This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hau, H. H.
Right arrow Articles by Gralnick, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hau, H. H.
Right arrow Articles by Gralnick, J. A.
Agricola
Right arrow Articles by Hau, H. H.
Right arrow Articles by Gralnick, J. A.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, November 2008, p. 6880-6886, Vol. 74, No. 22
0099-2240/08/$08.00+0     doi:10.1128/AEM.00840-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Mechanism and Consequences of Anaerobic Respiration of Cobalt by Shewanella oneidensis Strain MR-1 {triangledown}

Heidi H. Hau,1,3 Alan Gilbert,2,3 Dan Coursolle,1,3 and Jeffrey A. Gralnick1,3*

Departments of Microbiology,1 Chemical Engineering,2 BioTechnology Institute, University of Minnesota—Twin Cities, St. Paul, Minnesota 551083

Received 11 April 2008/ Accepted 23 September 2008


arrow
ABSTRACT
 
Bacteria from the genus Shewanella are the most diverse respiratory organisms studied to date and can utilize a variety of metals and metal(loid)s as terminal electron acceptors. These bacteria can potentially be used in bioremediation applications since the redox state of metals often influences both solubility and toxicity. Understanding molecular mechanisms by which metal transformations occur and the consequences of by-products that may be toxic to the organism and thus inhibitory to the overall process is significant to future applications for bioremediation. Here, we examine the ability of Shewanella oneidensis to catalyze the reduction of chelated cobalt. We describe an unexpected ramification of [Co(III)-EDTA]– reduction by S. oneidensis: the formation of a toxic by-product. We found that [Co(II)-EDTA]2–, the product of [Co(III)-EDTA]– respiration, inhibited the growth of S. oneidensis strain MR-1 and that this toxicity was partially abolished by the addition of MgSO4. We demonstrate that [Co(III)-EDTA]– reduction by S. oneidensis requires the Mtr extracellular respiratory pathway and associated pathways required to develop functional Mtr enzymes (the c-type cytochrome maturation pathway) and ensure proper localization (type II secretion). The Mtr pathway is known to be required for a variety of substrates, including some chelated and insoluble metals and organic compounds. Understanding the full substrate range for the Mtr pathway is crucial for developing S. oneidensis strains as a tool for bioremediation.


arrow
INTRODUCTION
 
Radioactive cobalt-60 (60Co) is used for radiotherapy in hospitals and for the "cold pasteurization" of spices and other foods and is a by-product of nuclear and defense-related industries. The most mobile form of 60Co contamination stemming from leaks, spills, or decontamination operations is [60Co(III)-EDTA]– (26). In general, chelated forms of 60Co are more mobile than nonchelated forms; however, stability and mobility are directly related to the oxidation state of 60Co, and both the oxidized {[60Co(III)-EDTA]–} and reduced {[60Co(II)-EDTA]2–} forms are present in contaminated environments. The half-life of 60Co is 5.27 years; therefore, waiting for decay is one method for treating contamination, provided that the contamination is contained. Unfortunately, [Co(III)-EDTA]– is both stable and highly mobile in groundwater systems (26), increasing the difficulty of containing leaks or spills. [Co(II)-EDTA]2– can dissociate more readily than the oxidized form, allowing free cobalt ions to be sorbed onto iron oxide surfaces, thus preventing further migration and potentially facilitating removal (14). Cobalt can exist in the +3 oxidation state, but Co(III) is not thermodynamically stable and requires a ligand, such as EDTA, for persistence in aqueous environments (19); otherwise, cobalt oxide minerals will form.

Microbial redox transformations of toxic metals represent one strategy for in situ remediation of contaminated areas (47). Members of the genus Shewanella can respire a diverse repertoire of compounds in the absence of oxygen, including metals and radionuclides, and for this reason are considered to be outstanding candidates for potential applications in the bioremediation of pollutants (34, 47). Several different Shewanella species have demonstrated the ability to reduce [Co(III)-EDTA]– anaerobically (9, 14, 23, 45). Importantly, Shewanella alga BrY can reduce [60Co(III)-EDTA]– at or above concentrations found at contaminated sites without any noted deleterious effects of radiation on the bacterium (14).

One proposed strategy to facilitate remediation at [60Co(III)-EDTA]–-contaminated sites involves bacterium-mediated reduction to [60Co(II)-EDTA]2–; however, the mechanism of cobalt reduction remains undefined (14, 24). The elucidation of the main pathway for cobalt reduction is important for engineering microorganisms for specific bioremediation applications or increasing the efficiency of indigenous microbial populations. The findings from S. oneidensis strain MR-1 whole-genome DNA microarray studies suggest that similar pathways are utilized to reduce a diverse array of metal electron acceptors ranging from soluble metal complexes to insoluble metal hydr(oxy)oxides (3). The primary mechanism in S. oneidensis for the reduction of iron (Fe)- and manganese (Mn)-containing compounds is the Mtr respiratory pathway (11, 16, 43). Interestingly, the mechanisms of reduction of vanadium(V), uranium(VI), technetium(VII), and 9,10-anthraquinone-2,6-disulfonic acid appear to require the same cluster of genes that includes omcA, mtrC (omcB), mtrA, and mtrB (4, 10, 22, 25, 33, 42), although not all substrates have been tested with all mutant strains. Additional pathways required for this process are c-type cytochrome maturation (8), menaquinone biosynthesis (31), and type II secretion (13).

