Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Dunlap, P. V. Articles by Fukui, A. Search for Related Content PubMed PubMed Citation Articles by Dunlap, P. V. Articles by Fukui, A. Agricola Articles by Dunlap, P. V. Articles by Fukui, A.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, December 2008, p. 7471-7481, Vol. 74, No. 24
0099-2240/08/$08.00+0     doi:10.1128/AEM.01619-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Developmental and Microbiological Analysis of the Inception of Bioluminescent Symbiosis in the Marine Fish Nuchequula nuchalis (Perciformes: Leiognathidae)

Paul V. Dunlap,^1* Kimberly M. Davis,^1, Shinichi Tomiyama,^2, Misato Fujino,² and Atsushi Fukui²

Department of Ecology and Evolutionary Biology, University of Michigan, Ann Arbor, Michigan 48109,¹ School of Marine Science and Technology, Tokai University, Orido, Shimizu, Shizuoka 424-8610, Japan²

Received 15 July 2008/ Accepted 22 October 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Many marine fish harbor luminous bacteria as bioluminescent symbionts. Despite the diversity, abundance, and ecological importance of these fish and their apparent dependence on luminous bacteria for survival and reproduction, little is known about developmental and microbiological events surrounding the inception of their symbioses. To gain insight on these issues, we examined wild-caught larvae of the leiognathid fish Nuchequula nuchalis, a species that harbors Photobacterium leiognathi as its symbiont, for the presence, developmental state, and microbiological status of the fish's internal, supraesophageal light organ. Nascent light organs were evident in the smallest specimens obtained, flexion larvae of 6.0 to 6.5 mm in notochord length (NL), a developmental stage at which the stomach had not yet differentiated and the nascent gasbladder had not established an interface with the light organ. Light organs of certain of the specimens in this size range apparently lacked bacteria, whereas light organs of other specimens of 6.5 mm in NL and of all larger specimens harbored large populations of bacteria, representatives of which were identified as P. leiognathi. Bacteria identified as Vibrio harveyi were also present in the light organ of one larval specimen. Light organ populations were composed typically of two or three genetically distinct strain types of P. leiognathi, similar to the situation in adult fish, and the same strain type was only rarely found in light organs of different larval, juvenile, or adult specimens. Light organs of larvae carried a smaller proportion of strains merodiploid for the lux-rib operon, 79 of 249 strains, than those of adults (75 of 91 strains). These results indicate that light organs of N. nuchalis flexion and postflexion larvae of 6.0 to 6.7 mm in NL are at an early stage of development and that inception of the symbiosis apparently occurs in flexion larvae of 6.0 to 6.5 mm in NL. Ontogeny of the light organ therefore apparently precedes acquisition of the symbiotic bacteria. Furthermore, bacterial populations in larval light organs near inception of the symbiosis are genetically diverse, like those of adult fish.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Members of 12 families of marine teleost fish, representing six orders, form bioluminescent symbioses with luminous bacteria. Many of these fish are abundant in the marine environment and geographically widespread and play important roles in marine ecosystems (14, 17, 22, 24). The fish maintain their bacteria in gland-like tissue complexes called light organs, the anatomical diversity of which among different fish reflects the evolutionary diversity of these animals (17, 47). The fish is thought to provide its bacteria, which are extracellular and typically a single species within each fish family, with oxygen and nutrients for luminescence and reproduction. The animal uses the bacterial light for signaling, avoiding predators, and attracting prey (e.g., see references 20, 24, 32-35, 37, and 46). Growth of the bacterial population within the light organ leads to a release of excess cells from the light organ into the seawater (23, 41), from which the bacteria colonize various other habitats (14, 24, 40). In the only experimental study, bacteria could be passed via seawater from adults to aposymbiotic juveniles to reinitiate the symbiosis (51). To date, four bacterial species, Aliivibrio fischeri, Photobacterium kishitanii, Photobacterium leiognathi, and "Photobacterium mandapamensis," have been identified as bioluminescent symbionts of fish (17, 26, 48).

Despite the abundance and ecological importance of these fish and their apparent dependence on luminous bacteria for survival and reproduction, very little is known about developmental and microbiological events surrounding the inception of their symbioses. Limited information from microscopic examinations of a few wild-caught or artificially reared specimens of early developmental stages of some fish suggests the animal acquires its symbiont early in development, prior to or during notochord flexion, and that initiation of light organ ontogeny precedes bacterial acquisition (6, 25, 28, 31, 38, 52). However, detailed microbiological analysis of early developmental stages has not been carried out with any wild-caught bacterially luminous fish, due to the rareness with which early life history stages of these animals have been obtained. This situation leaves undefined many aspects of symbiont-host interaction at the inception of the symbiosis.

To gain insight into these issues, we collected early developmental stages of wild-caught specimens of the leiognathid fish Nuchequula nuchalis, a shallow-dwelling, coastal species, and examined them using microscopic and microbiological methods. Leiognathids bear an internal, supraesophageal light organ and typically harbor P. leiognathi as their light organ symbiont (7, 9, 12, 21, 26, 43). The goals of the study were to identify the developmental stage at which the symbiosis begins in N. nuchalis, to determine whether initiation of light organ ontogeny precedes bacterial colonization, and to characterize the genetic diversity of bacteria initiating the association.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Collection of fish specimens.
Larval and juvenile specimens of N. nuchalis were collected at Miho Kaigan, Suruga Bay, Honshu, Japan, on 29 July, 1 August, and 3 August 2005, from the wave zone 2 to 5 m from shore (approximately 1-m depth) using a hand-towed beach seine net (1 m deep by 3 m wide by 1 m long; mesh size, 0.53 mm). The net sampled from the surface to 1 m below the surface. On 1 August, seawater temperature and salinity at the sampled sites were 25.4°C and 28.1 to 28.8 ppt, respectively. Adult specimens of N. nuchalis were collected by boat seine at Miho Kaigan and from gill nets in Suruga Bay. Specimens of N. nuchalis were identified by reference to the work of Okiyama (42) and Kimura et al. (27). Specimens in which formation of all fin rays was not complete, less than 10.0 mm in length (standard length [SL]), were considered larvae, whereas specimens in which formation of all fin rays was complete, which were 10.0 mm (SL) and larger, were considered juveniles. Furthermore, larvae were divided into flexion stage, with a 6.0- to 6.7-mm notochord length (NL), and postflexion stage, with a 7.2- to 9.4-mm SL, respectively, based on whether the tips of the hypural bones had fully assumed a vertical position. In certain cases, larvae smaller than 7.0 mm in SL had completed notochord formation; lengths of these specimens are given as SL. Specimens of 43 mm in SL and larger were considered adults.

