Previous Article | Next Article 
Applied and Environmental Microbiology, February 2008, p. 753-761, Vol. 74, No. 3
0099-2240/08/$08.00+0 doi:10.1128/AEM.01944-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
The Type II Secretion System of Legionella pneumophila Elaborates Two Aminopeptidases, as Well as a Metalloprotease That Contributes to Differential Infection among Protozoan Hosts
Ombeline Rossier,
Jenny Dao, and
Nicholas P. Cianciotto*
Department of Microbiology-Immunology, Northwestern University Medical School, Chicago, Illinois 60611
Received 23 August 2007/
Accepted 29 November 2007

ABSTRACT
Legionella pneumophila, the agent of Legionnaires' disease,
is an intracellular parasite of aquatic amoebae and human macrophages.
A key factor for
L. pneumophila in intracellular infection is
its type II protein secretion system (Lsp). In order to more
completely define Lsp output, we recently performed a proteomic
analysis of culture supernatants. Based upon the predictions
of that analysis, we found that
L. pneumophila secretes two
distinct aminopeptidase activities encoded by the genes
lapA and
lapB. Whereas
lapA conferred activity against leucine, phenylalanine,
and tyrosine aminopeptides,
lapB was linked to the cleavage
of lysine- and arginine-containing substrates. To assess the
role of secreted aminopeptidases in intracellular infection,
we examined the relative abilities of
lapA and
lapB mutants
to infect human U937 cell macrophages as well as
Hartmannella vermiformis and
Acanthamoeba castellanii amoebae. Although these
experiments identified a dispensable role for LapA and LapB,
they uncovered a previously unrecognized role for the type II-dependent
ProA (MspA) metalloprotease. Whereas
proA mutants were not defective
for macrophage or
A. castellanii infection, they (but not their
complemented derivatives) were impaired for growth upon coculture
with
H. vermiformis. Thus, ProA represents the first type II
effector implicated in an intracellular infection event. Furthermore,
proA represents an
L. pneumophila gene that shows differential
importance among protozoan infection models, suggesting that
the legionellae might have evolved some of its factors to especially
target certain of their protozoan hosts.

INTRODUCTION
Legionella pneumophila is the agent of Legionnaires' disease
pneumonia (
29). In fresh waters, this gram-negative bacterium
exists in protozoan hosts and as a part of biofilms. Disease
occurs when inhaled legionellae, possibly including those still
associated with protozoa or protozoan vesicles (
11,
12), invade
alveolar macrophages. Although many factors promote the ecology
and pathogenesis of
L. pneumophila, protein secretion stands
out for its multifaceted significance.
L. pneumophila possesses
type II secretion, type IVB secretion, and type IVA secretion
(
7,
17), and genome sequencing suggests the existence of type
I and type V secretion systems (
14,
40). Among these pathways,
the Lsp type II system is arguably implicated in the broadest
array of phenotypes (
17). Indeed, this pathway is required for
secretion during growth in bacteriologic media at 37°C,
extracellular survival in broth/water at 12 to 25°C, colony
morphology, intracellular infection of protozoa (acanthamoebae
and hartmannellae), optimal intracellular infection of human
macrophages and monocytes, and virulence in a murine model of
pneumonia (
37,
44,
55,
61,
62,
68,
69). Although type II secretion
exists in many gram-negative organisms, including various animal
and plant pathogens,
L. pneumophila is the only intracellular
pathogen known to possess a functional type II system (
17).
Type II secretion is a two-step process in which nascent proteins
are first translocated across the inner membrane and then, after
what might be a very short period, are transported from the
periplasm to the exterior through a dedicated outer membrane
pore (
42). In
Pseudomonas aeruginosa and
L. pneumophila, the
transport of type II substrates across the inner membrane is
mediated by the Sec or Tat pathway (
42,
60). Proteins secreted
via the
L. pneumophila type II system were first identified
by enzymatic activities in wild-type but not
lsp mutant culture
supernatants, i.e., a metalloprotease, acid phosphatases, lipases,
phospholipase A, phospholipase C, lysophospholipase A, cholesterol
acyltransferase, and RNase (
2-
4,
8,
22,
30,
31,
37,
44,
61,
62). A two-dimensional polyacrylamide gel electrophoresis comparison
of wild-type and
lsp mutant supernatants then showed that the
type II secretome includes at least 25 proteins (
23). Among
the new proteins are (i) a chitinase that promotes persistence
in lungs, (ii) proteins predicted to have aminopeptidase, cellulase,
nucleotidase, or decarboxylase activity, (iii) proteins that
show their greatest similarity to eukaryotic proteins, and (iv)
proteins with no homology to known proteins. In silico analysis
of the
L. pneumophila genome suggested that the type II secretome
may actually encompass as many as 60 proteins (
23).
For many years, it has been known that amino acids are the main carbon and energy source for growing legionellae (74), and early reports described a variety of secreted aminopeptidase and protease activities in L. pneumophila culture supernatants (10, 20, 25, 36, 53, 54, 75). However, the genes responsible for the production and secretion of these activities have remained unknown, other than the loci associated with the above-mentioned metalloprotease, which is variously known as ProA or MspA (37, 44, 50, 57, 73). By cloning two proteins identified in our proteomic screen and characterizing new mutants, we now show that L. pneumophila does secrete aminopeptidases through its type II system. While examining the role of the aminopeptidases, we also discovered that ProA promotes L. pneumophila infection of Hartmannella vermiformis amoebae, an issue that was not addressed in earlier studies on that exoprotein (51, 73).

MATERIALS AND METHODS
Strains, growth media, and chemicals.
L. pneumophila strain 130b (ATCC strain BAA-74, also known as
AA100 or Wadsworth) served as our wild type (
27). Mutants of
130b containing a kanamycin resistance (Km
r) cassette inserted
into
lspF (NU275) or
proA (AA200) as well as a complemented
lspF mutant were previously described (
51,
62). Legionellae
were routinely cultured in buffered yeast extract (BYE) broth
or on buffered charcoal yeast extract (BCYE) agar (
62). Growth
in broth was assessed by measuring the optical density of the
culture at 660 nm.
Escherichia coli DH5

and DH5
pir (Invitrogen,
Carlsbad, CA), hosts for recombinant plasmids, were grown on
LB agar (
6). Antibiotics were added to media at the following
concentrations (in µg per ml): ampicillin, 100; chloramphenicol
(Cm), 6 for
L. pneumophila and 30 for
E. coli; gentamicin, 2.5;
kanamycin, 25 for
L. pneumophila and 50 for
E. coli. Chemicals
were purchased from Sigma-Aldrich (St. Louis, MO).
Sequence analysis, gene cloning, and mutant constructions.
