Previous Article | Next Article ![]()
Applied and Environmental Microbiology, February 2008, p. 1232-1239, Vol. 74, No. 4
0099-2240/08/$08.00+0 doi:10.1128/AEM.01946-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
School of Municipal and Environmental Engineering, Harbin Institute of Technology, Harbin 150090, China,1 Center for Environmental Biotechnology, The Biodesign Institute, Arizona State University, Tempe, Arizona 85287-57012
Received 23 August 2007/ Accepted 10 December 2007
|
|
|---|
|
|
|---|
The conventional wisdom is that fermentative H2-producing bacteria (HPB) are restricted to a few genera, such as Clostridium and Enterobacter (20, 32), which lose the ability to produce H2 at pHs below 5 to 5.5 (19). However, a few studies find significant H2 production by anaerobic sludge at low pH values of 4.0 to 4.5, and the soluble organic fermentation products are mainly ethanol and acetic acid (37, 38). These findings break with the conventional concept that H2 production occurs by butyric-type and mixed-acid-type fermentation at pH values higher than 5.5 (15, 19). They imply that unknown and novel HPB are present in the acidophilic communities.
Until now, most research on communities involving HPB has been based on culture-dependent isolation and 16S rRNA gene analysis. However, functional genes have been exploited as molecular markers to monitor environmental microorganisms, and they offer advantages over phylogenetic studies solely based on 16S rRNA genes (21, 44). Hydrogenases (H2ases) catalyze the reversible formation of H2 from protons and electrons according to the half-reaction H2
2H+ + 2e– (33, 45). According to the metal cofactors at the active sites, H2ases are classified into three major groups: NiFe or NiFeSe, Fe only, and metal free (49). NiFe varieties are usually found in microorganisms that consume H2 (49). Wawer and Muyzer (1995) reported the genetic diversity of Desulfovibrio spp. in environmental samples by use of [NiFe]-H2ase gene fragments and demonstrated that genes encoding H2ases could be biomarkers for genus- or species-specific detection of bacteria (50). Fe-only H2ases have been identified in a small group of microbes, where they often catalyze the reduction of protons as terminal electron acceptors to produce H2 (1, 8, 35). Hence, genes encoding [Fe]-H2ases (hyd) can be specific biomarkers of HPB. They have been divided into hydA (large-subunit) and hydB (small-subunit) classes. Chang et al. specifically detected clostridia in an anaerobic H2 biofermentation system by use of [Fe]-hydA (9). However, specific detection of all fermentative HPB in microbial communities based on universal [Fe]-hydA primers has not been reported. A metal-free H2ase has been discovered in some methanogens (49), but it does not produce H2.
Here we use a range of DNA-, RNA-, and enzyme-directed tools to understand the diversity and dynamics of H2-producing communities that are enriched under acidophilic conditions. In particular, this study exploits unique PCR primers targeting hydA to document the distribution and diversity of HPB in acidophilic communities. It also reports that diverse ethanol-H2-coproducing bacteria (EHCB) and fatty acid-oxidizing HPB are enriched in the acidophilic sludge.
|
|
|---|
Chemical analyses.
H2 was measured using a gas chromatograph (SC-2; Shanghai Analytical Instruments Co., Ltd.) equipped with a thermal conductivity detector and a molecular sieve column (Porapak Q 50/80) with nitrogen as the carrier gas. Carbon dioxide and methane were measured similarly, except that a different column was used (Porapak Q 80/100), with helium as the carrier gas. In each case, the size of the injected sample was 0.5 ml. We analyzed volatile fatty acids (VFAs) and ethanol with a gas chromatograph (Agilent 6890N) equipped with a flame ionization detector and a fused-silica capillary column (DB-FFAP), with helium as the carrier gas. Procedures described in Standard Methods for the Examination of Water and Wastewater, 18th ed. (16), were used to determine the COD and levels of volatile suspended solids (VSS).
DNA and RNA extraction.
Samples of anaerobic activated sludge were collected from the two reactors at days 0, 7, 14, 21, 28, 35, and 42. Genomic DNA and total RNA were extracted and purified using the PowerSoil DNA isolation kit and the PowerSoil total-RNA isolation kit (Mo Bio Laboratories, Inc.) according to the manufacturer's instructions.
