupted by ultrasonic disintegration (Sonics & Materials, Inc., Danbury, CT) at 40 kc/s for 30 s followed by cooling for 30 s on ice. The cycle was repeated 4 times. Cell debris and whole cells were removed by centrifugation at 13,000 rpm for 10 min at 4°C. The supernatant was used for enzyme assays.

Enzyme assays.
Perchlorate, chlorate, and nitrate reductase levels were measured in anoxic stoppered quartz cuvettes, by monitoring the oxidation of reduced methyl viologen at 578 nm between 50 and 75°C (22). Chlorite dismutase activity was determined by measuring the production of oxygen with a Clark-type oxygen electrode (43).

Nucleotide sequence accession number.
The 16S rRNA gene sequence of strain An10 has been deposited in the GenBank database under accession no. EF060194. The organism whose EMBL database accession numbers are most closely related to strain An10 is Moorella thermoacetica (ATCC 39073).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Isolation and morphological characterization.
An enrichment culture that grew at 55°C in a perchlorate-containing bicarbonate-buffered medium with methanol as the growth substrate was obtained from underground gas storage in Russia. The culture formed mainly acetate and chloride as products, but no methane was formed. A pure culture of perchlorate-reducing bacterium was obtained by the agar and liquid dilution methods and designated strain An10. Strain An10 is a rod-shaped, spore-forming bacterium (Fig. 1). When grown on pyruvate, lactate, or sugars, cells are 0.4 to 0.6 µm in diameter and 2 to 4 µm in length, and when grown on methanol, the cells are 0.4 to 0.6 µm in diameter and 6 to 8 µm in length. Spores are located terminally and have a bulged sporangium. Cells stained gram positive.

View larger version (83K): [in this window] [in a new window]

FIG. 1. Phase-contrast micrograph of sporulating cells of strain An10 during growth on methanol and perchlorate. Bar, 5 µm.

16S rRNA analysis and G+C content.
A phylogenetic analysis of the almost full-length 16S rRNA sequence (1,401 bases) revealed that strain An10 is a member of the Bacillus-Clostridium subphylum of the gram-positive (eu)bacteria and is closely related to Moorella thermoacetica (formerly known as Clostridium thermoaceticum [12]) and Moorella thermoautotrophica (formerly Clostridium thermoautotrophicum [12]) (97% sequence similarity) (Fig. 2).

View larger version (20K): [in this window] [in a new window]

FIG. 2. Dendrogram showing the position of strain An10 among the members of the genus Moorella. Phylogenetic analysis based on 16S rRNA gene sequences available from GenBank databases (accession numbers are shown). The neighbor-joining tree was reconstructed from distance matrices; Caldicellulosiruptor saccharolyticus AF 130258 served as an outgroup. Bar, evolutionary distance of 0.10.

The DNA base composition (G+C) of strain An10 was 57.6 mol%.

Growth and substrate utilization.
Strain An10 grew at temperatures ranging from 40 to 70°C; optimum growth occurred at 55 to 60°C. The optimum pH was around 7. The salinity range for growth was 0 to 30 g NaCl liter^–1, with an optimum at 10 g liter^–1. Strain An10 was able to grow on CO, methanol, pyruvate, glucose, fructose, cellobiose, mannose, xylose, and pectin. In the presence of (per)chlorate, thiosulfate, or nitrate, formate also supported growth. The following substrates were tested but not utilized for growth in the absence or presence of perchlorate: H₂/CO₂, acetate, ethanol, lactate, glycerol, propionate, fumarate, succinate, benzoate, oxalate, glycolate, thioglycolate, acetone, n-propanol, butanol, and yeast extract. When the isolate was grown with (per)chlorate, the organic substrates were mainly converted to CO₂, while only small amounts of acetate were formed. In the absence of (per)chlorate, the products were mainly acetate and CO₂. During pectin degradation (only tested in the absence of perchlorate), methanol was produced as an intermediate. The bacterium reduced perchlorate to chloride. The isolate was also able to respire with thiosulfate, neutralized Fe(III) complexes, AQDS, and nitrate but not with fumarate and sulfate.