In this work, we demonstrate that S. oneidensis strain MR-1, one of the best-studied organisms for bioremediation applications, can couple growth to the anaerobic respiration of [Co(III)-EDTA]–. Interestingly, the toxicity of the respiration by-product [Co(II)-EDTA]2– initially masked this finding. The toxicity of [Co(II)-EDTA]2– could be overcome through the addition of MgSO4, likely serving to form a complex with free EDTA that dissociated from Co(II). Furthermore, we demonstrate that the Mtr respiratory pathway is essential for [Co(III)-EDTA]– reduction by S. oneidensis, providing a molecular mechanism for anaerobic [Co(III)-EDTA]– respiration in this bacterium.


arrow
MATERIALS AND METHODS
 
Bacterial strains, culture conditions, and growth media.
S. oneidensis strain MR-1 was originally isolated from sediments of Lake Oneida in New York (27). Strains lacking cymA, menC, dsbD, mtrB, and mtrC (omcB) were generated by random transposon mutagenesis as described previously (44) and isolated in a screen for mutants defective in amorphous iron oxy(hydr)oxide reduction (J. A. Gralnick and D. K. Newman, unpublished data).

Strains were cultured aerobically and anaerobically as described previously (15) in Luria broth (LB) or minimal medium consisting of (per liter) 0.225 g of K2HPO4, 0.225 g of KH2PO4, 0.46 g of NaCl, 0.225 g of (NH4)2SO4, 0.117 g of MgSO4-7H2O, and 100 ml of 1 M HEPES buffer adjusted to a final pH of 7.2. In addition, 5 ml/liter each of vitamins and modified trace minerals (2) from sterile filtered stock solutions was added to the minimal medium. The mineral solution was modified to include (per liter) 0.13 g of ZnCl2 (instead of ZnSO4), 0.025 g of Na2MoO4-2H2O, 0.024 g of NiCl2, and 0.025 g of Na2WO4-2H2O. Anaerobic manipulations and 96-well-plate assays were performed in an anaerobic chamber (5% H2, 20% CO2, and 75% N2 atmosphere; Coy).

[Co(III)-EDTA]– preparation.
[Co(III)-EDTA]– was prepared according to the method of Taylor and Jardine (46) by adding (per 150 ml) 20 g of Co(II)Cl2-6H2O, 2.5 g of EDTA, and 5 g of potassium acetate and heating almost to a boil. Thirty-two milliliters of 7% H2O2 was added with continuous stirring. The solution was cooled to room temperature, and 100 ml of 100% ethyl alcohol (EtOH) was added slowly with stirring. Precipitated crystals were washed twice with 100% EtOH and allowed to dry. Crystals were then dissolved in a small volume of double-distilled water (ddH2O), recrystalized in EtOH, and subjected to two additional EtOH washes. Crystals were allowed to dry on low heat until all EtOH was evaporated and were stored at 4°C. Products were examined spectrophotometrically at 535 nm for [Co(III)-EDTA]– and 490 nm for [Co(II)-EDTA]2–. A 520 mM stock solution of [Co(III)-EDTA]– in ddH2O was prepared, and stock solutions were sterilized by using a 0.22-µm-pore-size filter.

Viability staining and flow cytometry.
A FACSCalibur flow cytometer (Becton-Dickinson, San Jose, CA) was used for the determination of culture viability and cell concentrations. A 15-mW laser (Spectra-Physics, Mountain View, CA) with a wavelength of 488 nm was used for excitation. Cell concentrations were determined through the calibration of the sample volume by using standard beads of known concentrations from a kit, while the viability was assayed using the stains SYTO9 and propidium iodide from the LIVE/DEAD BacLight bacterial viability and counting kit (Invitrogen, Carlsbad, California). The green fluorescence exhibited after SYTO9 staining was measured at 530 ± 30 nm. Propidium iodide fluorescence was measured at 585 ± 42 nm, and the electronic signals were compensated to adjust for the spectral overlap (data not shown). The fluorescence properties of live cells were determined by the staining of mid-exponential-phase cells cultivated aerobically in LB. The fluorescence properties of dead cells were determined by the staining of cells treated with isopropyl alcohol and confirmed by the staining of cells that were heat killed. Samples of approximately 7 x 105 cells per ml were inoculated in triplicate under anaerobic conditions, and the cells were assayed every 24 h over 96 h for growth in lactate and [Co(III)-EDTA]–.

Co(II) ion, EDTA, and [Co(II)-EDTA]2– toxicity assays.
A 0.5 M Co(II) stock solution was prepared by adding 5.94 g of Co(II)Cl2-6H2O to 50 ml of ddH2O and filter sterilizing. A stock solution of [Co(II)-EDTA]2– was prepared by adding equal molar amounts of Co(II) and EDTA stock solutions.

Toxicity to cells on agar plates, in sealed tubes, or in the wells of 96-well plates was evaluated. MR-1 was streaked directly onto LB or minimal medium agar plates that contained lactate, fumarate, and [Co(II)-EDTA]2–. Plates were incubated at 30°C under aerobic or anaerobic conditions. The toxicity of [Co(II)-EDTA]2– was scored based on the appearance of colonies compared to that of a positive control grown without [Co(II)-EDTA]2–. The toxicity of [Co(II)-EDTA]2– to cells grown anaerobically in a mixture of lactate, fumarate, and [Co(II)-EDTA]2– was monitored. Samples were withdrawn anaerobically and then plated onto LB agar plates, which were incubated aerobically at 30°C. Anaerobic-to-aerobic transition appeared to not be a concern in these experiments, as the CFU quantified by plate counts were equivalent to population estimates by flow cytometry (data not shown). The toxicity of Co(II), EDTA, and [Co(II)-EDTA]2– to cultures grown anaerobically in 96-well plates with continuous shaking at 30°C inside an anaerobic chamber was monitored spectrophotometrically at 600 nm. Aerobically grown overnight cultures were diluted to 106 cells per ml in anoxic minimal medium and then inoculated into 96-well plates containing lactate and fumarate, with or without Co(II) ions, EDTA, [Co(II)-EDTA]2–, and 25 mM MgSO4.