DNA and protein sequences were analyzed using Lasergene software (DNASTAR, Madison, WI). The Clustal method of Lasergene Megalign was used for protein alignments. Database searches were done using programs based on the BLAST algorithm (1). Genomic DNA was isolated from L. pneumophila as described previously (18). Based on data from the L. pneumophila strain Paris genome (14), pairs of primers were designed for amplifying genes from 130b DNA. Primers OR140lpp2866 (5'-CAGGCTTGCTCCAACAGTTA) and OR141lpp2866 (5'-CTCTAACCGACGACGCTAAT) yielded a 1,879-bp fragment containing lapA, and primers OR142lpp0031 (5'-TCCTGCGAGAACGTGATGAA) and OR143lpp0031 (5'-AGATTGCAAGTCACTCGCTG) yielded a 1,957-bp fragment for lapB. Primers were obtained from Integrated DNA Technologies (Coralville, IA). To facilitate construction of L. pneumophila mutants, the PCR fragments encoding lapA and lapB were ligated into pGem-T Easy (Promega, Madison, WI), yielding plasmids pGlapA and pGlapB, respectively. pGlapA was digested with MfeI, which cuts 91 bp after the lapA start codon, and MscI, which cuts 245 bp before the end of the gene, and then, after Klenow treatment, was ligated to a Kmr gene isolated from pMB2190 upon HincII digestion (34) to yield pGlapA::Km. Next, a SphI-XbaI fragment of pGlapA::Km containing the disrupted gene was cloned into the Cmr, sacB-containing suicide vector pRE112 (26), to give pRlapA::Km. pGlapB was digested with BstBI, which cuts 383 bp after the lapB start codon, and then, after Klenow treatment, was ligated to a gentamicin resistance (Gmr) gene isolated from pX1918GT after HincII and PvuII digestion (65) to give pGlapB::Gm. Following a SphI digest of pGlapB::Gm, disrupted lapB was cloned into pRE112, yielding pRlapB::Gm. L. pneumophila was transformed with plasmids by electroporation as previously described (19). Following electroporation of pRlapA::Km and pRlapB::Gm into strain 130b, mutants were selected based on Cm sensitivity, sucrose resistance, and Kmr (pRlapA::Km) or Gmr (pRlapB::Gm), indicative of the introduction of the mutated gene into the chromosome and loss of the pRE112 vector by allelic exchange. To construct a lapA lapB double mutant, a Gmr lapB mutant was electroporated with pRlapA::Km. To mutate proA, Kmr-disrupted proA from strain AA200 was amplified using primers OR115lipA (5'-GGCATGGTCATTCTTCACAC) and OR121proA (5'-GTGCACCAGATAATTCCGTC). The PCR fragment was then cloned into pGem-T Easy to give pGproA::Km. The latter plasmid was digested with NotI, and then, after Klenow treatment, the fragment encoding the disrupted gene was ligated into the SmaI site of plasmid pRE112, yielding pRproA::Km. To make a lapB proA double mutant, a Gmr lapB mutant was electroporated with pRproA::Km. Verification of mutant genotypes was carried out by PCR (data not shown).
Complementation analysis.
To facilitate complementation of the proA mutant, a 3,297-bp fragment specifically containing proA was amplified by PCR from strain 130b DNA using primers OR115lipA and OR121proA and then subcloned into pGem-T Easy. Following a SphI digest of the resulting plasmid, proA was cloned under the control of the tac promoter in pMMB2002 (62), yielding pMproA. To confirm expression from this construct, we observed that pMproA restored the ability of AA200 to degrade casein. For complementation of the lapB mutant, a 1,729-bp fragment specifically containing lapB was amplified by PCR from strain 130b DNA using primers JDlapBfr (5'-CGTTCAAG ATCATCGAGCTATTCCATAG) and JDlapBrv (5'-TCCCTAACAAAAAAATGGATA GCAAGAG) and then subcloned into pGem-T Easy. Following a SalI and SphI digest of the resulting plasmid, lapB was directionally cloned under the control of the tac promoter in pMMB2002, yielding pMlapB. Confirmation of this final construct was done by PCR using primers OR77pMMB2002 (5'-TCGGCTCGTATAATGTGTGG) and JDlapBrv.
Analysis of L. pneumophila-secreted enzymatic activities.
Cell-free, filter-sterilized supernatants were obtained from L. pneumophila cultures grown in BYE broth to late log phase (3). Leucine and lysine aminopeptidase activities were assayed by following the release of p-nitroanilide (pNI) from L-leucine p-NI (Leu-pNI) and L-lysine p-NI (Lys-pNI), respectively (13, 36, 56, 70). Briefly, 20 µl of sample was added to 180 µl of assay buffer (50 mM Tris-HCl [pH 8], 100 mM NaCl, 1 mM CaCl2) containing 3 mM Leu-pNI or Lys-pNI, and then the increase in absorbance at 405 nm was monitored over time of incubation at 37°C (SpectraMAX 190; Molecular Devices, Sunnyvale, CA). Alanine, arginine, cystine, phenylalanine, and tyrosine aminopeptidase activities were assayed by following the release of β-naphthylamide (βNA) from L-alanine-βNA (L-Ala-βNA), L-arginine-βNA (L-Arg-βNA), L-cystine di-βNA (L-Cys-βNA), L-phenylalanine-βNA (L-Phe-βNA), and L-tyrosine-βNA (L-Tyr-βNA), respectively (53, 54). A 10-µl aliquot of sample was added to 190 µl of 0.1 M phosphate buffer (pH 6.8) and then, to start the reaction, 3 mM of the amino acid-βNA substrate was added in a volume of 100 µl. Upon incubation at 37°C, released βNA was recorded fluorometrically (SpectraMAX GeminiXS; Molecular Devices) over time at 410 nm with an excitation wavelength of 340 nm (45, 66, 80). One unit of aminopeptidase was defined as that which yielded 1 µM of pNI or βNA in 1 min, based upon standard curves generated with pNA and pNI (66, 80). Protease activity was determined on casein agar, and acid phosphatases were monitored by the release of p-nitrophenol (p-NP) from p-NP phosphate (2, 3). RNase activity was assayed by monitoring the release of nucleotides from Baker's yeast type III RNA (62), and lipolytic activities were determined by p-NP palmitate and p-NP caprylate hydrolysis (3, 4).
Intracellular infection of protozoa and macrophages.
To examine the ability of L. pneumophila to grow in protozoa, H. vermiformis (ATCC strain 50237) and Acanthamoeba castellanii (ATCC 30234) were infected as previously described (19, 51, 77). Thus, ca. 104 CFU were added to wells containing 105 amoebae and then, at various times postinoculation, the numbers of bacteria per coculture were determined by plating dilutions on BCYE agar. To assess growth in macrophages, differentiated human U937 cells were infected as previously described (18, 62). Monolayers containing 106 macrophages were inoculated with 105 CFU, incubated for 2 h to allow bacterial entry, and then washed to remove unincorporated bacteria. At various times postinoculation, dilutions of saponin-lysed monolayers were plated on BCYE to determine the numbers of bacteria per monolayer.