PCR amplification of the 16S rRNA gene.
PCR amplification was carried out in 50-µl volumes containing 12.5 µM each primer, 200 µM each deoxyribonucleoside triphosphate, 5 µl of 10x PCR buffer (100 mM Tris-HCl, 15 mM MgCl2, 500 mM KCl [pH 8.3]), 0.5 U of Taq DNA polymerase (Promega, Madison, WI), 100 ng of the DNA extract, and sterile deionized water to make up the total volume of 50 µl. The 16S rRNA primers used for denaturing gradient gel electrophoresis (DGGE) analysis were BSF338 (5'-ACTCCTACGGGAGGCAGCAG-3'; E. coli 16S rRNA positions 338 to 354), which was attached to a GC clamp (CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCG) at the 5' terminus, and BSR534 (5'-ATTACCGCGGCTGCTGG-3'; E. coli 16S rRNA positions 517 to 534) (11, 38). The primers used for 16S rRNA gene clone libraries were BSF341 (5'-CCTACGGGAGGCAGCAG-3'; E. coli 16S rRNA positions 341 to 357) and BSR926 (5'-CCGTCAATTYYTTTRAGTTT-3'; E. coli 16S rRNA positions 917 to 926). The samples were amplified in a GenAmp PCR system 9700 (Perkin-Elmer Applied Biosystems, Foster City, CA) programmed as follows: initial denaturation of DNA for 5 min at 94°C; 30 cycles of 1 min at 94°C, 30 s at 60°C (55°C for BSF341 and BSR926), decreasing 0.1°C per cycle to 57°C (52°C for BSF341 and BSR926), and 30 s at 72°C; and extension of incomplete products for 30 min at 72°C. PCR products were examined by electrophoresis on a 2% (wt/vol) agarose gel containing ethidium bromide (0.5 µg/ml). Blank controls were carried out for all steps.
RT-PCR amplification of hydA.
Amino acid sequences of genes known to encode [Fe]-H2ase (33 sequences of 14 genera) from the GenBank database were aligned by the ClustalW program and identified by two conserved regions, ADLTIMEE and EVMACPGGCI (see Fig. S1 and Table S1 in the supplemental material). According to the consensus region of [Fe]-H2ase amino acid sequences, two degenerate universal primers, hydF1 (5'-GCCGACCTKACMATMATGGA-3') and hydR1 (5'-ATRCARCCRCCSGGRCAGGCCAT-3'), were designed. The phosphoric acid of the 5' end of the primers was removed to avoid improper annealing between the primers and the DNA template. For hydA DGGE analysis, hydA segments were recovered from activated sludge by 5'-phosphate-modified primers in the first amplification; then a second amplification was carried out using the regular primer hydF1 (5' end not modified), which was attached to a GC clamp. Reverse transcription-PCR (RT-PCR) was performed using the Promega (Madison, WI) Reverse Transcription System according to the manufacturer's instructions. The reverse transcription samples were amplified under the following conditions: initial denaturation for 5 min at 94°C; 10 cycles of 1 min at 94°C, 90 s at 47°C, and 90 s at 72°C; 20 cycles of 1 min at 94°C, 90 s at 55°C, and 90 s at 72°C; and extension of incomplete products for 30 min at 72°C. The PCR products were examined by electrophoresis on a 1% (wt/vol) agarose gel containing ethidium bromide (0.5 µg/ml). Blank controls were carried out for all steps.
DGGE analysis.
DGGE was performed with a DCode universal mutation detection system (Bio-Rad Laboratories, Hercules, CA). A double-gradient gel was used for analyzing amplified 16S rRNA gene products. A second gradient of 6 to 12% polyacrylamide (acrylamide/bisacrylamide ratio, 37.5:1) together with a 30 to 60% denaturing gradient was superimposed (11, 31). One hundred percent denaturation corresponds to 7 M urea and 40% (vol/vol) deionized formamide. DGGE analysis for the RT-PCR products of the hydA gene used 8% (wt/vol) polyacrylamide gels with a denaturing gradient ranging from 30 to 60%. The gradient gel was cast with a gradient delivery system (model 475; Bio-Rad). Approximately 1 µg of PCR or RT-PCR products per lane was loaded onto DGGE gels.