Growth in the presence of [Co(III)-EDTA]–.
Anaerobic growth on agar plates and in sealed tubes with [Co(III)-EDTA]– as the sole final electron acceptor was examined. MR-1 was streaked directly onto LB or minimal medium agar plates equilibrated under anaerobic chamber conditions for at least 48 h and containing 20 mM lactate and 5 mM [Co(III)-EDTA]. Growth at 30°C was scored based on the appearance of colonies compared to that of colonies on a positive control plate. Additionally, anaerobic growth in sealed tubes of minimal medium with lactate and [Co(III)-EDTA]– was monitored. Samples were withdrawn with a sterile syringe from sealed tubes in an anaerobic chamber at experimental time points and analyzed aerobically by using flow cytometry or spread plate counts. Sample dilutions were performed with minimal medium, and dilutions were spread plated onto LB agar plates, which were incubated aerobically at 30°C. The toxicity of [Co(III)-EDTA]– was determined by streaking samples onto LB or minimal medium agar plates containing 20 mM lactate and 5 mM [Co(III)-EDTA]– under aerobic or anaerobic conditions as described above. The medium was supplemented with MgSO4 where indicated.

[Co(III)-EDTA]– reduction.
[Co(III)-EDTA]– reduction was examined under anaerobic conditions at 30°C with polystyrene 96-well plates. [Co(III)-EDTA]– reduction was evaluated by the inoculation of approximately 2 x 107 cells per ml of an aerobically grown overnight culture diluted in anoxic minimal medium into wells containing 20 mM lactate and 5 mM [Co(III)-EDTA]– in minimal medium supplemented with vitamins and minerals. [Co(III)-EDTA]– reduction under these conditions was dependent on lactate addition (data not shown). Plates were shaken continuously, and [Co(III)-EDTA]– concentrations were monitored spectrophotometrically at 535 nm (7, 46) with a SpectraMax M2 microplate reader (Molecular Devices) in an anaerobic chamber. Total cellular protein levels were determined by the bicinchoninic acid method with bovine serum albumin as a standard.

Deletion and complementation strain construction.
Deletion mutation and complementation analyses used methods described previously (17, 37). The ligation of upstream fragments (amplified with P1 and P2) and downstream fragments (amplified with P3 and P4) was facilitated by overlapping ends generated using the restriction enzyme BsaI. Primers for deletion constructs were as follows: omcA, P1SacI (NNNGAGCTCAGATAGTGTCTTAGTGGA), P2BsaI (NNNGGTCTCCATTAGTCGTATTTAATG), P3BsaI (NNNGGTCTCATAATTATCTGAATCGAG), and P4BamHI (NNNGGATCCCTTCGTGGCTAACGATAT); mtrC, P1SpeI (NNNACGAGTCAGCTGATCTAACTGGTA), P2BsaI (NNNGGTCTCTTTTTGTGCGTTCATCAT), P3BsaI (NNNGGTCTCGAAAATGTAATTTGCCCA), and P4SacI (NNNGAGCTCCATTCACACTACCGTGAG); mtrA, P1SacI (NNNGAGCTCCACAATTAGTGTTCAAGT), P2BsaI (NNNGGTCTCATGGTAAGTGCCGGCAC), P3BsaI (NNNGGTCTCAACCATCCATCTGGCAA), and P4SpeI (NNNACTAGTCATGGGTATTGAGCTGA); and mtrB, P1SacI (NNNGAGCTCATTGGGAAGCCTATTATG), P2BsaI (NNNGGTCTCATGGTTAGAACCATGAACv), P3BsaI (NNNGGTCTCAACCATTGAGTCTGAACA), and P4BamHI (NNNGGATCCTATGCATATTATCCATTA). Complementation primers used to amplify mtrA from wild-type genomic DNA were SalImtrAFor (CTCGACTTTCTTGAATTTTGTTGGGA) and SacIImtrARev (CCGCGGTGTTGGCTAATAAACGCTA). The amplification product was digested with SalI and SacII and then cloned into a similarly digested vector, pBBR1-MCS2 (18), to create pMTRA1. The orientation of the insert ensured expression under the control of the vector-carried lac promoter, and the insert was verified by sequence analysis. Strains used in the complementation analysis of the mtrA deletion strain (JG476) were JG553 (mtrA pBBR1-MCS2), JG554 (mtrA pMTRA1), and JG168 (MR-1 pBBR1-MCS2), and kanamycin was provided at 50 µg/ml.


arrow
RESULTS AND DISCUSSION
 
Anaerobic respiration of [Co(III)-EDTA]– by MR-1 leads to cell death.
The anaerobic growth of other species of Shewanella coupled to [Co(III)-EDTA]– reduction has been reported previously; however, it has not been experimentally verified for S. oneidensis strain MR-1. No growth was visible when MR-1 was incubated on plates containing lactate and [Co(III)-EDTA]– (provided at concentrations ranging from 0.5 to 20 mM) as the sole anaerobic electron acceptor in rich or defined minimal medium (data not shown). These results suggested that MR-1 was unable to couple [Co(III)-EDTA]– reduction with anaerobic growth, that the substrate was limiting, or that a component of the reduction reaction inhibited growth.

We tested the growth of MR-1 in liquid culture, where [Co(III)-EDTA]– could be more available to growing cells than on solid medium. To obtain cell-specific measurements for each cell population, flow cytometric analysis was performed to examine both the viability and growth of MR-1 using [Co(III)-EDTA]– as the sole electron acceptor. At each time point, total cell numbers and the percentage of live cells were analyzed. Viable and nonviable cells have similar forward light scattering characteristics, which correlate with cell size, but exhibit different green fluorescence patterns. Cells with damaged membranes, indicative of death, retain less green fluorescence. Due to the accuracy of flow cytometry and the ease of determining pertinent cell concentrations by this method, the growth of MR-1 from concentrations as low as 104 cells per ml can be assayed directly.