TEM.
Light organs for examination by transmission electron microscopy (TEM), which was carried out by staff of the University of Michigan Microscopy and Image Analysis Laboratory, were dissected from larval specimens of N. nuchalis that had been preserved in Karnovsky's fixative (2% paraformaldehyde, 2.5% glutaraldehyde, 0.1 M sodium phosphate buffer; EM Sciences, Hatfield, PA) and stored at 4°C. Light organs were washed in phosphate buffer, postfixed in buffered osmium tetroxide (1%) for 1 h, and then rinsed, dehydrated in ascending strengths of ethanol, infiltrated with propylene oxide, infiltrated with polyembed 812 epoxy resin, and polymerized. Ultrathin sections were mounted on slotted grids with a supporting membrane, double stained with lead citrate-uranyl acetate, and examined with a Philips CM-100 transmission electron microscope.

Bacterial isolations.
Specimens of larval, juvenile, and adult N. nuchalis to be used for bacterial isolations were kept on ice following collection and dissected aseptically to remove the light organ, which was then homogenized in sterile buffered (25 mM HEPES buffer, pH 7.25) 70% artificial seawater (39) (100 or 500 µl for larval and juvenile specimens and 500 µl or 1 ml for adults). Ten to five hundred microliters of the light organ homogenates, or dilutions thereof, were spread on LSW-70 agar plates (16), which contained (per liter) 10 g tryptone, 5 g yeast extract, 350 ml double-strength artificial seawater (39), 650 ml deionized water, and 15 g agar. Bacterial strains were purified on LSW-70 agar plates, grown overnight in LSW-70 broth at room temperature, and stored in cryoprotective medium at –75°C (14).

Strain typing.
Genomic DNA was purified from 1-ml cultures of strains grown overnight at room temperature in LSW-70 broth, using the Qiagen (Valencia, CA) DNeasy tissue extraction kit.

DNA fingerprint analysis (genomotyping) was carried out by repetitive element palindromic PCR (rep-PCR) (49), essentially as described previously (13, 26). The reaction mixture for rep-PCR contained the following (per 25-µl reaction volume): 6.125 µl of tissue culture-grade water (Sigma, St. Louis, MO), 5 µl of 5x Gitschier buffer, 0.2 µl of bovine serum albumin (10 mg ml^–1), 2.5 µl of dimethylsulfoxide (100%), 3.125 µl of deoxynucleoside triphosphates (10 mM), 1.25 µl (each) of primers REPIR-1 (5'-IIIICGICGICATCIGGC-3') and REP2-1 (5'-ICGICTTATCIGGCCTAC-3') (50 nM), 2.5 µl of MgCl₂ (25 mM), and 1 µl of Taq polymerase (5 U µl^–1) (Eppendorf). For individual reactions, 23 µl of the mixture was combined with 1.5 µl of template DNA (or 2 µl depending on the concentration of the DNA), prepared as described above. PCR was carried out using the Bio-Rad (Hercules, CA) iCycler, with the following conditions for rep-PCR: hot start and 2 min of denaturation at 95°C; 30 cycles of 30 s at 92°C (denaturation), 1 min at 40°C (primer annealing), and 8 min at 65°C (polymerase extension); a single additional extension step of 8 min at 65°C; and snap cooling to 4°C. Products of the rep-PCRs were separated on 1.75% agarose gels in 1x TA (0.04 M Tris-acetate) buffer containing 5 µl of 1% ethidium bromide at 80 V for approximately 4.5 h. Digital images of gels were captured with a Bio-Rad Fluor S Multi-imager and were examined visually. Repeated rep-PCR analysis of the same strain consistently gave the same banding pattern. Strains were identified as distinct if their DNA fingerprints differed by one or more bands.

Amplification of luxA region.
The primers CWLAforPl (GTTTTAGATCAACTGTCTAAAGGRCG) and CWLArevPl (TCAGAACCATTCGCTTCAAATCCAAC), designed for amplification of the luxA region from P. leiognathi (26), were used to amplify the luxA region from genomic DNA of N. nuchalis symbionts. For amplifications, Taq polymerase and reagents of the Eppendorf (Hamburg, Germany) MasterTaq kit were used with the following protocol: hot start and 2-min denaturing at 95°C; 35 cycles of 20 s at 94°C (denaturing), 15 s at 50°C (primer annealing), and 1 min at 72°C (polymerase extension); a single additional extension step of 7 min at 72°C; and snap cooling to 4°C.

DNA sequencing and merodiploidy analysis.
Sequencing of the luxA amplicons, approximately 0.8 kb in length, was carried out by staff of the University of Michigan Sequencing Core using the amplification primers and dye terminator cycle sequencing on a Perkin-Elmer (Wellesley, MA) ABI 3730 or 3700 DNA analyzer. Bacterial identifications were based on an extensive GenBank data set for luxA genes of luminous bacteria (e.g., see references 2-5, 16, 26, 48, and 49). The sequencing chromatograms were examined for single or multiple discrete luxA sequence peaks to identify the presence of single versus multiple (merodiploid) lux-rib operons (4).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Structure of nascent light organ in N. nuchalis larvae.
Larval and juvenile specimens of N. nuchalis, ranging in size from 6.0 mm in NL to 12.1 mm in SL, were collected by beach seine and examined for the presence and developmental state of an internal, supraesophageal light organ and the extent to which the light organ was colonized by luminous bacteria. Tissue consistent with a light organ, partially wrapping around the esophagus and covered dorsally by a layer of pigment, was evident in even the smallest specimens obtained, 6.0 to 6.5 mm in NL (Fig. 1). The pigment layer presumably functions to prevent light from passing from the light organ dorsally into and through the transparent epaxial musculature of the larval fish. In specimens of this size, the stomach has not yet differentiated, and the nascent gasbladder is small and has not yet established the interface with the light organ that is characteristic of juvenile and adult leiognathids (1, 15, 19, 32, 33).

View larger version (24K): [in this window] [in a new window]

FIG. 1. Sketch of the position and structure of the internal, supraesophageal light organ of a flexion larva of N. nuchalis (6.3 mm in NL). (A) Lateral view of fish. The light organ (not shown) is located internally, slightly above and interior to the pectoral fin base. (B) Lateral view of light organ and associated tissues with body wall cut away (a, esophagus; b, light organ; c, gasbladder; d, gut) showing its supraesophageal, pregastric location. (C) Dorsal view of light organ and associated tissues. Note the nascent gasbladder. Bar, 1 mm (A), 0.1 mm (B), or 0.1 mm (C).