Electrophoresis was run for 15 min at 25 V and for 3.5 h at 200 V (for the 16S rRNA gene) or 11 h at 75 V (for hydA) in 1x Tris-acetate-EDTA buffer maintained at 60°C. The gels were silver stained according to the method of Bassam et al. (3). Prominent DGGE bands were selected and excised for nucleotide sequencing. The gel was crushed in 50 µl TE buffer (10 mM Tris-HCl, 1 mM EDTA [pH 8.0]), and the mixture was allowed to equilibrate overnight at 4°C. After the slurry was centrifuged at 5,000 x g for 1 min, we took 1 µl of buffer containing DNA as the template for a PCR performed under the conditions described above for sludge samples, except that the forward primer lacked the GC clamp. The PCR products were purified with a Gel Recovery purification kit (Watson Biotechnologies Inc., Shanghai, China) and cloned into Escherichia coli JM109 using the pGEM-T plasmid vector system (Promega, Madison, WI) in accordance with the manufacturer's instructions. Ten clones from each band were randomly chosen for reamplification with the GC clamp. Five microliters of reamplification product from each clone was subjected to DGGE analysis as described above for sludge samples in order to check the purity and to confirm the melting behavior of the band recovered. If the bands from the clones were identical with the DGGE parents' bands, these clones from the same band were sequenced to estimate the numbers of 16S rRNA and hydA sequences comigrating on the DGGE band.
Clone library and sequencing analysis.
The PCR or RT-PCR products were purified, ligated into vector pCR2.1 using a TOPO TA cloning kit (Invitrogen, Carlsbad, CA), and cloned into chemically competent One Shot Escherichia coli cells, provided with the cloning kit, according to the manufacturer's instructions. From these transformants, clone libraries of the 16S rRNA and hydA genes from the 42-day sample of each reactor were constructed. For each reactor, five libraries were constructed from independent PCR or RT-PCR amplifications of the extracted DNA and RNA. Fifty clones for the 16S rRNA gene and 30 clones for the hydA gene were randomly picked and identified from each library. Thus, in total, 250 16S rRNA gene clones and 150 hydA gene clones from each sample were analyzed. Positive clones were screened by colony PCR with vector-specific primers as described previously (40). The cloned PCR fragments were sequenced with an ABI Prism model 3730 automatic sequencer (Perkin-Elmer, Foster City, CA).
Phylogenetic analysis.
16S rRNA sequences were analyzed against the GenBank database and Ribosomal Database Project II (RDP II; http://rdp.cme.msu.edu). All sequences were examined for chimerism using the CHECK_CHIMERA program at RDP II and BELLEROPHON (http://foo.maths.uq.edu.au/
huber/bellerophon.pl) (22). The partial sequences of the hydA gene were aligned with the same region of the most closely related strains available in the GenBank database by using the ClustalW function of the BioEdit package (17). Neighbor-joining phylogenetic trees of 16S rRNA and hydA partial sequences were constructed with the molecular evolutionary genetics analysis package (MEGA, version 3.1) and the Jukes-Cantor algorithm (25). A bootstrap analysis with 1,000 replicates was carried out to check the robustness of the tree.
Isoenzyme activity assay.
Bacteria from as much as 1 ml of anaerobic activated sludge were harvested by centrifugation and resuspended in phosphate-buffered saline, pH 7.4, consisting of 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4, and 0.24 g of K2HPO4 per liter of distilled water. The pellets were washed three times in phosphate-buffered saline and then mixed with extraction buffer (100 mM Tris-HCl [pH 8.0], 5 mM dithiothreitol, and 0.1% β-mercaptoethanol) at 4°C. After the cells were broken by sonication (Sonics; VC130PB) and centrifugation, the proteins were analyzed in the supernatant by electrophoresis. The protein concentrations of crude extracts were estimated by the Bradford method, using a Coomassie blue-based reagent and bovine serum albumin (New England Biolabs Inc.) as standards (6).