Total cell numbers increased approximately 100-fold within 48 h in the presence of lactate and fumarate (data not shown). The percentage of live cells among all cells in the sample decreased within the first 48 h (Fig. 1). Once stationary phase was reached, live cell numbers remained consistent for the duration of the experiment. We hypothesize that cell death observed in the positive control was due to the culture's reaching stationary phase. Two negative controls were prepared: one lacking an electron donor but containing [Co(III)-EDTA]– and another containing lactate but no electron acceptor. In each case, the total number of viable cells remained constant (Fig. 1). The high percentages of live cells present in both negative controls suggest that [Co(III)-EDTA]– itself is not toxic to cells, an observation confirmed by monitoring aerobic growth on agar plates containing [Co(III)-EDTA]– (data not shown). No difference in total cell numbers in samples containing an electron donor alone or a donor and [Co(III)-EDTA]– as the electron acceptor was observed (data not shown). Therefore, the results of this experiment do not indicate if S. oneidensis strain MR-1 can grow anaerobically with [Co(III)-EDTA]– as an electron acceptor. However, unlike that in the lactate-only control, the population of viable cells in the samples containing lactate and [Co(III)-EDTA]– declined significantly over time, with less than 3% of the population remaining viable at the conclusion of the experiment (Fig. 1). Cell death occurred rapidly and correlated with the visual observation that [Co(III)-EDTA]– had been reduced, suggesting that [Co(II)-EDTA]2– was responsible for the observed decline in cell viability in these cultures.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

  		FIG. 1. Live/dead flow cytometric analysis of S. oneidensis MR-1 anaerobic growth using [Co(III)-EDTA]–. Shown are percentages of live cells in samples during anaerobic growth in minimal medium containing 20 mM lactate and fumarate (•), 20 mM lactate and 5 mM [Co(III)-EDTA]– ({triangleup}), lactate only ({square}), and 5 mM [Co(III)-EDTA]– only ({diamondsuit}). Error bars represent the standard errors of the means (SEM) from experiments performed in triplicate.

[Co(II)-EDTA]2– is toxic to MR-1.
Based on flow cytometry results, MR-1 was plated onto LB agar containing lactate, fumarate, and 0.5, 5, or 20 mM [Co(II)-EDTA]2–. Under aerobic conditions, concentrations of up to 5 mM [Co(II)-EDTA]2– did not inhibit growth; however, concentrations above 0.5 mM [Co(II)-EDTA]2– prevented growth anaerobically (data not shown). A similar trend was noted when the experiment was performed with minimal medium, except that concentrations higher than 0.5 mM [Co(II)-EDTA]2– inhibited growth under both aerobic and anaerobic conditions (data not shown). The difference in the toxicity of [Co(II)-EDTA]2– to MR-1 in rich and defined media is likely to be due to the availability of high concentrations of various nutrients found in LB, allowing cells to devote more energy to respond to the [Co(II)-EDTA]2– stress. To better define the concentrations of [Co(II)-EDTA]2– tolerated by MR-1 during growth, we inoculated cultures into minimal medium containing lactate, fumarate, and [Co(II)-EDTA]2– and monitored anaerobic growth by determining numbers of CFU (Fig. 2). No overall increase in CFU in cultures grown in the presence of 1 or 3 mM [Co(II)-EDTA]2– was noted, but a constant number of cells remained viable for the duration of the experiment. At [Co(II)-EDTA]2– concentrations of 4 mM (data not shown) or 5 mM, death was noted within 48 h and significant cellular death was evident at all subsequent time points (Fig. 2).


Figure 2
View larger version (10K):
[in this window]
[in a new window]

  		FIG. 2. Toxicity of [Co(II)-EDTA]2– during the growth of S. oneidensis MR-1. Plate counts were carried out over 96 h to monitor the anaerobic growth of cultures in tubes of minimal liquid medium containing 20 mM lactate, 20 mM fumarate, and various concentrations of [Co(II)-EDTA]2– as follows: 0 mM (control; {blacksquare}), 1 mM ({triangleup}), 3 mM ({circ}), or 5 mM ({blacktriangleup}). Data presented are the averages of results from experiments performed in duplicate (SEM, <10% deviation).

[Co(II)-EDTA]2– toxicity can be abolished by the addition of MgSO4.
Previous studies of other microorganisms determined that the toxicity of some divalent cations can be influenced by magnesium (Mg) concentrations (1). To suppress the detrimental effects of [Co(II)-EDTA]2–, media were supplemented with 25 mM MgSO4 and the anaerobic growth of MR-1 utilizing lactate and fumarate was analyzed (Fig. 3). The addition of MgSO4 to cultures did not affect growth over 48 h as monitored by optical density (A600). Cells grown in the presence of 0.5 mM [Co(II)-EDTA]2– with or without MgSO4 achieved similar optical densities, but cells supplemented with MgSO4 had a shorter lag time. The most significant effect was noted with cells grown in 1 mM [Co(II)-EDTA]2–. Without the addition of MgSO4, no increase in optical density was observed; however, the addition of MgSO4 permitted growth after a considerable lag. The decrease in optical density in the cultures at later time points was due to cell death and the lysis of cells in this experiment.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 3. MgSO4 suppresses [Co(II)-EDTA]2– toxicity during growth. Anaerobic growth was monitored in minimal medium containing 20 mM lactate and 20 mM fumarate ({blacksquare}) in the presence or absence of [Co(II)-EDTA]2– and 25 mM MgSO4, as follows: MgSO4 ({square}), 0.5 mM [Co(II)-EDTA]2– (•), 0.5 mM [Co(II)-EDTA]2– and MgSO4 ({circ}), 1 mM [Co(II)-EDTA]2– ({blacktriangleup}), or 1 mM [Co(II)-EDTA]2– and MgSO4 ({triangleup}). Data presented are the averages for duplicate experiments; error bars were removed for clarity (SEM, <10% deviation).