Pulmonary infection of A/J mice with L. pneumophila.
As described before, female 6- to 8-week-old A/J mice (Jackson Lab, Bar Harbor, ME) were inoculated intratracheally with 25 µl of a bacterial suspension containing 106 CFU of a 1:1 ratio of wild-type and mutant strains (62). Three days later, infected lungs were homogenized, and the numbers of viable bacteria and the ratio of wild type to mutants were determined by plating dilutions on standard and antibiotic-supplemented BCYE (23, 62). Animal experiments were approved by the Animal Care and Use Committee of Northwestern University.

RESULTS
Identification and mutation of lapA and lapB in L. pneumophila.
In our previous proteomic analysis, we identified two proteins
that are present in wild-type 130b but not
lspF mutant supernatants
and are hypothesized to be aminopeptidases (
23). The first of
these proteins, which we now designate as LapA, for
Legionella aminopeptidase A, had been annotated as a leucine aminopeptidase.
In the sequenced strains Philadelphia, Paris, and Lens,
lapA is designated as lpg2814, lpp2866, and lpl2729, respectively
(
14,
16). In wild-type supernatants, we observed a 35-kDa LapA,
a form of the protein that predicts cleavage of a signal sequence,
secretion by the type II pathway, and processing to a smaller
form (
23). The second of these proteins, which we named LapB,
also showed similarity to known aminopeptidases, although its
level of similarity was not sufficient to warrant prior annotation
as an aminopeptidase. In strains Philadelphia, Paris, and Lens,
lapB is designated as lpg0032, lpp0031, and lpl0032, respectively
(
14,
16). As was the case for LapA, a ca. 35-kDa LapB was observed
in wild-type supernatants (
23). LapA and LapB exhibit 42% identity
and 59% similarity with each other (data not shown).
In order to determine whether LapA and LapB are, in fact, aminopeptidases, we cloned each of their genes and then used allelic exchange to construct the corresponding specific mutants of strain 130b. Two independently derived mutants were obtained for each gene, i.e., Kmr NU320 and NU321 for lapA and Gmr NU322 and NU323 for lapB. We also constructed two double mutants that were defective for both lapA and lapB, i.e., Kmr Gmr NU324 and NU325. All new mutants grew normally in BYE broth and on BCYE agar at 37 and 25°C (data not shown), indicating that lapA and lapB are not required for extracellular growth in standard medium. When cultured in broth, supernatants from mutant cultures contained normal levels of acid phosphatase, lipase, RNase, and protease (data not shown), indicating that the strains do not have general defects in type II secretion.
Influence of lapA, lapB, and lspF on secreted aminopeptidase activities.
To examine secreted aminopeptidase activities, we grew legionellae in BYE broth to late log phase and then assayed culture supernatants for the ability to cleave peptide substrates. Wild-type 130b supernatants consistently cleaved arginine-, alanine-, leucine-, lysine-, phenylalanine-, and tyrosine-containing substrates (Fig. 1). As observed previously with the Corby strain of L. pneumophila (20), this activity appeared the greatest when using the leucine- and lysine-containing substrates. No activity was seen against Cys-βNA (data not shown). When the wild type was grown in BYE broth that had 25% of its usual yeast extract content, there was a ca. 97% reduction in activity in supernatants compared to the activity in supernatants from standard BYE. Hence, as might be expected, secreted activity is responsive to the amount of potential substrate in the growth medium. These data confirm that L. pneumophila strains secrete activity against a variety of aminopeptides.
As predicted from the annotation, supernatants derived from
lapA mutant NU320 lacked leucine aminopeptidase activity (Fig.
1A). Since the independently derived
lapA mutant NU321 also
completely lacked this activity and since
lapA is monocistronic,
these data indicate that this defect was due to loss of LapA.
We next observed that the
lapA mutant also completely lacked
activity against Phe-βNA and L-Tyr-βNA (Fig.
1B and C),
indicating that the ability of LapA to cleave is not specific
for leucine aminopeptides. In contrast to the
lapA mutant, the
lapB mutant did not show any loss of activity against leucine,
phenylalanine, or tyrosine substrates (Fig.
1A to C). Supernatants
from the independently derived
lapA lapB double mutant lacked
activity against leucine, phenylalanine, and tyrosine aminopeptides
in the same way as did the
lapA mutants (Fig.
1A to C). When
testing activity against L-Arg-βNA and Lys-
pNI, we observed
that the LapB mutant, but not the LapA mutant, lacked activity
(Fig.
1D and E). LapB mutant NU322 showed a complete loss of
lysine aminopeptidase activity and a partial reduction in arginine
aminopeptidase activity. Supernatants from the
lapA lapB double
mutant lacked activity against arginine and lysine aminopeptides
in the same way as did the
lapB mutant (Fig.
1D and E). When
an intact copy of
lapB was reintroduced into NU322 on complementing
plasmid pM
lapB, there was restoration of aminopeptidase activity
(data not shown). Thus, the losses in arginine and lysine aminopeptidase
activities in the
lapB mutant were due to the absence of LapB.
None of the single or double
lap mutants lacked alanine aminopeptidase
activity in their supernatants (Fig.
1F). Taken together, these
data indicate that, under standard growth conditions, LapA is
entirely responsible for secreted leucine, phenylalanine, and
tyrosine aminopeptidase activities, whereas LapB is entirely
responsible for the lysine aminopeptidase activity and at least
partly responsible for the organism's secreted arginine aminopeptidase
activity.
Supporting the fact that LapA and LapB are secreted via the type II secretion system, we observed that the leucine and lysine aminopeptidase activities were diminished in the supernatants of an lspF mutant (Fig. 2) but at wild-type levels in supernatants of a complemented lspF mutant (data not shown). Interestingly, the alanine aminopeptidase activity that is not dependent upon LapA or LapB was always fully present within the supernatants of the lspF mutant (Fig. 2), suggesting that it is secreted or released by a mechanism other than standard type II secretion.
Roles of lapA and lapB in L. pneumophila infection.
On many occasions, we and others have observed that
lsp mutants
of strain 130b are impaired in their ability to infect
H. vermiformis amoebae and human U937 cell macrophages (
23,
44,
55,
60-
62).
Others have shown that
lsp mutants of strain Philadelphia-1
are unable to grow in
A. castellanii amoebae (
37). Thus, to
assess the role of aminopeptidases in intracellular infection,
we compared strain 130b and the LapA and LapB mutants for their
abilities to infect these three disparate hosts. Mutants lacking
one or both of the aminopeptidases showed no defect in
H. vermiformis amoebae,
A. castellanii amoebae, or U937 cell macrophages (Fig.
3). Thus, the losses of LapA and LapB do not account for the
previously reduced inability of
lsp mutants to grow within host
cells in vitro. To ascertain the in vivo significance of the
type II-secreted aminopeptidases, we assayed the ability of
the
lapA lapB double mutant NU324 to grow in the lungs of A/J
mice. Unlike an
lspF mutant (
23,
62), NU324 grew and displayed
a recoverability from the lungs that was similar to wild type
(data not shown). These data indicate that
lapA and
lapB are
not required for infection.