During growth with perchlorate, the medium became pink due to the presence of resazurin, and when all the (per)chlorate was consumed, the pink color disappeared again.

Formate and methanol utilization by strain An10.
Strain An10 was not able to utilize formate in the absence of an electron acceptor. However, reduction of 7.7 mM of perchlorate resulted in the oxidation of 38 mM formate and the formation of 0.8 mM of acetate and 7.7 mM chloride (Fig. 3). Reduction of 8.3 mM of perchlorate resulted in the oxidation of 20 mM methanol and the formation of 8.3 mM chloride (Fig. 4).

View larger version (14K): [in this window] [in a new window]

FIG. 3. Growth and formate utilization by strain An10 in the presence of perchlorate. The data are the means of three independent experiments, and the bars indicate the standard deviations. The concentration of chloride was corrected with the chloride concentration in the medium, which was around 12 mM. Bacterial growth was determined by measuring turbidity (OD600). Curves are labeled as follows: formate, ; perchlorate, •; chloride, ; acetate, ; OD, .

View larger version (20K): [in this window] [in a new window]

FIG. 4. Growth and methanol utilization by strain An10 in the absence of perchlorate (A) and in the presence of perchlorate (B). The data are the means of three independent experiments, and the bars indicate the standard deviations. The concentration of chloride was corrected with the chloride concentration in the medium, which was around 12 mM. Bacterial growth was determined by measuring turbidity (OD600). Curves are labeled as follows: methanol, ; perchlorate, •; chloride, ; acetate, ; OD, .

Chlorite, the potential intermediate in chlorate reduction, was not detected in the culture medium.

Perchlorate reduction by other members of the genus Moorella.
The ability of Moorella species, M. thermoacetica (= DSM 521^T), M. thermoautotrophica (= DSM 1974^T), M. mulderi (= DSM 14980^T), and M. glycerini (= DSM 11254^T), to reduce perchlorate was tested on fructose. Fructose is utilized by all of the type strains of the genus Moorella. Besides strain An10, M. glycerini and M. mulderi were also able to reduce perchlorate to chloride (Table 1). Although OD measurements for strain An10 and M. mulderi during fructose utilization in the presence of perchlorate were higher, there was no difference in OD values in the culture media with and without perchlorate for M. glycerini. Even after several transfers on perchlorate, M. thermoautotrophica did not reduce perchlorate. Transferring and adapting M. thermoacetica several times to the medium containing perchlorate and fructose did not result in a substantial reduction of perchlorate to chloride.

View this table: [in this window] [in a new window]

TABLE 1. Effect of perchlorate on growth and product profiles of Moorella species cultivated in bicarbonate-buffered medium with and without perchloratea

Enzyme measurements.
The pathway for (per)chlorate reduction has been proposed (43) to be as follows: ClO₄^– ClO₃^– ClO₂^– Cl^– + O₂. We could demonstrate that strain An10 is capable of conversion of the harmful chlorite into chloride and oxygen by using a chlorite dismutase (Table 2). The complete reduction pathway also involves (per)chlorate reductase. (Per)chlorate reductase activity could be demonstrated by using reduced methyl viologen as the artificial electron donor (Table 2). The activity was proportional to the amount of extract added (up to 0.75 mg of protein). The same ratio was observed in cell extracts that were derived from either ClO₃^–- or ClO₄^–-grown cells, suggesting that a single enzyme is responsible for both activities (results not shown).

View this table: [in this window] [in a new window]

TABLE 2. Enzymes in cell extracts of strain An10 grown on fructose and perchlorate at different temperatures

Effect of oxygen on the growth of strain An10.
Strain An10 grew in nonreduced medium containing fructose (5 mM) and small amounts of oxygen (up to 1% [vol/vol]) in the gas phase (Table 3). After fructose utilization, no oxygen was detected in the culture medium containing up to 1% (vol/vol) oxygen. No significant metabolic differences for the utilization of fructose were found between the culture media containing no oxygen and 0.5% oxygen (vol/vol) for strain An10. However, increasing amounts of oxygen caused an increase in the lag phase of growth and a decrease in the final OD. The growth became less reproducible once the concentration of oxygen became at least partially inhibitory. Strain An10 did not grow in nonreduced medium when oxygen in the gas phase exceeded 3% (vol/vol).