The bulk of the light organ in larvae is composed of clusters of host cells among which open spaces are evident (Fig. 2 and 3). This architecture is generally similar to the morphology of light organ tubules of the adult fish, which form the core of the light organ and house the bacteria extracellularly within the tubule lumina. The tubule lumina in larvae, however, vary widely in diameter within a single light organ, from approximately 2 to 30 µm, with smaller and larger tubules often in close association. Bacterial cells are present in many of the tubules, whereas many tubules of the same light organ appear to lack bacteria (Fig. 2 and 3).

View larger version (65K): [in this window] [in a new window]

FIG. 2. TEM of ultrastructure of the light organ of a flexion larva of N. nuchalis (6.7 mm in NL). (A) TEM section through the light organ, showing the pigment layer and host cells forming tubules that either contain or lack bacteria. (B) Light organ tubules containing bacteria. (C) Bacterial cells, some with refractile granules that are likely to be poly-β-hydroxybutyrate, and including a "ghost" cell, in a light organ tubule. Bar, 20 µm (A), 5 µm (B), or 1 µm (C).

View larger version (61K): [in this window] [in a new window]

FIG. 3. TEM of tubules lacking bacteria in the light organ of the flexion larva of N. nuchalis (6.7 mm in NL) shown in Fig. 2. (A) Larger tubules lacking bacteria, showing the dispersed and dense granular material and microvillus-like extensions in different tubules (see the text). (B) Closeup of smaller tubule (lower left in panel A) with microvillus-like extensions filling the tubule. (C) Closeup (from panel B) of microvillus-like extensions, showing their contiguity with host cell membranes. Bar, 4 µm (A), 1 µm (B), or 400 nm (C).

The bacterial cells are approximately 0.9 by 1.8 µm and exhibit the double-track membranes of gram-negative bacteria (Fig. 2C). The bacterial cells often contain one or more small spherical refractile inclusions, presumably granules of poly-β-hydroxybutyrate, a carbon storage product formed by P. leiognathi in culture but not typically seen for P. leiognathi in symbiosis with adult fish (7, 8, 11). The polar flagella formed by P. leiognathi grown culture (8) are not evident here, as also noted for P. leiognathi in symbiosis with adult leiognathids (12), and bacteria experimentally released from the nascent light organ into seawater were not initially motile. Although most bacterial cells show electron opacity consistent with viability, semitransparent "ghost" cells are present at low frequency (Fig. 2C); bacterial "ghost" cells have been noted previously in light organs of various species of leiognathid fish (7, 11). Evident here also are bacterial cells within gaps between host cells (Fig. 2A and B).

Granular material fills many of the tubules lacking bacteria (Fig. 2A and 3A), and this material is less evident or lacking in those tubules containing high numbers of bacteria. In certain of the small tubules lacking bacteria, extensive microvillus-like extensions are evident (Fig. 3B and C); in others, dense granular material is present; and in larger tubules that lack bacteria, the material appears more evenly dispersed (Fig. 3A). Overall, these observations suggest that for larvae of N. nuchalis of 6.0 to 6.7 mm in NL, the light organ is at an early stage of development and is undergoing bacterial colonization.

Developmental stage at inception of symbiosis.
Consistent with this interpretation, light organs of some larval specimens in this size range apparently lacked bacteria. To test for the presence of bacteria, we aseptically dissected the light organ, homogenized it to release bacteria, and then spread all or a portion of the homogenate on plates of seawater-based agar medium to allow bacteria present to reproduce and form colonies. Light organs of certain of the smallest specimens examined, 6.0 to 6.5 mm in NL, yielded no colonies, luminous or nonluminous, whereas light organs of other specimens of 6.5 mm in NL and all specimens of 6.6 mm in NL and larger harbored large populations of luminous bacteria (Table 1; Fig. 2). These results indicate that inception of the symbiosis apparently occurs in flexion larvae of 6.0 to 6.5 mm in NL. Therefore, initiation of light organ ontogeny apparently precedes the host's acquisition of symbiotic bacteria.

View this table: [in this window] [in a new window]

TABLE 1. Population structure of light organ symbionts from larval-, juvenile-, and adult-stage specimens of N. nuchalis

The bacterial colonies arising from the light organ homogenates of larval and juvenile specimens were luminous, as were those of adults, and in all cases except one (described below), the luminescence and morphology of the bacterial colonies were characteristic of P. leiognathi, the bacterial symbiont typically present in light organs of leiognathids (12, 16, 26, 43). Nonetheless, to confirm the identity of these bacteria, we sequenced the luxA gene of strains representative of each strain type (see below) from each larval, juvenile, and adult specimen. The luxA gene sequence distinguishes among all known species of luminous bacteria (e.g., 4, 5, 26, 48, 49) and therefore provides a rapid and effective means of confirming species identifications. All examined strains (with the exception described below) were confirmed by this method to be members of P. leiognathi (Table 1).

Bacterial population diversity in larval light organs.
Populations of P. leiognathi in light organs of adult leiognathids are composed typically of a few to several genetically distinct strain types (16). Whether this diversity is acquired at the inception of the symbiosis, by primary colonization of the nascent light organ by genetically distinct strains, or results from secondary colonization events over time by different strains is not known. To distinguish between these possibilities, we examined the population structure of bacteria in light organs of N. nuchalis larvae.

To identify the number of distinct strain types in each light organ population, strains from each larval specimen (Table 1) were typed by rep-PCR, a DNA fingerprinting (genomotyping) method (13, 50). An example of DNA fingerprinting of strains, for bacteria from the light organ of the larval specimen lnuch.40, is shown in Fig. 4. This population analysis revealed that light organs of larval N. nuchalis carried from one to six different strain types (n = 15 larval specimens), an average of 2.8 strain types per specimen. These values are similar to those reported previously for symbiont populations of adult leiognathid fish, from one to five different strain types (n = 26), an average of 2.6 types per specimen (16). Light organs of adult specimens of N. nuchalis apparently contained a somewhat greater diversity of strains, from 3 to 7 different strain types (n = 5 adult specimens), an average of 4.0 types per specimen (Table 1), but this difference might be due to the smaller sample size. Regardless, bacterial populations in light organs of N. nuchalis near inception of the symbiosis commonly are composed of multiple genetically distinct strains, and the extent of symbiont population diversity in light organs of larvae is similar to that in adult fish. Primary colonization of the nascent light organ by multiple genetically distinct strains therefore apparently accounts for the symbiont population diversity seen in adult light organs.