Why is [Co(II)-EDTA]2– more toxic than [Co(III)-EDTA]–? These complexes have substantially different dissociation constants, with [Co(II)-EDTA]2– being more likely to dissociate in solution (14). We sought to determine if the observed toxicity was due to free cobalt ions [Co(II)] or EDTA individually. The effects of Co(II) and EDTA during the anaerobic growth of MR-1 were evaluated, and both components were found to inhibit growth when present at levels as low as 0.25 mM (Fig. 4). At the Co(II) and EDTA concentrations tested, the addition of 25 mM MgSO4 had no effect on Co(II) lethality (Fig. 4A) but partially abolished EDTA toxicity (Fig. 4B). This observation suggests that the toxicity of [Co(II)-EDTA]2– is due in part to free EDTA since adding MgSO4 reversed the growth impairment. EDTA is able to chelate a wide range of metals and can destabilize or increase the permeability of the outer membrane in gram-negative bacteria (6, 20, 21). When we tested the toxicity of [Co(II)-EDTA]2– with excess Mg(II) (provided as MgSO4), it is possible that dissociated EDTA chelated Mg(II), therefore preventing the deleterious effects of free EDTA (Fig. 3). Under these conditions, free Co(II) concentrations must remain low enough not to impair growth (Fig. 3).


Figure 4
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 4. Toxicity of Co(II) and EDTA during the growth of MR-1. Anaerobic growth was monitored for cells in minimal medium containing 20 mM lactate and 20 mM fumarate. (A) Toxicity of Co(II) with (empty symbols) and without (filled symbols) 25 mM MgSO4. Symbols indicate no Co(II) addition (squares), 0.25 mM Co(II) (circles), or 2 mM Co(II) (triangles). (B) Toxicity of EDTA with (empty symbols) or without (filled symbols) 25 mM MgSO4. Symbols indicate no EDTA addition (squares), 0.25 mM EDTA (circles), or 2 mM EDTA (triangles). Data presented are the averages for duplicate experiments; error bars were removed for clarity (SEM, <10% deviation).

MgSO4-dependent growth of S. oneidensis MR-1 coupled to [Co(III)-EDTA]– respiration.
Since the toxicity of [Co(II)-EDTA]2– was alleviated through the addition of MgSO4, [Co(III)-EDTA]– utilization by MR-1 was reevaluated by adding 25 mM MgSO4 to cultures and monitoring CFU over time (Fig. 5). A positive control respiring fumarate achieved approximately 2 logs of growth within 24 h, whereas samples lacking either an electron acceptor or a donor had an overall decrease in cell numbers or no growth. Cell numbers increased by approximately 1 log when cells were cultured with lactate and [Co(III)-EDTA]–, demonstrating MgSO4-dependent growth of MR-1 coupled to [Co(III)-EDTA]– respiration.


Figure 5
View larger version (11K):
[in this window]
[in a new window]

  		FIG. 5. Growth of S. oneidensis MR-1 coupled to the respiration of [Co(III)-EDTA]–. Anaerobic growth in tubes of minimal liquid medium supplemented with 25 mM MgSO4 was monitored. Additionally, tubes contained 20 mM lactate and 20 mM fumarate ({blacktriangledown}), 20 mM lactate ({circ}), 1 mM [Co(III)-EDTA]– ({blacksquare}), and 20 mM lactate and 1 mM [Co(III)-EDTA]– ({diamond}). Growth was monitored by quantifying CFU aerobically using LB plates. Error bars represent SEM from experiments performed in triplicate.

Implications for remediation strategies.
Considering that the potential application for metal-reducing bacteria is the bioremediation of contaminant metals or radionuclides in aquatic and subsurface environments (47), our finding that [Co(II)-EDTA]2– is toxic to MR-1 will have an impact on remediation strategies using this organism. For the successful application of S. oneidensis in promoting the reduction of [Co(III)-EDTA]–, the nature of Co(II) ion and EDTA toxicity should be further studied to develop strains that can tolerate higher levels of [Co(II)-EDTA]2– than the present strains. An immediate strategy would be to supplement contaminated sites with MgSO4 to mitigate EDTA stress on bioremediation bacteria.

The reduction of [Co(III)-EDTA]– requires the Mtr respiratory pathway.
Though the reduction of [Co(III)-EDTA]– by other strains of Shewanella has been described previously, the genes required for this process have not been identified (3, 9, 14, 23, 45). Given the role of the Mtr respiratory pathway in reducing a variety of other substrates, we reasoned that it was likely to be involved in the reduction of [Co(III)-EDTA]–. Transposon mutants lacking Mtr pathway genes (mtrB and mtrC) and lacking genes for processes known to be required for a functional Mtr pathway (cymA, dsbD, menC, and gspD) all had lower rates of [Co(III)-EDTA]– reduction than the wild type (Fig. 6A). These data demonstrate the requirement of the Mtr pathway (mtrB and mtrC), type II secretion (gspD) (13, 38), c-type cytochrome maturation (dsbD) (8, 12), menaquinone biosynthesis (menC) (31, 41), and the tetraheme c-type cytochrome CymA, thought to be the primary link between many respiratory pathways in S. oneidensis and the menaquinone pool in the cytoplasmic membrane (29, 39, 40). The magnitudes of [Co(III)-EDTA]– reduction deficiency in the transposon mutants examined here are similar to previously described defects of these mutant strains in the reduction of Fe and Mn (4, 5, 22, 30).


Figure 6
View larger version (5K):
[in this window]
[in a new window]

  		FIG. 6. Anaerobic reduction of [Co(III)-EDTA]– by S. oneidensis MR-1 and mutant strains. (A) Analysis of the cymA (JG107; {diamond}), dsbD (JG297; {circ}), menC (JG300; +), mtrB (JG299; •), mtrC (JG298; {diamondsuit}), and gspD (JG301; *) transposon mutants relative to the wild type (JG274; {blacktriangledown}) and the abiotic control ({square}). (B) Analysis of the mtrA (JG476; {triangleup}), mtrB (JG467; •), mtrC (JG420; {diamondsuit}), and omcA (JG335; *) deletion mutants relative to the wild type (JG274; {blacktriangledown}) and the abiotic control ({square}). (C) Complementation of mtrA deletion strain JG476: mtrA pBBR1-MCS2 (JG553; {triangleup}), mtrA pMTRA1 (JG554; *), wild type with pBBR1-MCS2 (JG168; {blacktriangledown}), and abiotic control ({square}). Data presented are the averages for triplicate experiments; error bars were removed for clarity (SEM, <10% deviation).