Native gels containing 7.5% polyacrylamide were prepared in 1x TBE (90 mM Tris-borate, 1 mM EDTA [pH 8.0]), with each lane loading 3 mg of protein. Electrophoresis was carried out in a Protean II xi cell (Bio-Rad) equipped with a power supply (model PAC1000; Bio-Rad) under constant conditions (4°C, 64 mA) for 3 h in 1x running buffer (25 mM Tris, 192 mM glycine). After electrophoresis, the gels were soaked in an alcohol dehydrogenase (ADH) activity staining solution of 0.6 mM NAD+, 0.4 mM nitroblue tetrazolium, 0.15 mM phenazine methanosulfonate, 1 mM Tris-HCl (pH 7.5), and 4% ethanol for 30 min at 37°C in the dark. After staining, the gels were washed in distilled water.
Statistical analysis.
Phylotypes from clone libraries were determined with the DOTUR program; sequences were grouped into phylotypes at a cutoff value (
99% similarity) using the furthest-neighbor algorithm with 0.001 precision (41). Collector's curves of observed and estimated richness and Shannon and Simpson diversity indices were calculated using the DOTUR and EstimateS 7.5 (http://viceroy.eeb.uconn.edu/estimates) programs. The differences between the clone libraries of the two reactors were determined using the
-LIBSHUFF program (42).
Nucleotide sequence accession numbers.
The sequences reported in this paper have been deposited in the GenBank database under accession numbers DQ074125 to DQ074147, DQ298807 to DQ298832 [hydA], DQ464458 to DQ464598, and DQ482726 to DQ482730.
|
|
|---|
![]() View larger version (34K): [in a new window] |
FIG. 1. Fermentation products in the two reactors. (A and B) H2 production in reactors A and B, respectively. , H2 production rate; , H2 conversion efficiency. (C and D) Concentrations of VFAs and alcohol and pHs in reactors A and B, respectively. , acetic acid; , propionic acid; , butyric acid; , valeric acid; , ethanol; , lactate; , pH. Error bars, means ± standard deviations obtained from three replications.
|
Bacterial community structure.
Preliminary experiments indicated that Archaea and Fungi were not found in the microbial community by PCR amplification with universal primers of small-subunit rRNA (data not shown). Detailed results for the changes in bacterial community structure as assessed by DGGE of the 16S rRNA gene are shown in Fig. 2. In summary, the number of clearly distinguishable DGGE bands of the 16S rRNA gene increased markedly between days 14 and 21, when the fermentation type was becoming established (Fig. 1). After 21 days, new dominant bands appeared and some previously prominent bands disappeared, but the bands within the DGGE profiles of the 16S rRNA gene were relatively constant after day 28.
![]() View larger version (113K): [in a new window] |
FIG. 2. DGGE profiles of the PCR-amplified V3 regions of the 16S rRNA genes in the microbial communities from two reactors. (A) Reactor A; (B) reactor B. Lanes are labeled with the time of sampling. Arrows indicate the DGGE bands selected for cloning and sequencing.
|
|
View this table: [in a new window] |
TABLE 1. Phylogenic affiliations of DGGE bands based on the V3 region of the 16S rRNA gene
|
-LIBSHUFF program (P < 0.05). We obtained a total of 131 OTUs in both reactors.
![]() View larger version (18K): [in a new window] |
FIG. 3. Collector's curves of observed and estimated phylotype richness of 16S rRNA gene clone libraries by the DOTUR program. (A) Reactor A; (B) reactor B. Estimator curves include observed OTUs (bottom), Chao1 (middle), and ACE (abundance-based coverage estimator) (top). Phylotypes were defined using the 99% OTU cutoff.
|
![]() View larger version (28K): [in a new window] |
FIG. 4. Phylogenetic tree derived from 16S rRNA gene clone libraries. Each row represents a different OTU (phylotype). The phyla are color coded as follows, from top to bottom: green, low-G+C-content gram-positive bacteria; blue, Actinobacteria; black, unclassified; yellow, Alphaproteobacteria; red, Bacteroidetes. The relative abundances of phylotypes from the 16S rRNA gene clone libraries of the two reactors are shown on the right in grayscale values. Letters above the abundance graph correspond to two different enrichments.
|
![]() View larger version (14K): [in a new window] |
FIG. 5. Relative abundances of sequences from the 16S rRNA gene libraries of two reactors (A and B). The sequence frequencies are grouped according to phylum. "Unknown" sequences are unclassified.
|
Distribution of hydA clones.