View larger version (51K): [in this window] [in a new window]

FIG. 4. DNA fingerprint (rep-PCR) analysis of bacteria from the light organ of a postflexion larva of N. nuchalis (lnuch.40, 7.2 mm in NL). Visual inspection identified five strain types from symbiosis with this fish, represented by lnuch.40.1, lnuch.40.2, lnuch.40.7, lnuch.40.8, lnuch.40.11, lnuch.40.15, and lnuch.40.16 (first type); lnuch.40.3, lnuch.40.4, lnuch.40.5, lnuch.40.6, and lnuch.40.17 (second type); lnuch.40.9 and lnuch.40.14 (third type); lnuch.40.12 and lnuch.40.13 (fourth type); and lnuch.40.10 (fifth type). See Table 1 for more information. Left and right flanking lanes are 1-kb and 100-bp size markers, respectively.

Limited incidence of symbiont strain "sharing."
Previously, for adult leiognathids, we found that the same symbiont strain type was only rarely present in light organs of different fish, even for specimens of the same host species collected at the same time and location (16). This limited symbiont "sharing" suggests that the different strain type or types are not specific to individual host species. However, relatively few host specimens of the same species from the same time and place have been analyzed, leaving open the possibility that the appearance of limited strain "sharing" can be explained by small sample size. It is also possible that the different specimens of the fish examined previously acquired their symbiotic bacteria from different locations, each with different P. leiognathi strain types present.

With the many specimens of larval N. nuchalis collected from the same location over the course of a few days, we were able to avoid these caveats. The DNA fingerprinting analyses (rep-PCR gels) of symbiont populations of individual larval N. nuchalis, as well as those of juveniles and adults, were examined visually to identify strains from different host specimens that appeared similar. The genomic DNA of those strains was then reanalyzed together on a single rep-PCR gel to facilitate side-by-side comparisons between pairs or groups of strains deemed similar to each other (Fig. 5). This analysis revealed that symbiont strain "sharing" was rare; each symbiont population was composed almost always of completely different strains. Only a single strain type was found to be present in light organs of more than one fish, represented by strains lnuch.31.1, lnuch.34.16, and lnuch.36.1 from larvae caught on 1 August and lnuch.28.12 from an adult fish caught using a gill net on 30 July. This strain type accounted for 45% of the 55 examined strains from these four host specimens. In all other cases, the apparent similarity of strains from different fish specimens was not supported by direct side-by-side comparisons of the genomic fingerprints (Fig. 5); although similar in DNA fingerprints, the other compared strains were genomotypically distinct. These results confirmed the earlier finding of limited symbiont "sharing" among adult leiognathids (16) and extended that finding to multiple specimens of a single host species near inception of the symbiosis and collected from the same general location within a span of a few days. These results therefore affirm the view that colonization of the fish's light organ appears to be random with respect to symbiont strain type (16).

View larger version (44K): [in this window] [in a new window]

FIG. 5. DNA fingerprint (rep-PCR) analysis of strains deemed genomotypically similar from light organs of different N. nuchalis specimens. White bars indicate pairs or groups of strains identified by visual comparison of DNA fingerprints of individual larval, juvenile, and adult symbiont populations (see Fig. 4 and Table 1 for an example and additional details) as possibly similar to each other and reexamined here in side-by-side comparisons to test for identity. Only strains lnuch.31.1, lnuch.34.16, lnuch.36.1 (from larvae), and lnuch.28.12 (from an adult fish) were confirmed here as identical in DNA fingerprint; all other examined strains differed by one or more bands. Left and right flanking lanes are 100-bp size markers.

Incidence of lux-rib merodiploid strains.
In addition to the genetic diversity in P. leiognathi described above, many strains of this species also carry multiple copies of the lux-rib operon, an unusual case of merodiploidy in bacteria (4). Most of the strains examined previously and found to be merodiploid for the lux-rib operon were isolated from light organs of adult leiognathid fish, but whether merodiploidy might relate in some way to symbiosis is not known. To gain insight on this issue, we compared the incidence of merodiploid strains in light organs of larval, juvenile, and adult N. nuchalis. The chromatogram of the luxA gene sequence for each strain type was examined for multiple discrete peaks, which are diagnostic of lux-rib merodiploidy (4). We found that 170 of the 249 strains from the 16 examined larvae carried a single lux-rib operon whereas 79 strains were merodiploid (Table 1), a ratio of 2.2 to 1. Light organs of juveniles and adults also carried merodiploid strains. Adult specimens of N. nuchalis, however, had a much higher proportion of merodiploid strains than larvae. Of 91 strains from five adult specimens, 16 carried a single lux-rib operon whereas 75 were merodiploid (Table 1), a ratio of 1 to 4.7. These results suggest that the proportion of strains carrying multiple lux-rib operons increases as the symbiosis matures.

Occurrence of Vibrio harveyi in light organ symbiosis.
Light organs of most specimens of leiognathid fish carry only P. leiognathi (12, 16, 43; this study). Although highly specific, however, the association is not strictly exclusive to P. leiognathi; some leiognathids also harbor P. mandapamensis together with P. leiognathi (26). Here we found that platings of the light organ homogenate of one of the larval N. nuchalis specimens, lnuch.41, yielded luminous colonies of two different kinds, suggesting the presence of two bacterial species. The more-numerous kind was typical of the bacteria from light organs of other larval, juvenile, and adult leiognathid fish in colony morphology, luminescence color and intensity, lack of distinctive pigmentation, and absence of a strong odor; representatives of this kind were identified as P. leiognathi by luxA sequence analysis (Table 1). The less-numerous kind, present at approximately 15% of the total number of colonies, formed large, rapidly growing colonies of a bluer color of luminescence (compared to the more blue-green color of luminescence of P. leiognathi colonies). When strains of this kind were grown in pure culture, the colonies developed a diffusible brown pigment over time and produced a strong, putrid odor. The traits of rapid growth, blue luminescence, brown pigment, and putrid odor are characteristic of V. harveyi and related bacteria (8; P. V. Dunlap, personal observation). Twenty strains of this kind were isolated and characterized by rep-PCR DNA fingerprinting; all were genomotypically identical (data not shown). The luxA gene from two of these strains, lunch.41.H1 and lunch.41.H2, was sequenced, and analysis of those sequences identified the strains as V. harveyi (Table 1). The high incidence of strains of this kind, their luminescence, and their genomotypic uniformity are characteristic of bacteria from light organs (e.g., see references 13 and 16); they therefore are not likely to be chance contaminants arising from the gut tract. This is the first indication that V. harveyi, a bacterial species not known to be a bioluminescent symbiont, apparently can occur in the light organ habitat.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The developmental and microbiological events surrounding inception of symbiosis are central to understanding how luminous fish establish their bioluminescent associations. Here, for the leiognathid fish N. nuchalis, we show that light organ ontogeny is initiated early in development of the fish and apparently precedes acquisition of the bacteria. Microbiologically, we show that the symbiosis is initiated by multiple, genetically distinct strains of P. leiognathi, that the same strain types are only rarely found in light organs of different host specimens, and that the association, although highly specific for P. leiognathi, is not completely exclusive of other bacteria. Because this study is based on wild-caught specimens of the fish, the results and observations reported here also provide insight into life history traits of the fish that may be critical for continuity of the association.