To further quantify the role of the Mtr respiratory pathway in the reduction of [Co(III)-EDTA]–, we generated deletions of the four genes that encode Mtr respiratory proteins: mtrA, mtrB, mtrC, and omcA. MtrA is a periplasmic decaheme c-type cytochrome thought to accept electrons from CymA (35) and donate electrons to the MtrB/MtrC/OmcA complex (36, 43). MtrB is an integral outer membrane protein (4), while MtrC and OmcA are both decaheme c-type cytochrome lipoproteins (32) localized on the outer leaflet of the outer membrane (28). Deletions in the individual genes did not alter the expression of other genes within this cluster, indicating that these genes do not affect polarity as measured by quantitative reverse transcription-PCR (data not shown). Strains lacking mtrA and mtrB were severely defective in [Co(III)-EDTA]– reduction, while mtrC mutants were partially defective (Fig. 6B). Interestingly, the mtrC transposon mutation caused a more striking defect (reduction to ~12% of the wild-type rate) than the mtrC deletion mutation (reduction to ~50% of the wild-type rate), suggesting some polarity of the transposon on mtrA and/or mtrB, the genes located immediately downstream of mtrC. Strains lacking omcA were only slightly defective (exhibiting 96% of the wild-type rate), indicating that OmcA is not required for [Co(III)-EDTA]– reduction under the conditions tested. These data suggest that MtrC is the primary reductase for [Co(III)-EDTA]– in S. oneidensis strain MR-1. The complementation of the mtrA deletion strain fully restored [Co(III)-EDTA]– reduction activity, as shown in Fig. 6C. The complementation of both mtrB and mtrC deletions also yielded significant increases in [Co(III)-EDTA]– reduction rates (data not shown). Taken together, the results of genetic analyses of [Co(III)-EDTA]– reduction demonstrate that the Mtr respiratory pathway is essential for this process. Given the ability of the Mtr respiratory pathway to facilitate electron transfer to the outside of the cell, we predict that S. oneidensis strain MR-1 can also reduce insoluble forms of cobalt {e.g., heterogenite [Co(III)OOH] or cobalt oxy(hydr)oxide (CoOOH)}. Studies are under way now to test this prediction.

This work has added [Co(III)-EDTA]– to the list of substrates reduced via the Mtr respiratory pathway of S. oneidensis. The promiscuity of this system is intriguing since it has a direct impact on the biochemical mechanism of electron transfer to these different substrates, the ecological utility of such a system to Shewanella, and the potential bioremediation applications of Shewanella bacteria.


arrow
ACKNOWLEDGMENTS
 
We thank the University of Southern California/Agouron Institute 2003 International Geobiology class for technical assistance in isolating transposon mutants. We acknowledge Friedrich Srienc (Department of Chemical Engineering and Material Sciences and BioTechnology Institute, University of Minnesota) for providing equipment for flow cytometry analyses. We also thank anonymous reviewers who provided helpful suggestions for improving the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: BioTechnology Institute, University of Minnesota, 140 Gortner Lab, 1479 Gortner Ave., St. Paul, MN 55108. Phone: (612) 626-6496. Fax: (612) 625-5780. E-mail: gralnick{at}umn.edu Back