Compelling evidence for the enrichment of HPB was obtained by the identification of hydA. DGGE profiles of hydA expression showed that the H2-producing populations of the two reactors shifted over time (Fig. 6). RT-PCR amplification of hydA was faint on day 0. After 7 days, the intensity and diversity of bands increased. Five prominent bands from the DGGE gel of hydA were excised, reamplified, cloned, and sequenced. The amino acid sequences of the bands were affiliated with the hydA genes of Syntrophomonas wolfei-like, M. elsdenii-like, C. thermocellum-like, and E. harbinense-like organisms (see Table S3 in the supplemental material).
![]() View larger version (82K): [in a new window] |
FIG. 6. DGGE profiles of partial hydA genes in the microbial communities from two reactors (A and B, respectively). Lanes are labeled with the time of sampling. Arrows with numbers indicate the DGGE bands selected for cloning and sequencing. The initial RNA template was standardized for RT-PCR. The PCR product was loaded for every lane and was not standardized.
|
-LIBSHUFF (P > 0.05). The Shannon and Simpson (1/D) diversity indices of HPB were, respectively, 1.9 and 5.0 for reactor A and 2.1 and 7.7 for reactor B. Thus, based on hydA, the community in reactor B was slightly more diverse. We found 4 phylotypes (of the 21 phylotypes) affiliated with the hydA genes of C. thermocellum (58.6%), S. wolfei (60.6%), M. elsdenii (77.8%), and E. harbinense (65.2%) in the DGGE bands and the two clone libraries (see Table S3 in the supplemental material). Therefore, all 17 unique hydA sequences appeared in both reactors.
![]() View larger version (46K): [in a new window] |
FIG. 7. Phylogenetic tree derived from alignments of partial amino acid sequences of [Fe]-H2ases, including the sequences of DGGE bands and clone libraries and sequences from the database. GenBank accession numbers are given in parentheses. Bootstrap values of >50% for neighbor joining are shown (percentages of 1,000 resamplings). Bar indicates 1% divergence. , sequences from the hydA clone library of reactor A; , sequences from the clone library of reactor B; , bands excised from the DGGE gel (see Fig. 6). Numbers after the hyphen (b1 to b5) represent bands. Different clusters of hydA derived from the two reactors are highlighted by different colors.
|
![]() View larger version (30K): [in a new window] |
FIG. 8. Clone libraries of partial hydA genes from reactors A and B. Bar graph shows percentages of Clostridium thermocellum-like (C. t), Syntrophomonas wolfei-like (S. w), Ethanoligenens harbinense-like (E. h), Megasphaera elsdenii-like (M. e), Clostridium saccharoperbutylacetonicum-like (C. s), and Syntrophobacter fumaroxidans-like (S. f) organisms in each library. The number of clones is given in parentheses above each bar.
|
![]() View larger version (53K): [in a new window] |
FIG. 9. Zymograms of ADHs from anaerobic sludge. (A) Reactor A; (B) reactor B. Lanes are labeled with the time of sampling. Roman numerals on the left represent zymotypes. The specificities of ADHs were defined by their activities toward the substrate ethanol.
|
|
|
|---|
16S rRNA gene sequences from clone libraries indicated that the putative HPB were affiliated with nine phylotypes of Ethanoligenens and Megasphaera spp. Clone libraries of the hydA gene confirmed that the HPB were previously undescribed strains affiliated with E. harbinense and M. elsdenii, along with C. thermocellum, S. wolfei, S. fumaroxidans, and C. saccharoperbutylacetonicum (17 phylotypes). Only Ethanoligenens and Clostridium were identified as putative HPB in a previous analysis of an ethanol-H2-coproducing community based on 16S rRNA (with 97% similarity as the threshold) (38). Thus, direct amplification of hydA yielded a more complete view of the bacterial populations associated with H2 production than that provided by 16S rRNA gene analysis.