Role for the secreted zinc metalloprotease in intracellular infection of protozoa.
While testing the Lap mutants, we thought it would be instructive
to also examine a 130b mutant lacking another type of proteolytic
enzyme, i.e., the secreted ProA/MspA metalloprotease. At the
outset, we viewed the protease mutant as another control. Indeed,
when tested in the aminopeptidase assays, mutant AA200 did not
display a reduction in activity against Leu-
pNI, Phe-βNA,
Tyr-βNA, or Ala-βNA (Fig.
4A). Supernatants from the
proA mutant did show losses in activity against Arg-βNA
and Lys-
pNI that were comparable to those seen for the
lapB mutant (Fig.
4B), suggesting that the protease may be needed
for activation of LapB as it is for the expression of some other
type-II secreted enzymes (
8,
31). For intracellular infection,
the protease mutant AA200 behaved like the wild type did when
grown in U937 cells (data not shown) and
A. castellanii strain
30234 (Fig.
5). As expected (see above), our
lspF mutant of
strain 130b showed a greatly reduced ability to grow in
A. castellanii (Fig.
5). The U937 cell infection results obtained for the protease
mutant were also in agreement with the earlier work of others,
which showed that ProA is dispensable for infection of the HL-60
macrophage cell line and explanted guinea pig macrophages (
51,
73). Similarly, Moffat et al. also previously observed that
the
proA mutant AA200 is not defective for growth in
A. castellanii 30234 (
51). Using the assay methods of Moffat et al., Hales
and Shuman observed that a
mspA mutant derived from
L. pneumophila strain Philadelphia-1 does not show optimal growth in
A. castellanii 30234 (
37). It is not clear why we and Moffat et al. obtained
a result that is different from that of Hales and Shuman. On
the one hand, it is possible that
proA/mspA is important for
infection of acanthamoebae by some (e.g., Philadelphia-1) but
not all (e.g., 130b) strains of
L. pneumophila. On the other
hand, since only a single
mspA mutant derived from Philadelphia-1
was tested and no subsequent complementation analysis was done,
it is possible that the growth defect seen was due not to the
loss of
mspA/proA but to a second-site mutation.
When we examined AA200 for its ability to infect
H. vermiformis,
a type of amoebae that had not been examined previously with
any
proA or
mspA mutant, we observed a statistically significant
defect. Indeed, the
proA mutant consistently showed a ca. 10-fold-reduced
recovery after 48 to 96 h of incubation with these amoebae (Fig.
6A). The mutant did not exhibit any reduced survivability when
incubated in the 1034 culture medium alone (data not shown).
Importantly, complementation of the mutant phenotype occurred
when an intact copy of
proA was introduced on a plasmid (Fig.
6B). Also, an independently derived mutant (NU327) inactivated
for both
lapB and
proA displayed a defect in
H. vermiformis that was identical to that of AA200 (data not shown). That AA200
was not defective when infecting acanthamoebae that were cultured
in 1034 medium (Fig.
5B) indicates that the reduced recoverability
of the
proA mutant from
H. vermiformis was not simply an artifact
of the particular medium used to grow those amoebae. Together,
these data indicate that the secreted zinc metalloprotease of
L. pneumophila promotes optimal intracellular infection but
that its importance is dependent upon the host system being
used. Since the
proA mutant was not as defective in
H. vermiformis as the
lspF mutant (Fig.
6A), there are likely to be more type
II effectors that facilitate intracellular infection.

DISCUSSION
Bacteria produce many types of aminopeptidases, but most of
these enzymes are cell associated (
32,
41,
47). Indeed, secreted
aminopeptidases have only been described for
Aeromonas,
Bacillus,
Clostridium,
Pseudomonas,
Streptomyces, and
Vibrio (
5,
13,
32,
35,
76). We have now confirmed that
L. pneumophila also secretes
aminopeptidases. LapA and LapB are the second and third examples
of aminopeptidases being secreted via a type II secretion system,
with the first example being from
P. aeruginosa (
13,
48). LapA
and LapB are within the M28 family of peptidases, based on shared
homology that encompasses amino acid residues 195 to 401 in
LapA and residues 189 to 393 in LapB. The best-characterized
members of the family are the secreted aminopeptidases of
Streptomyces griseus and
Vibrio proteolyticus (
15,
33). When LapA is aligned
with these aminopeptidases, all of the conserved residues of
the active site (H217, D230, E265, D292, and H370) and 9 of
the 10 residues that line the hydrophobic pocket adjacent to
the zinc-binding site are found. When LapB is aligned with the
Vibrio enzyme, residues in the active site (H213, D226, E261,
D288, and H366) and residues along the hydrophobic pocket are
again conserved. Based on the different types of losses in activity
that we observed for the
lapA and
lapB mutants, LapA appears
to be directed against hydrophobic aminopeptides, whereas LapB
targets positively charged, hydrophilic aminopeptides. Thus,
LapA and LapB perform distinct yet complementary enzymatic activities
for
L. pneumophila.
As a group, bacterial aminopeptidases perform a variety of functions, including the catabolism of exogenous peptides, the modulation of intracellular protein turnover, the N-terminal cleavage of nascent proteins, and the repression of transcription (32, 41, 47). Because they are secreted, LapA and LapB are most likely involved in the catabolism of exogenous peptides. Although the lapA and lapB mutants were not impaired for growth in BYE broth, U937 cells, acanthamoebae, or hartmannellae, we did not conclude that LapA and LapB are irrelevant for growth. For example, it is possible that these enzymes are critical for growth in other specialized niches or conditions. L. pneumophila might also produce other aminopeptidases or proteases that compensate for the absence of LapA and LapB. In support of the latter scenario, the L. pneumophila genome predicts the existence of a third, type II-secreted aminopeptidase that is related to LapA and LapB (23). Also, as observed in the present study, wild-type supernatants contain an alanine aminopeptidase activity that is not type II dependent. Finally, carboxypeptidase activity has been seen in L. pneumophila culture supernatants (9, 10), and other secreted (nonamino) peptidases and proteases have been predicted from the genome (14, 16, 23).