{triangledown} Published ahead of print on 3 October 2008. Back


arrow
REFERENCES
 
    1
  1. Abelson, P., and E. Aldous. 1950. Ion antagonisms in microorganisms: interference of normal magnesium metabolism by nickel, cobalt, cadmium, zinc, and manganese. J. Bacteriol. 60:401-413.[Free Full Text]
    2. 2
  2. Balch, W. E., G. E. Fox, L. J. Magrum, C. R. Woese, and R. S. Wolfe. 1979. Methanogens: reevaluation of a unique biological group. Microbiol. Mol. Biol. Rev. 43:260-296.[Free Full Text]
    3. 3
  3. Beliaev, A., D. Klingeman, J. Klappenbach, L. Wu, M. Romine, J. Tiedje, K. Nealson, J. Fredrickson, and J. Zhou. 2005. Global transcriptome analysis of Shewanella oneidensis MR-1 exposed to different terminal electron acceptors. J. Bacteriol. 187:7138-7145.[Abstract/Free Full Text]
    4. 4
  4. Beliaev, A. S., and D. A. Saffarini. 1998. Shewanella putrefaciens mtrB encodes an outer membrane protein required for Fe(III) and Mn(IV) reduction. J. Bacteriol. 180:6292-6297.[Abstract/Free Full Text]
    5. 5
  5. Beliaev, A. S., D. A. Saffarini, J. L. McLaughlin, and D. Hunnicutt. 2001. MtrC, an outer membrane decahaem c cytochrome required for metal reduction in Shewanella putrefaciens MR-1. Mol. Microbiol. 39:722-730.[CrossRef][Medline]
    6. 6
  6. Berney, M., F. Hammes, F. Bosshard, H.-U. Weilenmann, and T. Egli. 2007. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Appl. Environ. Microbiol. 73:3283-3290.[Abstract/Free Full Text]
    7. 7
  7. Blessing, T. C., B. W. Wielinga, M. J. Morra, and S. Fendorf. 2001. Co(III)EDTA– reduction by Desulfovibrio vulgaris and propagation of reactions involving dissolved sulfide and polysulfides. Environ. Sci. Technol. 35:1599-1603.[Medline]
    8. 8
  8. Bouhenni, R., A. Gehrke, and D. Saffarini. 2005. Identification of genes involved in cytochrome c biogenesis in Shewanella oneidensis, using a modified mariner transposon. Appl. Environ. Microbiol. 71:4935-4937.[Abstract/Free Full Text]
    9. 9
  9. Caccavo, F., N. Ramsing, and J. Costerton. 1996. Morphological and metabolic responses to starvation by the dissimilatory metal-reducing bacterium Shewanella alga BrY. Appl. Environ. Microbiol. 62:4678-4682.[Abstract]
    10. 10
  10. Carpentier, W., L. De Smet, J. Van Beeumen, and A. Brige. 2005. Respiration and growth of Shewanella oneidensis MR-1 using vanadate as the sole electron acceptor. J. Bacteriol. 187:3293-3301.[Abstract/Free Full Text]
    11. 11
  11. Croal, L. R., J. A. Gralnick, D. Malasarn, and D. K. Newman. 2004. The genetics of geochemistry. Annu. Rev. Genet. 38:175-202.[CrossRef][Medline]
    12. 12
  12. Crooke, H., and J. Cole. 1995. The biogenesis of c-type cytochromes in Escherichia coli requires a membrane-bound protein, DipZ, with a protein disulphide isomerase-like domain. Mol. Microbiol. 15:1139-1150.[Medline]
    13. 13
  13. DiChristina, T. J., C. M. Moore, and C. A. Haller. 2002. Dissimilatory Fe(III) and Mn(IV) reduction by Shewanella putrefaciens requires ferE, a homolog of the pulE (gspE) type II protein secretion gene. J. Bacteriol. 184:142-151.[Abstract/Free Full Text]
    14. 14
  14. Gorby, Y., F. Caccavo, Jr., and H. Bolton, Jr. 1998. Microbial reduction of cobalt III EDTA in the presence and absence of manganese (IV) oxide. Environ. Sci. Technol. 32:244-250.
    15. 15
  15. Gralnick, J. A., C. T. Brown, and D. K. Newman. 2005. Anaerobic regulation by an atypical Arc system in Shewanella oneidensis. Mol. Microbiol. 56:1347-1357.[CrossRef][Medline]
    16. 16
  16. Gralnick, J. A., and D. K. Newman. 2007. Extracellular respiration. Mol. Microbiol. 65:1-11.[CrossRef][Medline]
    17. 17
  17. Gralnick, J. A., H. Vali, D. P. Lies, and D. K. Newman. 2006. Extracellular respiration of dimethyl sulfoxide by Shewanella oneidensis strain MR-1. Proc. Natl. Acad. Sci. USA 103:4669-4674.[Abstract/Free Full Text]
    18. 18
  18. Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop II, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176.[CrossRef][Medline]
    19. 19
  19. Krupka, K., and R. Serne. December 2002, posting date. Geochemical factors affecting the behavior of antimony, cobalt, europium, technetium and uranium in vadose sediments. Technical report PNNL-14126. Pacific Northwest National Laboratory, Richland, WA. http://www.pnl.gov/main/publications/external/technical_reports/PNNL-14126.pdf.
    20. 20
  20. Leive, L. 1965. A nonspecific increase in permeability in Escherichia coli produced by EDTA. Proc. Natl. Acad. Sci. USA 53:745-750.[Free Full Text]
    21. 21
  21. Leive, L. 1965. Release of lipopolysaccharide by EDTA treatment of E. coli. Biochem. Biophys. Res. Commun. 21:290-296.[CrossRef][Medline]
    22. 22
  22. Lies, D., M. Hernandez, A. Kappler, R. Mielke, J. Gralnick, and D. Newman. 2005. Shewanella oneidensis MR-1 uses overlapping pathways for iron reduction at a distance and by direct contact under conditions relevant for biofilms. Appl. Environ. Microbiol. 71:4414-4426.[Abstract/Free Full Text]
    23. 23
  23. Liu, C., Y. Gorby, J. Zachara, J. Fredrickson, and C. Brown. 2002. Reduction kinetics of Fe(III), Co(III), U(VI), Cr(VI), and Tc(VII) in cultures of dissimilatory metal-reducing bacteria. Biotechnol. Bioeng. 80:637-649.[CrossRef][Medline]
    24. 24
  24. Lloyd, J. R. 2003. Microbial reduction of metals and radionuclides. FEMS Microbiol. Rev. 27:411-425.[CrossRef][Medline]
    25. 25
  25. Marshall, M. J., A. E. Plymale, D. W. Kennedy, L. Shi, Z. Wang, S. B. Reed, A. C. Dohnalkova, C. J. Simonson, C. Liu, D. A. Saffarini, M. F. Romine, J. M. Zachara, A. S. Beliaev, and J. K. Fredrickson. 2008. Hydrogenase- and outer membrane c-type cytochrome-facilitated reduction of technetium(VII) by Shewanella oneidensis MR-1. Environ. Microbiol. 10:125-136.