View this table: [in this window] [in a new window]

TABLE 3. Effect of oxygen on growth of strain An10 cultivated in bicarbonate-buffered mediuma

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
A thermophilic isolate capable of reducing perchlorate to chloride was obtained from underground gas storage in Russia. This is the first reported thermophilic perchlorate-degrading bacterium. Phylogenetic analysis and physiological characteristics show that strain An10 is a new species of the genus Moorella. The closest relatives of strain An10 are Moorella thermoacetica and M. thermoautotrophica based on 16S rRNA sequence analysis (97% sequence similarity to both). In general, the members of the genus Moorella can utilize a wide variety of electron donors and acceptors. DNA base composition (G+C) of strain An10 was 57.6 mol%, which is in the higher range for Moorella species (3, 9, 37, 45). Strain An10 is able to grow heterotrophically but not autotrophically, as was previously described for the two closely related Moorella species (13, 45). Other differences are as shown in Table 4.

View this table: [in this window] [in a new window]

TABLE 4. Characteristics of strain An10 and related representatives of the genus Moorella

Phylogenetic analysis of 16S rRNA gene sequences revealed that strain An10 represents a new lineage within the genus Moorella. Strain An10 was also distinguished from related species based on differences in several phenotypic characteristics. It is a member of the family Thermoanaerobacteriaceae. To our knowledge, strain An10 is also the first isolate that is able to reduce perchlorate in the phylum Firmicutes. More than 50 dissimilatory (per)chlorate-reducing bacteria are now in pure culture and this number continues to increase. The bacteria described to date belonged mostly to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, and Epsilonproteobacteria subclasses of the Proteobacteria, but the majority are in the Betaproteobacteria subclass and are members of the genus Dechloromonas or Dechlorosoma (1, 10). The isolation of strain An10 suggests that many other thermophilic and mesophilic bacteria might be capable of perchlorate reduction than have been considered up to now.

(Per)chlorate-reducing bacteria have been isolated from a broad variety of environments, including contaminated soils and sediments (7, 11, 30, 34, 44). Isolation of the thermophilic strain An10 from an underground gas storage was unexpected due to the assumed limited natural abundance of (per)chlorate. Although we do not know the history of the sampling place for the perchlorate contamination, the diverse metabolic capabilities of perchlorate-reducing bacteria may explain their presence in environments where perchlorate is not found. We also found that Moorella mulderi and M. glycerini are able to reduce perchlorate as an electron acceptor. To some extent, M. thermoacetica reduces perchlorate, but the concentration of perchlorate used was much lower than that for strain An10, M. mulderi, and M. glycerini and not enough to change the product profile of the strain with fructose as a substrate. M. thermoautotrophica was not able to reduce perchlorate.

Perchlorate and chlorate reductase enzymes were active at the temperatures from 50 to 75°C. There was no activity at 45°C for both of the enzymes. Strain An10 was also able to grow on nitrate, and the isolate showed nitrate reductase activity. Currently, we do not know the genes encoding (per)chlorate reduction and chloride dismutation. Although microbial nitrate reductases have activity with chlorate, it is not known whether perchlorate is a substrate as well (4, 36). Interestingly, M. glycerini and M. mulderi are not able to reduce nitrate but they do reduce perchlorate.

Perchlorate reduction leads to the formation of oxygen. Thus, the perchlorate-reducing Moorella strains should be able to respire with oxygen as well. Despite its classification as a strict anaerobe, it was shown that M. thermoacetica contains a membrane-bound cytochrome bd oxidase that can catalyze reduction of low levels of dioxygen (14). The presence of small amounts of oxygen did not alter the ratios of acetate produced to fructose consumed for strain An10, but oxygen was consumed completely. Similarly, it was previously shown that M. thermoacetica, as well as other homoacetogenic bacteria, could grow in culture medium containing oxygen and even was able to consume small amounts of oxygen (5, 21, 25). The only difference between strain An10 and M. thermoacetica was that strain An10 was able to use up to 1% (vol/vol) oxygen and able to survive with up to 3% oxygen in the culture medium, whereas M. thermoacetica could use up to 0.4% oxygen (vol/vol) and survived up to 2% oxygen (21). M. thermoacetica possesses peroxidase and NADH-oxidase activities (21). The M. thermoacetica genome also encodes the "aerobic type" of Fe/Mn superoxide dismutase and Mn catalase (http://genome.jgi-psf.org). However, Karnolz et al. (21) did not observe superoxide dismutase or catalase activities, neither at room temperature nor at 50°C, in extracts of M. thermoacetica cells.