An arguably unexpected finding of our study is that L. pneumophila infection of H. vermiformis amoebae is affected by the absence of the type II-secreted metalloprotease, since earlier studies had not shown a role for ProA/MspA during infection of macrophages and A. castellanii amoebae (51, 73). Thus, our work not only uncovers a previously overlooked role for ProA/MspA but illustrates how the significance of a Legionella trait can vary depending on the host being used. Though a good number of L. pneumophila factors display differences in importance when comparing protozoan and mammalian hosts (52, 72), our observations indicate that distinctions can also be made between amoeba hosts. L. pneumophila infects at least seven genera and 17 species of protozoa (28, 67) and, therefore, it is reasonable to think that certain bacterial factors might have evolved to have greater importance in only certain protozoa. Previous studies have found that the growth and uptake of wild-type L. pneumophila can vary between Acanthamoeba, Hartmannella, and Naegleria hosts (24, 38, 55, 71). But, few past studies have examined specific mutants of L. pneumophila for their capacity to infect multiple protozoa (55, 77). One of these studies described mutants that exhibit different behaviors in different amoebae, but the insertion mutations described therein were not backcrossed or complemented (55). Thus, proA/mspA represents an L. pneumophila gene that clearly shows differential importance among protozoan models. Although a need for ProA is only evident from infections of H. vermiformis, previous studies showed that proA and its protein product are expressed during infection of A. castellanii and macrophages (51, 59). Thus, we hypothesize that in some hosts, such as acanthamoebae and macrophages, ProA/MspA is dispensable such that other proteases can, if necessary, fulfill its role, but that in other hosts, such as H. vermiformis, the need for ProA/MspA is greater and/or cannot be complemented by alternate proteases.
The metalloprotease may be promoting optimal intracellular infection by helping the bacterium to obtain amino acid nutrients. In support of this scenario, amino acid transporters in L. pneumophila and the host cell are required for optimal intracellular growth (64, 78). On the other hand, it is possible that ProA/MspA degrades host factors that are designed to control bacterial growth or cleaves other secreted Legionella proteins that directly promote intracellular infection. In infected macrophages, the protease is seen in both the Legionella phagosome and the adjacent host cytoplasm (59), supporting the possibility of it having multiple intracellular targets. Clearly, the protease's greater role in Hartmannella hosts should facilitate future investigations into the protein's intracellular role. Since ProA promotes optimal infection of H. vermiformis, an amoeba that is an environmental reservoir for legionellae (19, 28), we can now conclude that the protease plays a role in the ecology of L. pneumophila. Coupled with this environmental role, ProA contributes to disease by mediating lung damage and by inhibiting cytokine, phagocyte, NK cell, and T-cell function (21, 23, 39, 49, 58, 63, 79). Thus, ProA promotes the natural history and pathogenesis of Legionnaires' disease in multiple ways.
Finally, the results presented here increase our appreciation and understanding of type II secretion. First, with the characterization of LapA and LapB, the L. pneumophila type II secretome is now expanded to include at least 14 enzymatic activities and as such is arguably one of the best-characterized type II secretion systems (2-4, 8, 22, 30, 31, 37, 44, 61, 62). Second, with the demonstration of a role for ProA/MspA in H. vermiformis infection, we now have the first example of a type II-secreted protein promoting optimal intracellular infection. This confirms our previous hypothesis that the intracellular defects of lsp mutants are due, at least in part, to the loss of secreted effectors, as opposed to being strictly due to potential cell-associated (e.g., envelope) changes. Since a proA mutant is not as defective in H. vermiformis as an lsp mutant, we believe that there are more type II effectors that facilitate infection. Indeed, the relatively modest effect of the proA mutation is compatible with a scenario in which the importance of type II secretion derives from an additive effect of multiple secreted proteins. A similar conclusion has been drawn concerning the Dot/Icm type IV secretion system of L. pneumophila in which some effectors, analogous to LapA and LapB, are completely dispensable, while others, like ProA, contribute but in a relatively small way (43, 46).

ACKNOWLEDGMENTS
We acknowledge members of the Cianciotto lab for helpful comments
and advice. We again thank Jennifer Moffat and Lucy Tompkins
for having previously sent us their
proA mutant.
This work was supported by NIH grant AI43987, awarded to N.P.C.

FOOTNOTES
* Corresponding author. Mailing address: Department of Microbiology-Immunology, Northwestern University Medical School, 320 East Superior Ave., Chicago, IL 60611-3010. Phone: (312) 503-0385. Fax: (312) 503-1339. E-mail:
n-cianciotto{at}northwestern.edu 
Published ahead of print on 14 December 2007. 

REFERENCES
1 - Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
2 - Aragon, V., S. Kurtz, and N. P. Cianciotto. 2001. Legionella pneumophila major acid phosphatase and its role in intracellular infection. Infect. Immun. 69:177-185.[Abstract/Free Full Text]
3 - Aragon, V., S. Kurtz, A. Flieger, B. Neumeister, and N. P. Cianciotto. 2000. Secreted enzymatic activities of wild-type and pilD-deficient Legionella pneumophila. Infect. Immun. 68:1855-1863.[Abstract/Free Full Text]
4 - Aragon, V., O. Rossier, and N. P. Cianciotto. 2002. Legionella pneumophila genes that encode lipase and phospholipase C activities. Microbiology 148:2223-2231.[Abstract/Free Full Text]
5 - Arima, J., Y. Uesugi, M. Uraji, S. Yatsushiro, S. Tsuboi, M. Iwabuchi, and T. Hatanaka. 2006. Modulation of Streptomyces leucine aminopeptidase by calcium: identification and functional analysis of key residues in activation and stabilization by calcium. J. Biol. Chem. 281:5885-5894.[Abstract/Free Full Text]
6 - Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1989. Current protocols in molecular biology, vol. 1. Wiley, New York, NY.