For other bacterially luminous fish, analysis of early developmental stages has been limited to microscopy of a few experimentally reared or wild-caught specimens. Larvae from experimentally fertilized eggs of Monocentris japonica (Beryciformes: Monocentridae) were reared for 3 weeks, to a 6-mm total length, at which point they had not yet developed their mandibular light organs (52). Incipient subocular light organs were observed in 4.1-mm-NL flexion and 5.8-mm-SL postflexion larvae of Anomalops katoptron (Beryciformes: Anomalopidae) from the plankton (28) and in a wild-caught 6.2-mm-NL flexion larva of Kryptophaneron alfredi (Beryciformes: Anomalopidae) (6). A perianal light organ was evident in preflexion and flexion larvae of Paratrachichthys and Aulotrachichthys (Beryciformes: Trachichthyidae) collected from the plankton (25). In these studies, the possible presence of bacteria was not reported. Bacteria were mentioned in other studies, however. A nascent supraesophageal light organ with a low number of bacteria and an interface with the gasbladder was evident in a 9.8-mm-total-length wild-caught specimen of Equula (Perciformes: Leiognathidae) (19). Bacterial colonization of the nascent ventral light organ of larvae of Siphamia versicolor (Perciformes: Apogonidae) from the plankton was not evident in 2.4-mm- and 2.8-mm-NL preflexion specimens but was noted for a 3.5-mm-SL flexion specimen (31). In the nascent escal light organs of two wild-caught specimens of Melanocetus murrayi (Lophiiformes: Melanocetidae), bacteria were apparently absent from the light organ of the smaller specimen (18.5 mm in SL) but were present in the light organ of the larger specimen (36.0 mm in SL), and the presence of bacteria in the larger specimen correlated with formation of a duct connecting the light organ to the environment (38). Juveniles of N. nuchalis, reared from experimentally fertilized eggs, apparently were aposymbiotic and were able to initiate the symbiosis when presented with P. leiognathi (51). In general, these studies indicate that ontogeny of light organs in various bacterially luminous fish begins early in fish development, in most cases apparently during preflexion or flexion stages. They suggest also that initiation of light organ ontogeny precedes colonization by the symbiotic bacteria, which presumably are acquired from the environment.

The limited information on fish contrasts with an extensive literature from laboratory studies of the bacterially luminous squid, Euprymna scolopes (Sepiolida: Sepiolidae), in which developmental events both during bacterial colonization and in the absence of bacterial colonization have been investigated in detail (e.g., see references 10, 36, 44, and 45). Nonetheless, the results presented here on N. nuchalis indicate major differences with E. scolopes. The squid, which harbors A. fischeri as its symbiont, undergoes direct development, with embryos hatching as juveniles, which are morphologically similar to adults (10, 36), whereas the fish undergoes indirect development, passing through a series of developmental steps, i.e., postembryo and preflexion, flexion, and postflexion larval stages, before attaining the juvenile stage. Shortly after hatching, the squid acquires its symbiotic bacteria, whereas the work presented here indicates that the fish apparently initiates symbiosis several days after hatching, after substantial posthatching development has occurred. Another difference is ecological; the squid hatches into the habitat where the adult squid live and therefore encounters bacteria presumably released from the local population of adult squids (29, 30, 45). In contrast, the fish apparently hatches some distance from locations where adults live and to initiate symbiosis must migrate inshore, to a habitat where its symbiotic bacteria are more abundant (discussed below).

In flexion and postflexion larvae of N. nuchalis, the light organ system is at an early stage of development. We estimated the age of a 6.5-mm-SL postflexion larva at approximately 19 days posthatch based on the presence of 19 incremental rings on its otoliths and assuming the rings are formed daily. The nascent light organ in fish of this size is rudimentary in overall structure compared to that of adult fish (1, 7, 19), and tissue forming it appears to be undergoing active growth, with new tubules being formed, many of which apparently are not yet colonized by bacteria. Organs closely associated with the light organ also are early in development. The stomach, which develops just posterior to the light organ, has not yet differentiated in fish of this size, and the nascent gasbladder, a key component of the leiognathid light organ system, is small and has not established the interface with the light organ that is characteristic of the mature symbiosis (1, 15, 19, 32, 33). The apparent absence of bacteria in light organs of the smaller flexion larvae of N. nuchalis indicates that inception of the symbiosis most likely occurs at a host size of 6.0 to 6.5 mm in NL and that initiation of light organ ontogeny precedes bacterial colonization.

The high degree of species-level specificity of P. leiognathi for leiognathid fish contrasts with the substantial population genetic diversity of this bacterium and the absence of bacterial strain-host species specificity (12, 16, 26, 43; this study). Symbiont populations in light organs of individual leiognathid fish are typically composed of multiple genetically distinct strain types. However, the same strain type occurs only rarely in light organs of different fish specimens, even for specimens of the same host species collected close to inception of the symbiosis and from the same location within a few days (16; this study). The absence of host species-related strain specificity is consistent with the lack of congruence between the phylogenies of leiognathid fish and their light organ bacteria (17), and the rareness with which the same strain type is found in light organs of different fish specimens (16; this study) suggests the presence of extensive genetic diversity in the global population of P. leiognathi. In this regard, the similar levels of symbiont diversity in adults and in larvae indicate that the symbiosis commonly is initiated by multiple, genetically distinct bacteria; it is not necessary to invoke secondary colonization to explain symbiont population diversity in light organs of adult fish (16). Colonization of the nascent N. nuchalis light organ therefore appears to be random with respect to P. leiognathi strain type, with aposymbiotic flexion larvae typically picking up two, three, or more different representatives of the many different strain types present in their local environment. These strains serve as founders of the symbiont population.