    26. 26
  26. Means, J. L., D. A. Crerar, M. P. Borcsik, and J. O. Duguid. 1978. Adsorption of Co and selected actinides by Mn and Fe oxides in soils and sediments. Geochim. Cosmochim. Acta 42:1763-1773.[CrossRef]
    27. 27
  27. Myers, C., and K. Nealson. 1988. Bacterial manganese reduction and growth with manganese oxide as the sole electron acceptor. Science 240:1319-1321.[Abstract/Free Full Text]
    28. 28
  28. Myers, C. R., and J. M. Myers. 2003. Cell surface exposure of the outer membrane cytochromes of Shewanella oneidensis MR-1. Lett. Appl. Microbiol. 37:254-258.[CrossRef][Medline]
    29. 29
  29. Myers, C. R., and J. M. Myers. 1997. Cloning and sequence of cymA, a gene encoding a tetraheme cytochrome c required for reduction of iron(III), fumarate, and nitrate by Shewanella putrefaciens MR-1. J. Bacteriol. 179:1143-1152.[Abstract/Free Full Text]
    30. 30
  30. Myers, C. R., and J. M. Myers. 2002. MtrB is required for proper incorporation of the cytochromes OmcA and OmcB into the outer membrane of Shewanella putrefaciens MR-1. Appl. Environ. Microbiol. 68:5585-5594.[Abstract/Free Full Text]
    31. 31
  31. Myers, C. R., and J. M. Myers. 1993. Role of menaquinone in the reduction of fumarate, nitrate, iron(III) and manganese(IV) by Shewanella putrefaciens MR-1. FEMS Microbiol. Lett. 114:215-222.[CrossRef]
    32. 32
  32. Myers, C. R., and J. M. Myers. 2004. The outer membrane cytochromes of Shewanella oneidensis MR-1 are lipoproteins. Lett. Appl. Microbiol. 39:466-470.[CrossRef][Medline]
    33. 33
  33. Myers, J. M., W. E. Antholine, and C. R. Myers. 2004. Vanadium(V) reduction by Shewanella oneidensis MR-1 requires menaquinone and cytochromes from the cytoplasmic and outer membranes. Appl. Environ. Microbiol. 70:1405-1412.[Abstract/Free Full Text]
    34. 34
  34. Nealson, K. H., and J. Scott. 2005. Ecophysiology of the genus Shewanella. Prokaryotes 1133-1151.
    35. 35
  35. Pitts, K. E., P. S. Dobbin, F. Reyes-Ramirez, A. J. Thomson, D. J. Richardson, and H. E. Seward. 2003. Characterization of the Shewanella oneidensis MR-1 decaheme cytochrome MtrA: expression in Escherichia coli confers the ability to reduce soluble Fe(III) chelates. J. Biol. Chem. 278:27758-27765.[Abstract/Free Full Text]
    36. 36
  36. Ross, D. E., S. S. Ruebush, S. L. Brantley, R. S. Hartshorne, T. A. Clarke, D. J. Richardson, and M. Tien. 2007. Characterization of protein-protein interactions involved in iron reduction by Shewanella oneidensis MR-1. Appl. Environ. Microbiol. 73:5797-5808.[Abstract/Free Full Text]
    37. 37
  37. Saltikov, C. W., and D. K. Newman. 2003. Genetic identification of a respiratory arsenate reductase. Proc. Natl. Acad. Sci. USA 100:10983-10988.[Abstract/Free Full Text]
    38. 38
  38. Sandkvist, M. 2001. Biology of type II secretion. Mol. Microbiol. 40:271-283.[CrossRef][Medline]
    39. 39
  39. Schwalb, C., S. K. Chapman, and G. A. Reid. 2002. The membrane-bound tetrahaem c-type cytochrome CymA interacts directly with the soluble fumarate reductase in Shewanella. Biochem. Soc. Trans. 30:658-662.[CrossRef][Medline]
    40. 40
  40. Schwalb, C., S. K. Chapman, and G. A. Reid. 2003. The tetraheme cytochrome CymA is required for anaerobic respiration with dimethyl sulfoxide and nitrite in Shewanella oneidensis. Biochemistry 42:9491-9497.[CrossRef][Medline]
    41. 41
  41. Sharma, V., R. Meganathan, and M. E. Hudspeth. 1993. Menaquinone (vitamin K2) biosynthesis: cloning, nucleotide sequence, and expression of the menC gene from Escherichia coli. J. Bacteriol. 175:4917-4921.[Abstract/Free Full Text]
    42. 42
  42. Shi, L., B. Chen, Z. Wang, D. A. Elias, M. U. Mayer, Y. A. Gorby, S. Ni, B. H. Lower, D. W. Kennedy, D. S. Wunschel, H. M. Mottaz, M. J. Marshall, E. A. Hill, A. S. Beliaev, J. M. Zachara, J. K. Fredrickson, and T. C. Squier. 2006. Isolation of a high-affinity functional protein complex between OmcA and MtrC: two outer membrane decaheme c-type cytochromes of Shewanella oneidensis MR-1. J. Bacteriol. 188:4705-4714.[Abstract/Free Full Text]
    43. 43
  43. Shi, L., T. C. Squier, J. M. Zachara, and J. K. Fredrickson. 2007. Respiration of metal (hydr)oxides by Shewanella and Geobacter: a key role for multihaem c-type cytochromes. Mol. Microbiol. 65:12-20.[CrossRef][Medline]
    44. 44
  44. Shyu, J. B., D. P. Lies, and D. K. Newman. 2002. Protective role of tolC in efflux of the electron shuttle anthraquinone-2,6-disulfonate. J. Bacteriol. 184:1806-1810.[Abstract/Free Full Text]
    45. 45
  45. Stapleton, R., Jr., Z. Sabree, A. Palumbo, C. Moyer, A. Devol, Y. Roh, and J. Zhou. 2005. Metal reduction at cold temperatures by Shewanella isolates from various marine environments. Aquat. Microb. Ecol. 38:81-91.[CrossRef]
    46. 46
  46. Taylor, D., and P. Jardine. 1995. Analysis of cobalt(II)EDTA and cobalt(III)EDTA in pore water by ion chromatography. J. Environ. Qual. 24:789-791.[Abstract/Free Full Text]
    47. 47
  47. Tiedje, J. 2002. Shewanella—the environmentally versatile genome. Nat. Biotechnol. 20:1118-1123.[CrossRef][Medline]

Applied and Environmental Microbiology, November 2008, p. 6880-6886, Vol. 74, No. 22
0099-2240/08/$08.00+0     doi:10.1128/AEM.00840-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Baron, D., LaBelle, E., Coursolle, D., Gralnick, J. A., Bond, D. R. (2009). Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1. J. Biol. Chem. 284: 28865-28873 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hau, H. H.
Right arrow Articles by Gralnick, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hau, H. H.
Right arrow Articles by Gralnick, J. A.
Agricola
Right arrow Articles by Hau, H. H.
Right arrow Articles by Gralnick, J. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»