A striking result is that not all HPB identified by hydA sequences had been described by previous studies based on the 16S rRNA gene. Previous investigations (2, 15, 23, 43, 46) indicated that the dominant populations from hydrogen-producing sludge were Clostridium, Bacillus, and Staphylococcus groups of low-G+C-content gram-positive bacteria; putative HPB were affiliated with Clostridium, Thermoanaerobacterium, Desulfotomaculum, and Thermotogales spp. In contrast, the majority of the dominant populations based on hydA were affiliated with low-G+C-content gram-positive bacteria, Bacteroidetes, and Actinobacteria groups. Furthermore, all these HPB were uncultivated but affiliated with E. harbinense, C. thermocellum, C. saccharoperbutylacetonicum, S. wolfei, S. fumaroxidans, and M. elsdenii.
These results suggest that mesophilic EHCB are enriched by acidophilic conditions. Eleven novel phylotypes closely related to E. harbinense, C. thermocellum, and C. saccharoperbutylacetonicum were the putative EHCB, and the ADH isoenzyme analysis also pointed to an E. harbinense-like organism, which has a high rate of conversion of carbohydrates to H2 and ethanol (53). E. harbinense was also found to be a dominant EHCB in a previous analysis on an ethanol-H2-coproducing community based on the 16S rRNA gene (38). Previous work also has isolated a few EHCB, including mesophilic E. harbinense, thermophilic C. thermocellum, and Thermoanaerobium brockii (4, 26, 38, 53). Low pHs favor Ethanoligenens (38, 52, 53), but acidophilic and mesophilic clostridia that are EHCB have not been described previously.
In addition, M. elsdenii-like, S. fumaroxidans-like, and S. wolfei-like organisms, which are fatty acid-oxidizing bacteria, were among the HPB in the acidophilic sludge. They consume short-chain fatty acids, produce H2, and play a role in buffering against a pH drop (12, 14, 18, 29, 30). These fatty acid-oxidizing HPB were not found in a previous analysis of an ethanol-H2-coproducing community based on 16S rRNA genes (38). Thus, abundant EHCB (11 phylotypes) and fatty acid-oxidizing HPB (6 phylotypes) may play a significant, but previously unrecognized, role during H2 production of the acidophilic sludge.
The sampling interval of 7 days affected the times when strains could "appear" or "disappear" in the DGGE or zymogram. For example, ADH-II (reactor B on day 21) and ADH-III (both reactors on day 35) disappeared from the zymogram, possibly due to insufficient loading of sample DNA. Because long-term monitoring was difficult by several techniques, the experimental results were not exhaustive. The results of analyses could be complicated due to any time lapse. Therefore, continuous monitoring could offset the lapses from some time points.
Two conserved regions, ADLTIMEE and EVMACPGGCI, were found in the large subunit of [Fe]-H2ases by sequence alignment of 14 genera. The ADLTIMEE region is located in the first 50 to 100 amino acid residues of the active-site domain (hydrogen cluster) (35). EVMACPGGCI is located in the C-terminal end of the active-site domain. Both conserved regions belong to
-helix and β-sheet structures (35). The amino acid residues between the ADLTIMEE and EVMACPGGCI regions cover two-thirds of the active-site domain of the large subunit of the [Fe]-H2ases. Therefore, hydA segments of 500 to 600 bp, which are amplified using the pair of degenerate primers designed by us, represent important genetic information on the hydrogen cluster. This approach can be useful for elucidating the relationships between hydA gene expression, the H2 production rate, and the effects of ecological factors on microbial community structure. It will facilitate the identification of novel unknown HPB in the natural environment or in communities by mining of the hydA gene.
Published ahead of print on 21 December 2007. ![]()
Supplemental material for this article may be found at http://aem.asm.org/. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»