Whether changes occur over time in the strain composition of light organ populations of individual specimens of N. nuchalis is an open question. The complex microarchitecture of the light organ of adults, with heavily colonized tubules, efflux of excess bacterial cells from the tubules into collecting chambers, and ducts connecting the chambers to the esophagus (1, 7, 11, 19), suggests that secondary colonization may not occur. Competition among founding strains could alter the strain composition of the light organ over time, but the diversity of strains in light organs of adults, the similar levels of strain diversity in larvae and adults, and the lack of host species-related strain specificity do not appear to be consistent with a competitive succession of strain types. Clonal divergence could lead to a change in population structure, but an experimental test for clonal divergence of a strain of P. leiognathi under laboratory conditions found no detectable change in the DNA fingerprint after approximately 400 generations (4). In this regard, the higher proportion of lux-rib merodiploid strains in adults compared to larvae is intriguing, since it might result from transposon-mediated transfer of the second lux-rib operon among strains in the symbiosis, leading to an increasing proportion of strains that are merodiploid as the symbiosis matures (4). Alternatively, merodiploid strains might have a competitive advantage in the symbiosis (4), coming to proportionally dominate a population over time. A small sample size might also be a factor, and additional work will be necessary to distinguish among these possibilities.

The identification of V. harveyi in the light organ of a specimen of N. nuchalis is unexpected. This bacterial species had not been isolated from the light organ habitat previously, and its interactions with marine animals often are pathogenic (8, 14, 22). Whether this instance represents a rare occurrence or a more common interaction is not known, but the presence of V. harveyi in coastal waters where larvae of N. nuchalis occur (49) indicates the opportunity for this bacterium to encounter fish whose nascent light organs are in the process of being colonized. One possibility is that V. harveyi is acquired only infrequently by larvae of N. nuchalis and that the pathogenicity of this bacterium leads to death of the fish; as a consequence, larvae that have taken up this bacterium into their nascent light organs would be short-lived and therefore only rarely found. An alternative possibility is that the light organs of larval N. nuchalis sometimes are colonized by V. harveyi, which gains a temporary foothold in the light organ but is outcompeted by P. leiognathi as the light organ develops and the symbiosis matures. Regardless, the finding of V. harveyi in the light organ of a larval specimen of N. nuchalis is a further indication (26) that leiognathid light organs are not the exclusive, species-specific habitat of P. leiognathi.

Although little is known about the early life history of any bacterially luminous fish, information of this kind is central to understanding the ecological interactions between host and symbiont that ensure continuity of the association in new host generations. Particularly important is knowledge of the habitat in which the symbiosis begins, because larval stages of the fish may acquire their species and strains of symbiont in a habitat very different microbiologically from where adults are collected. In this regard, information on the life history of N. nuchalis in Suruga Bay is accumulating and leads to the following scenario. Adult N. nuchalis fish are demersal, occurring along the bottom in relatively shallow areas of the bay, typically down to an approximately 20-m depth. The adults spawn in this habitat. Currents then disperse the fertilized eggs, which are planktonic and separate (18), out into the open waters of the bay, up to 1 to 2 kilometers offshore, where the embryos hatch and larval development begins. The preflexion larvae, which presumably are aposymbiotic, then migrate inshore over the next 15 to 20 days as they develop. When they reach the wave zone along the shoreline, as flexion larvae of approximately 6 to 6.5 mm in NL, they acquire their symbiotic bacteria and initiate the symbiosis. They continue to develop in this habitat into the postflexion and early juvenile stages. As larger juveniles, they migrate along the bottom away from the wave zone, ultimately taking up demersal existence as adults in deeper water.

In support of this scenario, preflexion larvae of N. nuchalis ranging in size from 1.6 to 4.3 mm in NL have been collected by plankton tows offshore in open waters of Suruga Bay, whereas flexion and postflexion larvae and early juveniles are found in the wave zone and typically range from 6 to 10 mm in length (rarely less than 6 mm in NL and infrequently greater than 10 mm in SL) (M. Fujino, S. Tomiyama, and A. Fukui, unpublished data). Furthermore, P. leiognathi is readily found in the wave zone along the shoreline in Suruga Bay (49), but its incidence in offshore waters of the bay appears to be very low (K. Davis, P. V. Dunlap and A. Fukui, unpublished data). Thus, migration of aposymbiotic larvae from open waters of the bay to the wave zone along the shoreline, where the fish apparently acquires its symbiont, may be a part of the life history of this fish that is critical to continuity of the bioluminescent symbiosis. However, the ontological status and process of development of the nascent light organ in preflexion larvae of the fish have not yet been described. Therefore, although this scenario is supported by some preliminary data, testing it will require a more detailed understanding of the incidence of preflexion larvae in Suruga Bay and the developmental and microbiological status of the nascent light organs of these host specimens.

 
We thank H. Ichikawa and K. Watanabe for assistance with beach seining, K. Kimura for the gift of adult specimens of N. nuchalis, J. Ast for advice and guidance in DNA sequence analysis, and S. Meshinchi for carrying out the TEM. DNA sequencing was carried out by staff of the University of Michigan Sequencing Core.

This work was supported by grant DEB 0413441 from the National Science Foundation.

 
* Corresponding author. Mailing address: University of Michigan, Department of Ecology and Evolutionary Biology, 830 North University Avenue, Ann Arbor, MI 48109-1048. Phone: (734) 615-9099. Fax: (734) 763-0544. E-mail: pvdunlap{at}umich.edu

Published ahead of print on 31 October 2008.

Present address: Department of Microbiology, University of Pennsylvania, Philadelphia, PA 19104.