7 - Bandyopadhyay, P., S. Liu, C. B. Gabbai, Z. Venitelli, and H. M. Steinman. 2007. Environmental mimics and the Lvh type IVA secretion system contribute to virulence-related phenotypes of Legionella pneumophila. Infect. Immun. 75:723-735.[Abstract/Free Full Text]
8 - Banerji, S., M. Bewersdorff, B. Hermes, N. P. Cianciotto, and A. Flieger. 2005. Characterization of the major secreted zinc metalloprotease-dependent glycerophospholipid:cholesterol acyltransferase, PlaC, of Legionella pneumophila. Infect. Immun. 73:2899-2909.[Abstract/Free Full Text]
9 - Berdal, B. P., K. Bovre, O. Olsvik, and T. Omland. 1983. Patterns of extracellular proline-specific endopeptidases in Legionella and Flavobacterium spp. demonstrated by use of chromogenic peptides. J. Clin. Microbiol. 17:970-974.[Abstract/Free Full Text]
10 - Berdal, B. P., O. Olsvik, S. Myhre, and T. Omland. 1982. Demonstration of extracellular chymotrypsin-like activity from various Legionella species. J. Clin. Microbiol. 16:452-457.[Abstract/Free Full Text]
11 - Bouyer, S., C. Imbert, M. H. Rodier, and Y. Hechard. 2007. Long-term survival of Legionella pneumophila associated with Acanthamoeba castellanii vesicles. Environ. Microbiol. 9:1341-1344.[CrossRef][Medline]
12 - Brieland, J., M. McClain, M. LeGendre, and C. Engleberg. 1997. Intrapulmonary Hartmannella vermiformis: a potential niche for Legionella pneumophila replication in a murine model of legionellosis. Infect. Immun. 65:4892-4896.[Abstract]
13 - Cahan, R., I. Axelrad, M. Safrin, D. E. Ohman, and E. Kessler. 2001. A secreted aminopeptidase of Pseudomonas aeruginosa. Identification, primary structure, and relationship to other aminopeptidases. J. Biol. Chem. 276:43645-43652.[Abstract/Free Full Text]
14 - Cazalet, C., C. Rusniok, H. Bruggemann, N. Zidane, A. Magnier, L. Ma, M. Tichit, S. Jarraud, C. Bouchier, F. Vandenesch, F. Kunst, J. Etienne, P. Glaser, and C. Buchrieser. 2004. Evidence in the Legionella pneumophila genome for exploitation of host cell functions and high genome plasticity. Nat. Genet. 36:1165-1173.[CrossRef][Medline]
15 - Chevrier, B., C. Schalk, H. D'Orchymont, J. M. Rondeau, D. Moras, and C. Tarnus. 1994. Crystal structure of Aeromonas proteolytica aminopeptidase: a prototypical member of the co-catalytic zinc enzyme family. Structure 2:283-291.[Medline]
16 - Chien, M., I. Morozova, S. Shi, H. Sheng, J. Chen, S. M. Gomez, G. Asamani, K. Hill, J. Nuara, M. Feder, J. Rineer, J. J. Greenberg, V. Steshenko, S. H. Park, B. Zhao, E. Teplitskaya, J. R. Edwards, S. Pampou, A. Georghiou, I. C. Chou, W. Iannuccilli, M. E. Ulz, D. H. Kim, A. Geringer-Sameth, C. Goldsberry, P. Morozov, S. G. Fischer, G. Segal, X. Qu, A. Rzhetsky, P. Zhang, E. Cayanis, P. J. De Jong, J. Ju, S. Kalachikov, H. A. Shuman, and J. J. Russo. 2004. The genomic sequence of the accidental pathogen Legionella pneumophila. Science 305:1966-1968.[Abstract/Free Full Text]
17 - Cianciotto, N. P. 2005. Type II secretion: a protein secretion system for all seasons. Trends Microbiol. 13:581-588.[CrossRef][Medline]
18 - Cianciotto, N. P., B. I. Eisenstein, C. H. Mody, G. B. Toews, and N. C. Engleberg. 1989. A Legionella pneumophila gene encoding a species-specific surface protein potentiates initiation of intracellular infection. Infect. Immun. 57:1255-1262.[Abstract/Free Full Text]
19 - Cianciotto, N. P., and B. S. Fields. 1992. Legionella pneumophila mip gene potentiates intracellular infection of protozoa and human macrophages. Proc. Natl. Acad. Sci. USA 89:5188-5191.[Abstract/Free Full Text]
20 - Conlan, J. W., A. Baskerville, and L. A. E. Ashworth. 1986. Separation of Legionella pneumophila proteases and purification of a protease which produces lesions like those of Legionnaires' disease in guinea pig lung. J. Gen. Microbiol. 132:1565-1574.[Abstract/Free Full Text]
21 - Conlan, J. W., A. Williams, and L. A. Ashworth. 1988. In vivo production of a tissue-destructive protease by Legionella pneumophila in the lungs of experimentally infected guinea-pigs. J. Gen. Microbiol. 134:143-149.[Abstract/Free Full Text]
22 - DebRoy, S., V. Aragon, S. Kurtz, and N. P. Cianciotto. 2006. Legionella pneumophila Mip, a surface-exposed peptidylproline cis-trans-isomerase, promotes the presence of phospholipase C-like activity in culture supernatants. Infect. Immun. 74:5152-5160.[Abstract/Free Full Text]
23 - DebRoy, S., J. Dao, M. Soderberg, O. Rossier, and N. P. Cianciotto. 2006. Legionella pneumophila type II secretome reveals unique exoproteins and a chitinase that promotes bacterial persistence in the lung. Proc. Natl. Acad. Sci. USA 103:19146-19151.[Abstract/Free Full Text]
24 - Declerck, P., J. Behets, Y. Delaedt, A. Margineanu, E. Lammertyn, and F. Ollevier. 2005. Impact of non-Legionella bacteria on the uptake and intracellular replication of Legionella pneumophila in Acanthamoeba castellanii and Naegleria lovaniensis. Microb. Ecol. 50:536-549.[CrossRef][Medline]
25 - Dreyfus, L. A., and B. H. Iglewski. 1986. Purification and characterization of an extracellular protease of Legionella pneumophila. Infect. Immun. 51:736-743.[Abstract/Free Full Text]
26 - Edwards, R. A., L. H. Keller, and D. M. Schifferli. 1998. Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression. Gene 207:149-157.[CrossRef][Medline]
27 - Engleberg, N. C., D. J. Drutz, and B. I. Eisenstein. 1984. Cloning and expression of Legionella pneumophila antigens in Escherichia coli. Infect. Immun. 44:222-227.[Abstract/Free Full Text]
28 - Fields, B. S. 1996. The molecular ecology of legionellae. Trends Microbiol. 4:286-290.[CrossRef][Medline]
29 - Fields, B. S., R. F. Benson, and R. E. Besser. 2002. Legionella and Legionnaires' disease: 25 years of investigation. Clin. Microbiol. Rev. 15:506-526.[Abstract/Free Full Text]
30 - Flieger, A., S. Gong, M. Faigle, S. Stevanovic, N. P. Cianciotto, and B. Neumeister. 2001. Novel lysophospholipase A secreted by Legionella pneumophila. J. Bacteriol. 183:2121-2124.[Abstract/Free Full Text]