The 16S rRNA gene sequence and physiological characteristics of strain An10 were different from those of its phylogenetic neighbors. In addition, the closest similarity (97%) of the 16S rRNA gene sequence of strain An10 to a recognized bacterium (Moorella thermoacetica) was lower than the level (98%) that is generally used to define a new species (28). Therefore, we propose that isolate An10 represents a novel species in the genus Moorella, Moorella perchloratireducens sp. nov., within the family Thermoanaerobacteriaceae.

Description of Moorella perchloratireducens sp. nov.
Moorella perchloratireducens (per.chlo.ra.ti.re.du'cens. N.L. n. perchloras -atis, perchlorate; L. part. adj. reducens, leading back, bringing back, and in chemistry converting to a lower oxidation state; N.L. part. adj. perchloratireducens, reducing perchlorate).

Cells are gram-positive straight rods, 0.4 to 0.6 µm in diameter and 2 to 8 µm in length, growing as single cells or in pairs. Spores are terminal with bulged sporangium. The temperature range for growth is between 40 and 70°C, with an optimum at 55 to 60°C. The pH optimum is around 7. The salinity range for growth is between 0 and 40 g NaCl liter^–1, with an optimum at 10 g liter^–1. Strain An10 is able to grow on CO, methanol, pyruvate, glucose, fructose, cellobiose, mannose, xylose, and pectin. Only in the presence of an electron acceptor is formate utilized as a carbon source. No growth is observed on H₂/CO₂, lactate, oxalate, thioglycolate, glycolate, glycerol, fumarate, ethanol, acetone, n-propanol, butanol, and yeast extract. The products from substrate utilization are acetate, CO₂, and H₂. The bacterium is capable of performing a complete reduction of chlorate or perchlorate to chloride and oxygen, with the intermediate formation of chlorite. The key enzymes perchlorate reductase and chlorite dismutase are detected. The isolate was also able to respire with nitrate, thiosulfate, neutralized Fe(III) complexes and AQDS, but not with fumarate and sulfate. The G+C content of the DNA is 57.6 mol%.

The type strain, An10 (= ATCC BAA-1531^T = JCM 14829^T) was isolated from an underground gas storage tank in Russia.

 
We are grateful to Hans G. Trüper and Jean P. Euzéby for their suggestions and help with nomenclature. We thank Anna Ivanova (Institute of Microbiology of the Russian Academy of Sciences in Moscow) for kindly providing the sample that was used in this study. We thank Wim van Doesburg for technical assistance with the sequencing of the strain.

This work was supported by the Darwin Center for Biogeology of the Netherlands Organization for Scientific Research (NWO).

 
* Corresponding author. Mailing address: Laboratory of Microbiology, Wageningen University, Dreijenplein 10, 6703 HB Wageningen, The Netherlands. Phone: 31 317 482105. Fax: 31 317 483829. E-mail: fons.stams{at}wur.nl