Present address: Marine Science Museum, Social Education Center, Tokai University, Miho, Shimizu, Shizuoka 424-8620, Japan.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Ahrens, G. 1965. Untersuchungen am Leuchtorgan von Leiognathus klunzingeri (Steindachner). Z. Wiss. Zool. 173:90-113.
2
2. Ast, J. C., and P. V. Dunlap. 2004. Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi. Arch. Microbiol. 181:352-361.[CrossRef][Medline]
3
3. Ast, J. C., and P. V. Dunlap. 2005. Phylogenetic resolution and habitat specificity of members of the Photobacterium phosphoreum species group. Environ. Microbiol. 7:1641-1654.[CrossRef][Medline]
4
4. Ast, J. C., H. Urbanczyk, and P. V. Dunlap. 2007. Natural merodiploidy of the lux-rib operon of Photobacterium leiognathi from coastal waters of Honshu, Japan. J. Bacteriol. 189:6148-6158.[Abstract/Free Full Text]
5
5. Ast, J. C., I. Cleenwerck, K. Engelbeen, H. Urbanczyk, F. L. Thompson, P. De Vos, and P. V. Dunlap. 2007. Photobacterium kishitanii sp. nov., a luminous marine bacterium symbiotic with deep-sea fish. Int. J. Syst. Evol. Microbiol. 57:2073-2078.[Abstract/Free Full Text]
6
6. Baldwin, C. C., and G. D. Johnson. 1995. A larva of the Atlantic flashlight fish, Kryptophaneron alfredi (Beryciformes: Anomalopidae), with a comparison of beryciform and stephanoberyciform larvae. Bull. Mar. Sci. 56:1-24.
7
7. Bassot, J.-M. 1975. Les organes lumineux a bactéries symbiotiques de quelques Téléostéens leiognathides. Arch. Zool. Exp. Gen. 116:359-373.
8
8. Baumann, P., and R. H. Schubert. 1984. Family II. Vibrionaceae Veron 1965, p. 516-548. In N. R. Kreig and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, 1st ed., vol. 1. Williams & Wilkins, Baltimore, MD.
9
9. Boisvert, H., R. Chatelain, and J.-M. Bassot. 1967. Étude d'un Photobacterium isolé de l'organe lumineux des poissons Leiognathidae. Ann. Inst. Pasteur (Paris) 112:520-524.
10
10. Claes, M. F., and P. V. Dunlap. 2000. Aposymbiotic culture of the sepiolid squid Euprymna scolopes: role of the symbiotic bacterium Vibrio fischeri in host animal growth, development, and light organ morphogenesis. J. Exp. Zool. 286:280-296.[CrossRef][Medline]
11
11. Dunlap, P. V. 1984. Physiological and morphological state of the symbiotic bacteria from light organs of ponyfish. Biol. Bull. 167:410-425.[Abstract/Free Full Text]
12
12. Dunlap, P. V. 1985. Osmotic control of luminescence and growth in Photobacterium leiognathi from ponyfish light organs. Arch. Microbiol. 141:44-50.[CrossRef][Medline]
13
13. Dunlap, P. V., and J. C. Ast. 2005. Genomic and phylogenetic characterization of luminous bacteria symbiotic with the deep-sea fish Chlorophthalmus albatrossis (Aulopiformes: Chlorophthalmidae). Appl. Environ. Microbiol. 71:930-939.[Abstract/Free Full Text]
14
14. Dunlap, P. V., and K. Kita-Tsukamoto. 2006. Luminous bacteria, p. 863-892. In M. Dworkin, S. Falkow, E. Rosenberg, K.-H. Schleifer, and E. Stackebrandt (ed.), The prokaryotes: a handbook on the biology of bacteria, 3rd ed., vol. 2. Ecophysiology and biochemistry. Springer-Verlag, New York, NY.
15
15. Dunlap. P. V., and M. J. McFall-Ngai. 1987. Initiation and control of the bioluminescent symbiosis between Photobacterium leiognathi and leiognathid fish. Ann. N. Y. Acad. Sci. 503:269-283.[Medline]
16
16. Dunlap, P. V., A. Jiemjit, J. C. Ast, M. M. Pearce, R. R. Marques, and C. R. Lavilla-Pitogo. 2004. Genomic polymorphism in symbiotic populations of Photobacterium leiognathi. Environ. Microbiol. 6:145-158.[CrossRef][Medline]
17
17. Dunlap, P. V., J. C. Ast, S. Kimura, A. Fukui, T. Yoshino, and H. Endo. 2007. Phylogenetic analysis of host-symbiont specificity and codivergence in bioluminescent symbioses. Cladistics 23:507-532.
18
18. Fujita, S. 1960. Egg development and prelarval stages of development of a silver belly, Leiognathus nuchalis. Bull. Jpn. Soc. Sci. Fish. 26:1091-1094.
19
19. Harms, J. W. 1928. Bau und entwicklung eines eigenartigen leuchtorgans bei Equula spec. Z. Wiss. Zool. 131:157-179.
20
20. Hastings, J. W. 1971. Light to hide by: ventral luminescence to camouflage the silhouette. Science 173:1016-1017.[Abstract/Free Full Text]
21
21. Hastings, J. W., and G. Mitchell. 1971. Endosymbiotic bioluminescent bacteria from the light organ of pony fish. Biol. Bull. 141:261-268.[Free Full Text]
22
22. Hastings, J. W., and K. H. Nealson. 1981. The symbiotic luminous bacteria, p. 1332-1345. In M. P. Starr, H. Stolp, H. G. Trüper, A. Balows, and H. G. Schlegel (ed.), The prokaryotes: a handbook on habitats, isolation, and identification of bacteria. Springer-Verlag, Berlin, Germany.
23
23. Haygood, M. G., B. M. Tebo, and K. H. Nealson. 1984. Luminous bacteria of a monocentrid fish (Monocentris japonicus) and two anomalopid fish (Photoblepharon palpebratus and Kryptophaneron alfredi): population sizes and growth within the light organs, and rates of release into the seawater. Mar. Biol. 78:249-254.
24
24. Herring, P. J., and J. G. Morin. 1978. Bioluminescence in fish, p. 273-329. In P. J. Herring (ed.), Bioluminescence in action. Academic Press, London, United Kingdom.
25
25. Jordan, A. R., and B. D. Bruce. 1993. Larval development of three roughy species complexes (Pisces: Trachichthyidae) from southern Australian waters, with comments on the occurrence of orange roughy Hoplostethus atlanticus. Fish. Bull. U. S. 91:76-86.
26
26. Kaeding, A. J., J. C. Ast, M. M. Pearce, H. Urbanczyk, S. Kimura, H. Endo, M. Nakamura, and P. V. Dunlap. 2007. Phylogenetic diversity and co-symbiosis in the bioluminescent symbioses of Photobacterium mandapamensis. Appl. Environ. Microbiol. 73:3173-3182.[Abstract/Free Full Text]
27