31 - Flieger, A., B. Neumeister, and N. P. Cianciotto. 2002. Characterization of the gene encoding the major secreted lysophospholipase A of Legionella pneumophila and its role in detoxification of lysophosphatidylcholine. Infect. Immun. 70:6094-6106.[Abstract/Free Full Text]
32 - Gonzales, T., and J. Robert-Baudouy. 1996. Bacterial aminopeptidases: properties and functions. FEMS Microbiol. Rev. 18:319-344.[CrossRef][Medline]
33 - Greenblatt, H. M., O. Almog, B. Maras, A. Spungin-Bialik, D. Barra, S. Blumberg, and G. Shoham. 1997. Streptomyces griseus aminopeptidase: X-ray crystallographic structure at 1.75 Å resolution. J. Mol. Biol. 265:620-636.[CrossRef][Medline]
34 - Grindley, N. D., and C. M. Joyce. 1980. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903. Proc. Natl. Acad. Sci. USA 77:7176-7180.[Abstract/Free Full Text]
35 - Guenet, C., P. Lepage, and B. A. Harris. 1992. Isolation of the leucine aminopeptidase gene from Aeromonas proteolytica. Evidence for an enzyme precursor. J. Biol. Chem. 267:8390-8395.[Abstract/Free Full Text]
36 - Gul'nik, S. V., M. P. Yusupova, G. I. Lavrenova, I. S. Tartakovsky, S. V. Prozorovsky, and V. M. Stepanov. 1986. Proteinases of Legionella: phenylalanineaminopeptidase of L. pneumophila. J. Gen. Microbiol. 132:387-392.[Abstract/Free Full Text]
37 - Hales, L. M., and H. A. Shuman. 1999. Legionella pneumophila contains a type II general secretion pathway required for growth in amoebae as well as for secretion of the Msp protease. Infect. Immun. 67:3662-3666.[Abstract/Free Full Text]
38 - Harb, O. S., C. Venkataraman, B. J. Haack, L. Y. Gao, and Y. A. Kwaik. 1998. Heterogeneity in the attachment and uptake mechanisms of the Legionnaires' disease bacterium, Legionella pneumophila, by protozoan hosts. Appl. Environ. Microbiol. 64:126-132.[Abstract/Free Full Text]
39 - Hell, W., A. Essig, S. Bohnet, S. Gatermann, and R. Marre. 1993. Cleavage of tumor necrosis factor-alpha by Legionella exoprotease. APMIS 101:120-126.[Medline]
40 - Jacobi, S., and K. Heuner. 2003. Description of a putative type I secretion system in Legionella pneumophila. Int. J. Med. Microbiol. 293:349-358.[CrossRef][Medline]
41 - Jankiewicz, U., and W. Bielawski. 2003. The properties and functions of bacterial aminopeptidases. Acta Microbiol. Pol. 52:217-231.[Medline]
42 - Johnson, T. L., J. Abendroth, W. G. Hol, and M. Sandkvist. 2006. Type II secretion: from structure to function. FEMS Microbiol. Lett. 255:175-186.[CrossRef][Medline]
43 - Laguna, R. K., E. A. Creasey, Z. Li, N. Valtz, and R. R. Isberg. 2006. A Legionella pneumophila-translocated substrate that is required for growth within macrophages and protection from host cell death. Proc. Natl. Acad. Sci. USA 103:18745-18750.[Abstract/Free Full Text]
44 - Liles, M. R., P. H. Edelstein, and N. P. Cianciotto. 1999. The prepilin peptidase is required for protein secretion by and the virulence of the intracellular pathogen Legionella pneumophila. Mol. Microbiol. 31:959-970.[CrossRef][Medline]
45 - Little, G. H., W. L. Starnes, and F. J. Behal. 1976. Human liver aminopeptidase. Methods Enzymol. 45:495-503.[Medline]
46 - Liu, Y., and Z. Q. Luo. 2007. The Legionella pneumophila effector SidJ is required for efficient recruitment of endoplasmic reticulum proteins to the bacterial phagosome. Infect. Immun. 75:592-603.[Abstract/Free Full Text]
47 - Matsui, M., J. H. Fowler, and L. L. Walling. 2006. Leucine aminopeptidases: diversity in structure and function. Biol. Chem. 387:1535-1544.[CrossRef][Medline]
48 - Michel, G. P., E. Durand, and A. Filloux. 2007. XphA/XqhA, a novel GspCD subunit for type II secretion in Pseudomonas aeruginosa. J. Bacteriol. 189:3776-3783.[Abstract/Free Full Text]
49 - Mintz, C. S., R. D. Miller, N. S. Gutgsell, and T. Malek. 1993. Legionella pneumophila protease inactivates interleukin-2 and cleaves CD4 on human T cells. Infect. Immun. 61:3416-3421.[Abstract/Free Full Text]
50 - Moffat, J. F., W. J. Black, and L. S. Tompkins. 1994. Further molecular characterization of the cloned Legionella pneumophila zinc metalloprotease. Infect. Immun. 62:751-753.[Abstract/Free Full Text]
51 - Moffat, J. F., P. H. Edelstein, D. P. Regula, Jr., J. D. Cirillo, and L. S. Tompkins. 1994. Effects of an isogenic Zn-metalloprotease-deficient mutant of Legionella pneumophila in a guinea-pig pneumonia model. Mol. Microbiol. 12:693-705.[CrossRef][Medline]
52 - Molmeret, M., M. Horn, M. Wagner, M. Santic, and Y. Abu Kwaik. 2005. Amoebae as training grounds for intracellular bacterial pathogens. Appl. Environ. Microbiol. 71:20-28.[Free Full Text]
53 - Muller, H. E. 1981. Enzymatic profile of Legionella pneumophila. J. Clin. Microbiol. 13:423-426.[Abstract/Free Full Text]
54 - Nolte, F. S., G. E. Hollick, and R. G. Robertson. 1982. Enzymatic activities of Legionella pneumophila and Legionella-like organisms. J. Clin. Microbiol. 15:175-177.[Abstract/Free Full Text]
55 - Polesky, A. H., J. T. Ross, S. Falkow, and L. S. Tompkins. 2001. Identification of Legionella pneumophila genes important for infection of amoebas by signature-tagged mutagenesis. Infect. Immun. 69:977-987.[Abstract/Free Full Text]
56 - Prescott, J. M., and S. H. Wilkes. 1976. Aeromonas aminopeptidase. Methods Enzymol. 45:530-543.[Medline]
57 - Quinn, F. D., and L. S. Tompkins. 1989. Analysis of a cloned sequence of Legionella pneumophila encoding a 38 kD metalloprotease possessing haemolytic and cytotoxic activities. Mol. Microbiol. 3:797-805.[CrossRef][Medline]
58 - Rechnitzer, C., M. Diamant, and B. K. Pedersen. 1989. Inhibition of human natural killer cell activity by Legionella pneumophila protease. Eur. J. Clin. Microbiol. Infect. Dis. 8:989-992.[CrossRef][Medline]
59 - Rechnitzer, C., A. Williams, J. B. Wright, A. B. Dowsett, N. Milman, and R. B. Fitzgeorge. 1992. Demonstration of the intracellular production of tissue-destructive protease by Legionella pneumophila multiplying within guinea-pig and human alveolar macrophages. J. Gen. Microbiol. 138:1671-1677.[Abstract/Free Full Text]
60 - Rossier, O., and N. P. Cianciotto. 2005. The Legionella pneumophila tatB gene facilitates secretion of phospholipase C, growth under iron-limiting conditions, and intracellular infection. Infect. Immun. 73:2020-2032.[Abstract/Free Full Text]