Published ahead of print on 2 November 2007.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Achenbach, L. A., U. Michaelidou, R. A. Bruce, J. Fryman, and J. D. Coates. 2001. Dechloromonas agitata gen. nov., sp. nov. and Dechlorosoma suillum gen. nov., sp. nov., two novel environmentally dominant (per)chlorate-reducing bacteria and their phylogenetic position. Int. J. Syst. Evol. Microbiol. 51:527-533.[Abstract]
2
2. Aslander, A. 1928. Experiments on the eradication of Canada Thistle, Cirsium arvense, with chlorates and other herbicides. J. Agric. Res. 36:915-928.
3
3. Balk, M., J. Weijma, M. W. Friedrich, and A. J. M. Stams. 2003. Methanol conversion by novel thermophilic homoacetogenic bacterium Moorella mulderi sp. nov. isolated from a bioreactor. Arch. Microbiol. 179:315-320.[Medline]
4
4. Bender, K. S., C. Shang, R. Chakraborty, S. M. Belchik, J. D. Coates, and L. A. Achenbach. 2005. Identification, characterization, and classification of genes encoding perchlorate reductase. J. Bacteriol. 187:5090-5096.[Abstract/Free Full Text]
5
5. Boga, H. I., and A. Brune. 2003. Hydrogen-dependent oxygen reduction by homoacetogenic bacteria isolated from termite guts. Appl. Environ. Microbiol. 69:779-786.[Abstract/Free Full Text]
6
6. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline]
7
7. Bruce, R. A., L. A. Achenbach, and J. D. Coates. 1999. Reduction of (per)chlorate by a novel organism isolated from paper mill waste. Environ. Microbiol. 1:319-329.[CrossRef][Medline]
8
8. Cashion, P., M. A. Holder-Franklin, J. McCully, and M. Franklin. 1977. A rapid method for the base ratio determination of bacterial DNA. Anal. Biochem. 81:461-466.[CrossRef][Medline]
9
9. Cato, E. P., W. L. George, and S. M. Finegold. 1986. Genus Clostridium, p. 1141-1200. In P. H. A. Sneath (ed.), Bergey's manual of systematic bacteriology, vol. 2. Williams and Wilkins, Baltimore, MD.
10
10. Coates, J. D., U. Michaelidou, R. A. Bruce, S. M. O'Connor, J. N. Crespi, and L. A. Achenbach. 1999. Ubiquity and diversity of dissimilatory (per)chlorate-reducing bacteria. Appl. Environ. Microbiol. 65:5234-5241.[Abstract/Free Full Text]
11
11. Coates, J. D., and L. A. Achenbach. 2004. Microbial perchlorate reduction: rocket-fueled metabolism. Nat. Rev. Microbiol. 2:569-580.[CrossRef][Medline]
12
12. Collins, M. D., P. A. Lawson, A. Willems, J. J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J. A. E. Farrow. 1994. The phylogeny of the genus Clostridium: proposal of five new genera and eleven new species combinations. Int. J. Syst. Bacteriol. 44:812-826.[Abstract/Free Full Text]
13
13. Daniel, S. L., T. Hsu, S. I. Dean, and H. L. Drake. 1990. Characterization of the H₂- and CO-dependent chemolithotrophic potentials of the acetogens Clostridium thermoaceticum and Acetogenium kivui. J. Bacteriol. 172:4464-4471.[Abstract/Free Full Text]
14
14. Das, A., R. Silaghi-Dumitrescu, L. G. Ljungdahl, and M. D. Kurtz. 2005. Cytochrome bd oxidase, oxidative stress, and dioxygen tolerance of the strictly anaerobic bacterium Moorella thermoacetica. J. Bacteriol. 187:2020-2029.[Abstract/Free Full Text]
15
15. Doetsch, R. N. 1981. Determinative methods of light microscopy, p. 21-33. In P. Gerhardt, R. G. E. Murray, R. N. Costilow, E. W. Nester, W. A. Wood, N. R. Krieg, and G. B. Phillips (ed.), Manual of methods for general bacteriology. American Society for Microbiology, Washington, DC.
16
16. Fontaine, F. E., W. H. Peterson, E. McCoy, M. J. Johnson, and G. J. Ritter. 1942. A new type of glucose fermentation by Clostridium thermoaceticum. J. Bacteriol. 43:701-706.[Free Full Text]