27. Kimura, S., R. Kimura, and K. Ikejima. 2008. Revision of the genus Nuchequula with descriptions of three new species (Perciformes: Leiognathidae). Ichthyol. Res. 55:22-42.
28
28. Konishi, Y., and M. Okiyama. 1997. Morphological development of four trachichthyid larvae (Pisces: Beryciformes), with comments on trachichthyoid relationships. Bull. Mar. Sci. 60:66-88.
29
29. Lee, K.-H., and E. G. Ruby. 1994. Competition between Vibrio fischeri strains during initiation and maintenance of a light organ symbiosis. J. Bacteriol. 176:1985-1991.[Abstract/Free Full Text]
30
30. Lee, K.-H., and E. G. Ruby. 1995. Symbiotic role of the viable by nonculturable state of Vibrio fischeri in Hawaiian coastal seawater. Appl. Environ. Microbiol. 61:278-283.[Abstract]
31
31. Leis, J. M., and S. Bullock. 1986. The luminous cardinalfish Siphamia (Pisces, Apogonidae): development of larvae and the luminous organ, p. 703-714. In T. Uyeno, R. Arai, T. Taniuchi, and K. Matsuura (ed.), Indo-Pacific fish biology: proceedings of the second international conference on Indo-Pacific fish. Ichthyological Society of Japan, Tokyo.
32
32. McFall-Ngai, M. J. 1983. Adaptation for reflection of bioluminescent light in the gasbladder of Leiognathus equulus (Perciformes: Leiognathidae). J. Exp. Zool. 227:23-33.[Medline]
33
33. McFall-Ngai, M. J. 1983. The gasbladder as a central component of the leiognathid bacterial light organ symbiosis. Am. Zool. 23:907.
34
34. McFall-Ngai, M. J., and P. V. Dunlap. 1983. Three new modes of luminescence in the leiognathid fish Gazza minuta (Perciformes: Leiognathidae): discrete projected luminescence, ventral body flash and buccal luminescence. Mar. Biol. 73:227-237.
35
35. McFall-Ngai, M. J., and J. G. Morin. 1991. Camouflage by disruptive illumination in leiognathids, a family of shallow-water, bioluminescent fish. J. Exp. Biol. 156:119-137.[Abstract/Free Full Text]
36
36. McFall-Ngai, M. J., and E. G. Ruby. 1991. Symbiont recognition and subsequent morphogenesis as early events in an animal-bacterial mutualism. Science 254:1491-1494.[Abstract/Free Full Text]
37
37. Morin, J. G., A. Harrington, K. Nealson, N. Krieger, T. O. Baldwin, and J. W. Hastings. 1975. Light for all reasons: versatility in the behavioral repertoire of the flashlight fish. Science 190:74-76.
38
38. Munk, O., K. Hansen, and P. J. Herring. 1998. On the development and structure of the escal light organ of some melanocetid deep sea anglerfish (Pisces: Ceratioidei). J. Mar. Biol. Assoc. U. K. 78:1321-1335.
39
39. Nealson, K. H. 1978. Isolation, identification and manipulation of luminous bacteria. Methods Enzymol. 57:153-166.
40
40. Nealson, K. H., and J. W. Hastings. 1991. The luminous bacteria, p. 625-639. In A. Balows, H. G. Trüper, M. Dworkin, W. Harder and K.-H. Schleifer (ed.), The prokaryotes. Springer-Verlag, New York, NY.
41
41. Nealson, K. H., M. G. Haygood, B. M. Tebo, M. Roman, E. Miller, and J. E. McCosker. 1984. Contribution of symbiotically luminous fish to the occurrence and bioluminescence of luminous bacteria in seawater. Microb. Ecol. 10:69-77.
42
42. Okiyama, M. (ed.) 1988. An atlas of early stage fish in Japan. Tokai University Press, Tokyo, Japan.
43
43. Reichelt, J. L., K. Nealson, and J. W. Hastings. 1977. The specificity of symbiosis: pony fish and luminescent bacteria. Arch. Microbiol. 112:157-161.[CrossRef]
44
44. Ruby, E. G. 1996. Lessons from a cooperative, bacterial-animal association: the Vibrio fischeri-Euprymna scolopes light organ symbiosis. Annu. Rev. Microbiol. 50:591-624.[CrossRef][Medline]
45
45. Ruby, E. G., and L. M. Asato. 1993. Growth and flagellation of Vibrio fischeri during initiation of the sepiolid squid light organ symbiosis. Arch. Microbiol. 159:160-167.[CrossRef][Medline]
46
46. Sasaki, A., K. Ikejima, S. Aoki, N. Azuma, N. Kashimura, and M. Wada. 2003. Field evidence for bioluminescent signaling in the pony fish, Leiognathus elongatus. Environ. Biol. Fish. 66:307-311.
47
47. Sparks, J. S., P. V. Dunlap, and W. L. Smith. 2005. Evolution and diversification of a sexually dimorphic luminescent system in ponyfish (Teleostei: Leiognathidae), including diagnoses for two new genera. Cladistics 21:305-327.[CrossRef]
48
48. Urbanczyk, H., J. C. Ast, M. J. Higgins, J. Carson, and P. V. Dunlap. 2007. Reclassification of Vibrio fischeri, Vibrio logei, Vibrio salmonicida and Vibrio wodanis as Aliivibrio fischeri gen. nov., comb. nov., Aliivibrio logei comb. nov., Aliivibrio salmonicida comb. nov., and Aliivibrio wodanis comb. nov. Int. J. Syst. Evol. Microbiol. 57:2823-2829.
49
49. Urbanczyk, H., J. C. Ast, A. J. Kaeding, J. D. Oliver, and P. V. Dunlap. 2008. Phylogenetic analysis of the incidence of lux gene horizontal transfer in Vibrionaceae. J. Bacteriol. 190:3494-3504.[Abstract/Free Full Text]
50
50. Versalovic, J., J. Schneider, F. J. de Bruijn, and J. R. Lupski. 1994. Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction. Methods Mol. Cell Biol. 5:25-40.
51
51. Wada, M., N. Azuma, N. Mizuno, and H. Kurokura. 1999. Transfer of symbiotic luminous bacteria from parental Leiognathus nuchalis to offspring. Mar. Biol. 135:683-687.
52
52. Yamada, K., M. Haygood, and H. Kabasawa. 1979. On fertilization and early development in the pine-cone fish, Monocentris japonicus. Ann. Rep. Keikyu Aburatsubo Mar. Park Aquar. 10:31-38.

---

Applied and Environmental Microbiology, December 2008, p. 7471-7481, Vol. 74, No. 24
0099-2240/08/$08.00+0     doi:10.1128/AEM.01619-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Dunlap, P. V. Articles by Fukui, A. Search for Related Content PubMed PubMed Citation Articles by Dunlap, P. V. Articles by Fukui, A. Agricola Articles by Dunlap, P. V. Articles by Fukui, A.