61 - Rossier, O., and N. P. Cianciotto. 2001. Type II protein secretion is a subset of the PilD-dependent processes that facilitate intracellular infection by Legionella pneumophila. Infect. Immun. 69:2092-2098.[Abstract/Free Full Text]
62 - Rossier, O., S. Starkenburg, and N. P. Cianciotto. 2004. Legionella pneumophila type II protein secretion promotes virulence in the A/J mouse model of Legionnaires' disease pneumonia. Infect. Immun. 72:310-321.[Abstract/Free Full Text]
63 - Sahney, N. N., J. T. Summersgill, J. A. Ramirez, and R. D. Miller. 2001. Inhibition of oxidative burst and chemotaxis in human phagocytes by Legionella pneumophila zinc metalloprotease. J. Med. Microbiol. 50:517-525.[Abstract/Free Full Text]
64 - Sauer, J. D., M. A. Bachman, and M. S. Swanson. 2005. The phagosomal transporter A couples threonine acquisition to differentiation and replication of Legionella pneumophila in macrophages. Proc. Natl. Acad. Sci. USA 102:9924-9929.[Abstract/Free Full Text]
65 - Schweizer, H. P., and T. T. Hoang. 1995. An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene 158:15-22.[CrossRef][Medline]
66 - Segarra, A. B., R. Wangensteen, M. Ramirez, I. Banegas, F. Hermoso, F. Vargas, F. Vives, R. Duran, F. Alba, M. de Gasparo, and I. Prieto. 2006. Atrial angiotensinase activity in hypothyroid, euthyroid, and hyperthyroid rats. J. Cardiovasc. Pharmacol. 48:117-120.[CrossRef][Medline]
67 - Shadrach, W. S., K. Rydzewski, U. Laube, G. Holland, M. Ozel, A. F. Kiderlen, and A. Flieger. 2005. Balamuthia mandrillaris, free-living ameba and opportunistic agent of encephalitis, is a potential host for Legionella pneumophila bacteria. Appl. Environ. Microbiol. 71:2244-2249.[Abstract/Free Full Text]
68 - Söderberg, M. A., and N. P. Cianciotto. 2006. The type II protein secretion system of L. pneumophila is important for growth in iron-rich media and survival in tap water at low temperatures, p. 214-216. In N. P. Cianciotto, Y. Abu Kwaik, P. H. Edelstein, B. S. Fields, D. F. Geary, T. G. Harrison, C. A. Joseph, R. M. Ratcliff, J. E. Stout, and M. S. Swanson (ed.), Legionella: state of the art 30 years after its recognition. ASM Press, Washington, DC.
69 - Söderberg, M. A., O. Rossier, and N. P. Cianciotto. 2004. The type II protein secretion system of Legionella pneumophila promotes growth at low temperatures. J. Bacteriol. 186:3712-3720.[Abstract/Free Full Text]
70 - Spungin, A., and S. Blumberg. 1989. Streptomyces griseus aminopeptidase is a calcium-activated zinc metalloprotein. Purification and properties of the enzyme. Eur. J. Biochem. 183:471-477.[Medline]
71 - Steinert, M., M. Ott, P. C. Lück, E. Tannich, and J. Hacker. 1994. Studies on the uptake and intracellular replication of Legionella pneumophila in protozoa and in macrophage-like cells. FEMS Microbiol. Ecol. 15:299-308.[CrossRef]
72 - Swanson, M. S., and B. K. Hammer. 2000. Legionella pneumophila pathogenesis: a fateful journey from amoebae to macrophages. Annu. Rev. Microbiol. 54:567-613.[CrossRef][Medline]
73 - Szeto, L., and H. A. Shuman. 1990. The Legionella pneumophila major secretory protein, a protease, is not required for intracellular growth or cell killing. Infect. Immun. 58:2585-2592.[Abstract/Free Full Text]
74 - Tesh, M. J., S. A. Morse, and R. D. Miller. 1983. Intermediary metabolism in Legionella pneumophila: utilization of amino acids and other compounds as energy sources. J. Bacteriol. 154:1104-1109.[Abstract/Free Full Text]
75 - Thompson, M. R., R. D. Miller, and B. H. Iglewski. 1981. In vitro production of an extracellular protease by Legionella pneumophila. Infect. Immun. 34:299-302.[Abstract/Free Full Text]
76 - Toma, C., and Y. Honma. 1996. Cloning and genetic analysis of the Vibrio cholerae aminopeptidase gene. Infect. Immun. 64:4495-5000.[Abstract]
77 - Viswanathan, V. K., S. Kurtz, L. L. Pedersen, Y. Abu-Kwaik, K. Krcmarik, S. Mody, and N. P. Cianciotto. 2002. The cytochrome c maturation locus of Legionella pneumophila promotes iron assimilation and intracellular infection and contains a strain-specific insertion sequence element. Infect. Immun. 70:1842-1852.[Abstract/Free Full Text]
78 - Wieland, H., S. Ullrich, F. Lang, and B. Neumeister. 2005. Intracellular multiplication of Legionella pneumophila depends on host cell amino acid transporter SLC1A5. Mol. Microbiol. 55:1528-1537.[CrossRef][Medline]
79 - Williams, A., A. Baskerville, A. B. Dowsett, and J. W. Conlan. 1987. Immunocytochemical demonstration of the association between Legionella pneumophila, its tissue-destructive protease, and pulmonary lesions in experimental Legionnaires' disease. J. Pathol. 153:257-264.[CrossRef][Medline]
80 - Ye, S., S. Y. Chai, R. A. Lew, and A. L. Albiston. 2007. Insulin-regulated aminopeptidase: analysis of peptide substrate and inhibitor binding to the catalytic domain. Biol. Chem. 388:399-403.[CrossRef][Medline]
Applied and Environmental Microbiology, February 2008, p. 753-761, Vol. 74, No. 3
0099-2240/08/$08.00+0 doi:10.1128/AEM.01944-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Allard, K. A., Dao, J., Sanjeevaiah, P., McCoy-Simandle, K., Chatfield, C. H., Crumrine, D. S., Castignetti, D., Cianciotto, N. P.
(2009). Purification of Legiobactin and Importance of This Siderophore in Lung Infection by Legionella pneumophila. Infect. Immun.
77: 2887-2895
[Abstract]
[Full Text]
-
Rossier, O., Dao, J., Cianciotto, N. P.
(2009). A type II secreted RNase of Legionella pneumophila facilitates optimal intracellular infection of Hartmannella vermiformis. Microbiology
155: 882-890
[Abstract]
[Full Text]
-
Stewart, C. R., Rossier, O., Cianciotto, N. P.
(2009). Surface Translocation by Legionella pneumophila: a Form of Sliding Motility That Is Dependent upon Type II Protein Secretion. J. Bacteriol.
191: 1537-1546
[Abstract]
[Full Text]
-
Soderberg, M. A., Dao, J., Starkenburg, S. R., Cianciotto, N. P.
(2008). Importance of Type II Secretion for Survival of Legionella pneumophila in Tap Water and in Amoebae at Low Temperatures. Appl. Environ. Microbiol.
74: 5583-5588
[Abstract]
[Full Text]