17
17. Hackenthal, E. 1965. Die Reduktion von Perchlorat durch bakterien 2. Die Identität der Nitratreduktase und des Perchlorat Reduzierenden Enzyms aus B. cereus. Biochem. Pharmacol. 14:195-206.
18
18. Henstra, A. M., and A. J. M. Stams. 2004. Novel physiological features of Carboxydothermus hydrogenoformans and Thermoterrabacterium ferrireducens. Appl. Environ. Microbiol. 70:7236-7240.[Abstract/Free Full Text]
19
19. Herman, D. C., and W. T. Frankenberger. 1999. Bacterial reduction of perchlorate and nitrate in water. J. Environ. Qual. 28:1018-1024.[Abstract/Free Full Text]
20
20. Hogue, C. 2003. Rocket-fueled river. Chem. Eng. News 81:37-46.
21
21. Karnholz, A., K. Küsel, A. Gößner, A. Schramm, and H. L. Drake. 2002. Tolerance and metabolic response of acetogenic bacteria toward oxygen. Appl. Environ. Microbiol. 68:1005-1009.[Abstract/Free Full Text]
22
22. Kengen, S. W. M., G. B. Rikken, W. R. Hagen, C. G. van Ginkel, and A. J. M. Stams. 1999. Purification and characterization of (per)chlorate reductase from the chlorate-respiring strain GR-1. J. Bacteriol. 181:6706-6711.[Abstract/Free Full Text]
23
23. Kirk, A. B., E. E. Smith, K. Tian, T. A. Anderson, and P. K. Dasgupta. 2003. Perchlorate in milk. Environ. Sci. Technol. 37:4979-4981.[Medline]
24
24. Korenkov, V., V. Romanenko, S. Kuznetsov, and J. Voronov. March 1976. Process for purification of industrial waste waters from perchlorates and chlorates. U.S. patent 3,943,055.
25
25. Küsel, K., A. Karnholz, T. Trinkwalter, R. Devereux, G. Acker, and H. L. Drake. 2001. Physiological ecology of Clostridium glycolicum RD-1, an aerotolerant acetogen isolated from sea grass roots. Appl. Environ. Microbiol. 67:4734-4741.[Abstract/Free Full Text]
26
26. Logan, B. E. 1998. A review of chlorate- and perchlorate-respiring microorganisms. Bioremediat. J. 2:69-79.[CrossRef]
27
27. Logan, B. E. 2001. Assessing the outlook for perchlorate remediation. Environ. Sci. Technol. 23:482A-487A.
28
28. Ludwig, W., O. Strunk, R. Westram, L. Richter, H. Meier, Yadhukumar, A. Buchner, T. Lai, S. Steppi, G. Jobb, W. Forster, I. Brettske, S. Gerber, A. W. Ginhart, O. Gross, S. Grumann, S. Hermann, R. Jost, A. Konig, T. Liss, R. Lussmann, M. May, B. Nonhoff, B. Reichel, R. Strehlow, A. Stamatakis, N. Stuckmann, A. Vilbig, M. Lenke, T. Ludwig, A. Bode, and K. H. Schleifer. 2004. ARB: a software environment for sequence data. Nucleic Acids Res. 32:1363-1371.[Abstract/Free Full Text]
29
29. Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol. 3:208-218.
30
30. Michaelidou, U., L. A. Achenbach, and J. D. Coates. 2000. Isolation and characterization of two novel (per)chlorate-reducing bacteria from swine waste lagoons, p. 271-283. In E. T. Urbansky (ed.), Perchlorate in the environment. Kluwer Academic/Plenum Publishers, New York, NY.
31
31. Owen, R. J., R. L. Hill, and S. P. Lapage. 1969. Determination of DNA base composition from melting profiles in dilute buffers. Biopolymers 7:503-516.[CrossRef][Medline]
32
32. Quastel, J. H., M. Stephenson, and M. D. Whetham. 1925. Some reactions of resting bacteria in relation to anaerobic growth. Biochem. J. 14:304-317.
33
33. Renner, R. 1998. Perchlorate-tainted wells spur government action. Environ. Sci. Technol. 9:210A.
34
34. Rikken, G. B., A. G. M. Kroon, and C. G. van Ginkel. 1996. Transformation of (per)chlorate into chloride by a newly isolated bacterium: reduction and dismutation. Appl. Microbiol. Biotechnol. 45:420-426.[CrossRef]
35
35. Scholten, J. C., and A. J. M. Stams. 1995. The effect of sulphate and nitrate on methane formation in a freshwater sediment. Antonie Leeuwenhoek 68:309-315.[CrossRef][Medline]
36
36. Shanmugam, K. T., V. Stewart, R. P. Gunsalus, D. H. Boxer, J. A. Cole, M. Chippaux, J. A. DeMoss, G. Giordano, E. C. C. Lin, and K. V. Rajagopalan. 1992. Proposed nomenclature for the genes involved in molybdenum metabolism in Escherichia coli and Salmonella typhimurium. Mol. Microbiol. 6:3452-3454.[CrossRef][Medline]
37
37. Slobodkin, A., A. L. Reysenbach, F. Mayer, and J. Wiegel. 1997. Isolation and characterization of the homoacetogenic thermophilic bacterium Moorella glycerini sp. nov. Int. J. Syst. Bacteriol. 47:969-974.[Abstract/Free Full Text]
38
38. Stams, A. J. M., J. B. van Dijk, C. Dijkema, and C. M. Plugge. 1993. Growth of syntrophic propionate-oxidizing bacteria with fumarate in the absence of methanogenic bacteria. Appl. Environ. Microbiol. 59:1114-1119.[Abstract/Free Full Text]
39
39. Stanbury, J. B., and J. B. Wyngaarden. 1952. Effect of perchlorate on the human thyroid gland. Metab. Clin. Exp. 1:533-539.[Medline]
40
40. Trüper, H. G., and H. G. Schlegel. 1964. Sulphur metabolism in Thiorhodaceae. I. Quantitative measurements on growing cells of Chromatium okenii. Antonie Leeuwenhoek 30:225-238.[CrossRef][Medline]
41
41. Urbansky, E. T., and M. R. Schock. 1999. Issues in managing the risks associated with perchlorate in drinking water. J. Environ. Manag. 56:79-95.[CrossRef]
42
42. van der Maarel, M. J. E. C., M. Jansen, R. Haanstra, W. G. Meijer, and T. A. Hansen. 1996. Demethylation of dimethylsulfoniopropionate to 3-S-methylmercaptopropionate by marine sulfate-reducing bacteria. Appl. Environ. Microbiol. 62:3978-3984.[Abstract]
43
43. van Ginkel, C. G., G. B. Rikken, A. G. M. Kroon, and S. W. M. Kengen. 1996. Purification and characterization of a chlorite dismutase: a novel oxygen generating enzyme. Arch. Microbiol. 166:321-326.[CrossRef][Medline]
44
44. Wallace, W., T. Ward, A. Breen, and H. Attaway. 1996. Identification of an anaerobic bacterium which reduces perchlorate and chlorate as Wolinella succinogenes. J. Ind. Microbiol. 16:68-72.[CrossRef]
45
45. Wiegel, J., M. Braun, and G. Gottschalk. 1981. Clostridium thermoautotrophicum species novum, a thermophile producing acetate from molecular hydrogen and carbon dioxide. Curr. Microbiol. 5:255-260.[CrossRef]
46
46. Wolterink, A. F., A. B. Jonker, S. W. Kengen, and A. J. Stams. 2002. Pseudomonas chloritidismutans sp. nov., a non-denitrifying, chlorate-reducing bacterium. Int. J. Syst. Evol. Microbiol. 52:2183-2190.[Abstract]
47
47. Wolterink, A. W. F. M., S. Kim, M. Muusse, I. S. Kim, P. J. Roholl, C. G. van Ginkel, A. J. M. Stams, and S. W. Kengen. 2005. Dechloromonas hortensis sp. nov. and strain ASK-1, two novel(per)chlorate-reducing bacteria, and taxonomic description of strain GR-1. Int. J. Syst. Evol. Microbiol. 55:2063-2068.[Abstract/Free Full Text]
48
48. Wu, J., R. F. Unz, H. Zhang, and B. E. Logan. 2001. Persistence of perchlorate and the relative numbers of perchlorate- and chlorate-respiring microorganisms in natural waters, soils, and wastewater. Bioremediat. J. 5:119-130.[CrossRef]

---

Applied and Environmental Microbiology, January 2008, p. 403-409, Vol. 74, No. 2
0099-2240/08/$08.00+0     doi:10.1128/AEM.01743-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Balk, M. Articles by Stams, A. J. M. Search for Related Content PubMed PubMed Citation Articles by Balk, M. Articles by Stams, A. J. M. Agricola Articles by Balk, M. Articles by Stams, A. J. M.